ID: 1148029003

View in Genome Browser
Species Human (GRCh38)
Location 17:44607289-44607311
Sequence CTTTATCCACAGATGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148029003_1148029010 14 Left 1148029003 17:44607289-44607311 CCAATGCCCATCTGTGGATAAAG No data
Right 1148029010 17:44607326-44607348 AGAGATTAAGCTGGGCTCAGTGG No data
1148029003_1148029008 5 Left 1148029003 17:44607289-44607311 CCAATGCCCATCTGTGGATAAAG No data
Right 1148029008 17:44607317-44607339 AAGGCTCAGAGAGATTAAGCTGG No data
1148029003_1148029009 6 Left 1148029003 17:44607289-44607311 CCAATGCCCATCTGTGGATAAAG No data
Right 1148029009 17:44607318-44607340 AGGCTCAGAGAGATTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148029003 Original CRISPR CTTTATCCACAGATGGGCAT TGG (reversed) Intergenic
No off target data available for this crispr