ID: 1148032146

View in Genome Browser
Species Human (GRCh38)
Location 17:44628749-44628771
Sequence CTGGGCTGGTACCCCGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148032139_1148032146 -3 Left 1148032139 17:44628729-44628751 CCCCGAAGAGCCTTTAGACACTG No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032140_1148032146 -4 Left 1148032140 17:44628730-44628752 CCCGAAGAGCCTTTAGACACTGG No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032142_1148032146 -5 Left 1148032142 17:44628731-44628753 CCGAAGAGCCTTTAGACACTGGG No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032136_1148032146 6 Left 1148032136 17:44628720-44628742 CCACCGCCACCCCGAAGAGCCTT No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032135_1148032146 7 Left 1148032135 17:44628719-44628741 CCCACCGCCACCCCGAAGAGCCT No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032137_1148032146 3 Left 1148032137 17:44628723-44628745 CCGCCACCCCGAAGAGCCTTTAG No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data
1148032138_1148032146 0 Left 1148032138 17:44628726-44628748 CCACCCCGAAGAGCCTTTAGACA No data
Right 1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148032146 Original CRISPR CTGGGCTGGTACCCCGAGTC AGG Intergenic
No off target data available for this crispr