ID: 1148037133

View in Genome Browser
Species Human (GRCh38)
Location 17:44673211-44673233
Sequence GTTTCCCCCAGCATGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148037133 Original CRISPR GTTTCCCCCAGCATGGTGTC AGG Intronic
900116783 1:1032497-1032519 GAGTCCCCCAGCCGGGTGTCTGG - Intronic
900478961 1:2889181-2889203 GTTTCCCAAAGCTTGATGTCTGG - Intergenic
900736935 1:4305044-4305066 GCTTCCCCCAGCAAGGTTCCTGG + Intergenic
902048583 1:13544043-13544065 CTGTCCCCCAGCATGATGCCTGG - Intergenic
902835704 1:19045364-19045386 GTCTTCCCCAGCCTGGTTTCTGG - Intergenic
903325968 1:22568712-22568734 TGTTCCCCCAGCACGGTGCCTGG - Intronic
903864600 1:26389111-26389133 TTTGCCCCCAGCATGGGGTCCGG - Intergenic
906069122 1:43004800-43004822 GTTTCCCCCATCCTGTTCTCAGG - Intergenic
906839516 1:49121704-49121726 GGTTCTCCCAGCATGGCGTTTGG - Intronic
907237957 1:53064217-53064239 GTCTCCCCAAGCATGGAGTGGGG - Intronic
910552609 1:88493608-88493630 CTTCCTCCCAGCATGATGTCTGG + Intergenic
911015192 1:93324711-93324733 TTATCTCCCAGCATGGTGCCTGG + Intergenic
916966056 1:169944498-169944520 GTTTCCCACAACATGGTGAGTGG + Intronic
922704129 1:227780097-227780119 GTCTCACCCAGCATAGTGGCTGG + Intronic
923654612 1:235904837-235904859 CCTGCCCCCAACATGGTGTCTGG - Intergenic
1062943050 10:1438857-1438879 GTCTCCCCCAGGATGGAGGCAGG + Intronic
1062943081 10:1438993-1439015 GTCTCCCCCAGGATGGAGGCAGG + Intronic
1062943340 10:1440177-1440199 GTCTCCCCCAGGATGGAGGCAGG + Intronic
1067157622 10:43795265-43795287 GTGTCCCTCAGCAGGGTGACAGG + Intergenic
1067230307 10:44402633-44402655 GTATCCCCCAGCATGGAGTAGGG - Intergenic
1068521331 10:58080718-58080740 GTTTCCCCCAGTGTGGTGCGGGG - Intergenic
1069011340 10:63376806-63376828 ATTTCCACCAGCATTGTGTAAGG - Intronic
1071553588 10:86585680-86585702 GTAGCCCCCAGCAGGGTGTGGGG - Intergenic
1072485250 10:95848379-95848401 TTTTCCACAAGCTTGGTGTCAGG + Intronic
1074698127 10:116069336-116069358 GTTTCCCCCAACTTAGAGTCAGG - Intronic
1075641796 10:124070018-124070040 GTCCCCCCCAGCACGTTGTCAGG + Intronic
1076084999 10:127619748-127619770 GTTTTTCCCAGCATGGTGATGGG + Intergenic
1076209707 10:128630498-128630520 GTTTCCCCCATCCTGTTCTCAGG + Intergenic
1077556932 11:3230435-3230457 GCGTCCCCCTGCATGGTCTCGGG - Intronic
1078063343 11:8062062-8062084 GAGTCCCCCAGCCTGTTGTCAGG - Intronic
1084728547 11:71058592-71058614 GGTGCCCCCAGCCCGGTGTCAGG - Intronic
1085823375 11:79817165-79817187 CTTTCCCCCTGCATAGTGTCAGG + Intergenic
1088937616 11:114419481-114419503 CTTCCTCACAGCATGGTGTCTGG + Intronic
1091556508 12:1577567-1577589 GTTTCCTCCAGCCTGGGGGCGGG - Intronic
1094623841 12:32105029-32105051 GTTTCCACTAGCAGGCTGTCTGG - Intergenic
1096597321 12:52704546-52704568 CTTTTCCCCAGGATGCTGTCTGG - Intergenic
1098966432 12:76794032-76794054 ATTTAGCCCAGCATGGTGGCAGG - Intronic
1102637964 12:114341008-114341030 ATTTCCCCCAGCCTAGTGCCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106542593 13:30703535-30703557 GTGTCCCCCAACATTGTATCAGG + Intergenic
1107414496 13:40188313-40188335 GTCGCCCCCAGCTTGGAGTCGGG - Intergenic
1108017187 13:46087662-46087684 GTTTCCTCCTGTATGTTGTCTGG - Intronic
1110267252 13:73552403-73552425 CTTTCTCCCAGCCTGGTATCTGG - Intergenic
1110709356 13:78633105-78633127 GTTTCCCACAGCATGCTGAATGG - Intronic
1112161492 13:96872997-96873019 GTTTCCCCCAGGCTGTTCTCGGG + Intergenic
1114897670 14:27011596-27011618 GCTCCTCACAGCATGGTGTCTGG - Intergenic
1116421031 14:44732408-44732430 GTTAAACCAAGCATGGTGTCAGG - Intergenic
1117659765 14:57991552-57991574 GCTTCCCAAGGCATGGTGTCAGG + Intergenic
1117717941 14:58599898-58599920 GTTTCCCACAGCATGGCAGCTGG - Intergenic
1121212868 14:92222074-92222096 AATTACCCCAGCATGGTGGCCGG + Intergenic
1121415491 14:93776443-93776465 GTAGCCCCCAGCCTGGTTTCAGG + Intronic
1125543510 15:40486535-40486557 GTTTCCCCGCGCTTGGTGTGGGG - Intergenic
1128976292 15:72156105-72156127 GTTTTCCCCAGCAAGGGGACAGG + Intergenic
1130624672 15:85501816-85501838 GTTTAACCCTGCATGGTGTAGGG + Intronic
1131178362 15:90224038-90224060 CTTGCTCCCAGCATGGTGTGGGG - Intronic
1135583233 16:23646039-23646061 GTTTCCACCAGCATTGTGCAGGG + Intronic
1136282471 16:29221977-29221999 TTTTTCCCCAGCAGGGTCTCAGG + Intergenic
1136398514 16:30005593-30005615 GTGTCCCCCAGGAGGGTGGCAGG + Exonic
1136596840 16:31256619-31256641 GCTTCTCGCAGCATGGTGGCTGG - Intergenic
1141345308 16:83239483-83239505 GATGCCCCCAGCTTGGTGGCTGG - Intronic
1142086846 16:88187901-88187923 TTTTTCCCCAGCAGGGTCTCAGG + Intergenic
1142137336 16:88457522-88457544 GTTCCCCTCAGGATGGTGACTGG - Intronic
1142808557 17:2384691-2384713 GTCTCCCCCAGAGTGCTGTCGGG - Exonic
1143465543 17:7133991-7134013 GTTTCCCCCGGCCCGGAGTCGGG + Intergenic
1143581972 17:7833060-7833082 TTTCTCCCCAGGATGGTGTCTGG + Exonic
1148037133 17:44673211-44673233 GTTTCCCCCAGCATGGTGTCAGG + Intronic
1150924352 17:69516975-69516997 ATTTTCCCTAGCATGCTGTCAGG + Intronic
1151798340 17:76362019-76362041 CCTGCCCCCAGCATGGTTTCTGG - Intronic
1153714263 18:7830278-7830300 GTTTCCCCCAGCCATGTGACTGG + Intronic
1158441231 18:57476075-57476097 GCTTCCCCCACCCTGGCGTCTGG + Intronic
1159723033 18:71917222-71917244 GTTTCCCCCTGCTTGGTATAGGG - Intergenic
1160392723 18:78547344-78547366 GTTCTCCCCAGCAGGGTCTCCGG + Intergenic
1164617854 19:29677373-29677395 GTCTCCCCCACCATGCTGTGCGG - Intergenic
1165348591 19:35264566-35264588 GTTTCCTTCAGGAGGGTGTCTGG + Intronic
926253000 2:11166456-11166478 CTTTCCCCCAACATCTTGTCTGG + Intronic
927081726 2:19636870-19636892 GTTTCCCCCAGCCTAGAGCCAGG - Intergenic
927690527 2:25204767-25204789 GTTTCCGCCTGCACAGTGTCAGG - Intergenic
931094424 2:58923034-58923056 GATTCCCCAAACATGGTTTCTGG - Intergenic
936162185 2:110092261-110092283 ATGTCCCACAGCATGGTGTGAGG - Intronic
936182477 2:110279093-110279115 ATGTCCCACAGCATGGTGTGAGG + Intergenic
936287042 2:111188968-111188990 CTACCCCACAGCATGGTGTCTGG + Intergenic
937885012 2:126893707-126893729 GCTTCTCCCAGCATGGTGGCTGG + Intergenic
942304591 2:174593779-174593801 CTTCCCCCCAGCATGTGGTCTGG + Intronic
944911323 2:204313287-204313309 GTTTCCTACAGCATGTTGTAAGG - Intergenic
945816781 2:214614368-214614390 CTTCCCCTCAGCATGGTGGCTGG + Intergenic
948299264 2:236889855-236889877 GTTTCCCTTAGCAGGGTGCCAGG + Intergenic
948827540 2:240579969-240579991 GTTTCCCAAAGCCAGGTGTCAGG - Exonic
948942540 2:241203532-241203554 GGCCCCCCCAGCTTGGTGTCAGG + Intronic
949039546 2:241841448-241841470 GTATCCACCATGATGGTGTCAGG - Intergenic
1170613055 20:17929643-17929665 GTCCCCACCAGCATGGTGCCTGG + Intergenic
1172510130 20:35494864-35494886 GTATCCCCAAGCATGGTGCCTGG - Intronic
1172804954 20:37605111-37605133 GTTTCCCACAGAATGGTGGTCGG - Intergenic
1172880807 20:38198855-38198877 CTTCCCCACAGCATGGTGGCTGG + Intergenic
1174203063 20:48820479-48820501 TTTTCACCCAGCAGAGTGTCTGG - Intronic
1174624495 20:51903088-51903110 GCTTCCCTCAACATGGTGGCTGG - Intergenic
1175272183 20:57742142-57742164 TTTTCCCCCAGCATCGTGGTAGG - Intergenic
1176106406 20:63391644-63391666 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1176921122 21:14688628-14688650 GTTTCCACCAGAAGGTTGTCTGG + Intergenic
1177828718 21:26112728-26112750 GTTTCCCCCAGAATATTCTCTGG + Intronic
1178432635 21:32529927-32529949 CCTCCACCCAGCATGGTGTCTGG - Intergenic
1178790707 21:35697403-35697425 GGTTCCCCCAGTGTTGTGTCTGG - Intronic
1179818268 21:43921897-43921919 GTCTCCCCCACCAAGGTGTGGGG + Intronic
1179837183 21:44043823-44043845 CTTCCCCACAGCATGGTGGCTGG - Intronic
1181979906 22:26759042-26759064 GCTCTCCCCAGCATGGTGTGAGG + Intergenic
1183797862 22:40135121-40135143 GTTTCTCACAGCATGGTGGCAGG + Intronic
1184003843 22:41694606-41694628 GTTTCTCCCACTGTGGTGTCTGG - Exonic
1184003880 22:41694834-41694856 GCTTCTCCCACCTTGGTGTCTGG - Exonic
949142247 3:648824-648846 TTTCTCCTCAGCATGGTGTCTGG - Intergenic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
950810762 3:15647973-15647995 GTTTCCCTCAGCAGGGGCTCTGG - Intergenic
951566742 3:24019255-24019277 GTTGCCCACAGCATGGTGAGCGG + Intergenic
952116562 3:30188825-30188847 CTTTCTCCTAGCATGGTGGCTGG - Intergenic
952404389 3:32992602-32992624 CTTTCCATCAGCATGGTCTCGGG - Intergenic
953020262 3:39108509-39108531 GTTACCCTTAGGATGGTGTCTGG + Intronic
953474321 3:43193131-43193153 GTTTCCCCCAGTATGGTCCCAGG - Intergenic
953568241 3:44051426-44051448 ATGTCCCCCAGCATGGTGGAGGG - Intergenic
955803726 3:62712307-62712329 ATTCCCCCCAGCAAGGTGTGAGG + Intronic
958454732 3:94316230-94316252 CTTTCCCACAACATGGTGGCTGG + Intergenic
964127437 3:153250075-153250097 GTTTCCCAAAGCATGGTCTGAGG + Intergenic
964392287 3:156210580-156210602 GCTGCTCTCAGCATGGTGTCAGG - Intronic
965311117 3:167129992-167130014 GCTTCTCCCAGCATGGAGTTTGG + Intergenic
966203603 3:177383040-177383062 CTTTTTCACAGCATGGTGTCCGG - Intergenic
967108392 3:186272045-186272067 GTACCCCCTAGCATGGTGCCTGG + Intronic
967206952 3:187132589-187132611 GTTTCCCCCCGTATGGTTTATGG + Intronic
968582165 4:1400251-1400273 GTGTCCCCCACTTTGGTGTCAGG - Intergenic
969126315 4:4951004-4951026 GGTTCCCTCAGCACTGTGTCTGG + Intergenic
973534258 4:51865486-51865508 ATTTCCCCCAGCAAGCTCTCTGG - Intronic
974125251 4:57688078-57688100 CTTCCCCACAGCATGGTGACTGG + Intergenic
976654820 4:87477590-87477612 GCTGCCCACAGCATGGTATCTGG - Intronic
976876237 4:89856770-89856792 GGTTCTCCCAGCATGGAGTTTGG + Intergenic
980189162 4:129501354-129501376 GTTCCTCACAGCATGGTGCCTGG + Intergenic
981026323 4:140080354-140080376 GTTACTCAAAGCATGGTGTCTGG + Intronic
981616656 4:146649993-146650015 GTTTCACCAAGCATGTTGGCAGG - Intergenic
983641395 4:169946867-169946889 GTTTCTCACAGCATGGTGGTGGG + Intergenic
985618233 5:937419-937441 ATGTCACCTAGCATGGTGTCTGG - Intergenic
986015453 5:3753435-3753457 CCTCCCCCCAGCCTGGTGTCTGG - Intergenic
986336445 5:6759190-6759212 GTAGCCCCCAGCGTGGTGTCTGG - Intergenic
987419769 5:17705616-17705638 GCTTCTCACAGTATGGTGTCTGG - Intergenic
988803570 5:34719265-34719287 CTTTCTCACAGCATGGTGGCTGG + Intronic
995857569 5:116609418-116609440 GTTTCCGCCAGCTGGGTGCCTGG - Intergenic
997461046 5:134052767-134052789 GCTCCCCACAGCATGGTGTCGGG - Intergenic
998482588 5:142475091-142475113 CTTGCCCCCAGCATGGTGTGGGG - Intergenic
999583176 5:153062326-153062348 GTTTATCCCTGCATGGTGTGTGG - Intergenic
1001534351 5:172488378-172488400 GTTTCCCCCTGCCTGGTGCATGG + Intergenic
1003316249 6:5014634-5014656 GTTTCCCCCAGTCTTGTATCTGG - Intergenic
1004431210 6:15545709-15545731 GTTTCCTGCAGCATGGTTTTAGG - Intronic
1006410477 6:33870697-33870719 GCTTCCCCCAGTATGGGGTGTGG + Intergenic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1008633208 6:53383352-53383374 GGTTCTCCCAGCACGGTGTTTGG + Intergenic
1011062956 6:83292619-83292641 GGTTCTCCCAGCATGGCGTTTGG - Intronic
1015247892 6:131095311-131095333 GTCTCCCCCAGGTTGGTATCAGG - Intergenic
1017442023 6:154473512-154473534 TTCTCCCCCAGCATCGTGGCAGG - Intronic
1018026015 6:159806393-159806415 TTTTCCCCCAGCATGTGGTGTGG + Intronic
1018500937 6:164410722-164410744 GCTTCCCCCAGCAGGCTGGCTGG + Intergenic
1018727327 6:166623736-166623758 GTGTGCCCCAGAAAGGTGTCAGG - Intronic
1018739154 6:166714155-166714177 GTTACCCCCAGCACGCTGTGGGG + Intronic
1021913648 7:25410384-25410406 CTTTCCTCTTGCATGGTGTCTGG - Intergenic
1022139142 7:27477288-27477310 GCCTCTCACAGCATGGTGTCTGG - Intergenic
1023043680 7:36193853-36193875 CTCTCCCACAGAATGGTGTCAGG - Intronic
1023521534 7:41054757-41054779 GCTTACCCCAGCATGAAGTCTGG + Intergenic
1026894844 7:74004029-74004051 GTGTCCTCCAGCTTGTTGTCAGG + Intergenic
1029851455 7:103465623-103465645 AATTACCCCAGCATGGTGACGGG - Intergenic
1030437280 7:109539152-109539174 ATTTCCACCAGCATGGTTTGAGG + Intergenic
1031018231 7:116598427-116598449 GCTTCTCCCAGCATGCTGGCTGG - Intergenic
1032135662 7:129274702-129274724 GATTCTCACAGCATGGTGACCGG - Intronic
1032276484 7:130460819-130460841 GTTTCCCCCAACAGTGTCTCAGG + Intergenic
1032486585 7:132292246-132292268 GTGTCCCCCAGTGTGGTATCAGG + Intronic
1032580616 7:133099962-133099984 GTTCTCCACAGCATGGTGACTGG - Intergenic
1038186245 8:25277660-25277682 GTTTCCTCCAACATGGTGGGTGG - Intronic
1042752758 8:72176221-72176243 GTGTCCCACAGCATGGACTCTGG + Intergenic
1043761641 8:84075913-84075935 GATTCAGCCAGCATGGTGCCAGG - Intergenic
1044370570 8:91405575-91405597 GTATCAACCAGCATGGTGCCTGG - Intergenic
1045422609 8:102031144-102031166 ATTTCCTGCAGCATGGTGGCTGG - Intronic
1047251944 8:123187266-123187288 GGTTCCCAAAGCATGGTGTGGGG + Intronic
1049279528 8:141737250-141737272 GCTTCAGCCAGCATGGGGTCAGG - Intergenic
1050290951 9:4154091-4154113 GCTTCCCACAGCATGGTGGCTGG + Intronic
1050525669 9:6544234-6544256 GTTTCCCCGAGAATGAGGTCAGG + Intronic
1056690303 9:88802704-88802726 CTTCCCCACAGCATGGTGACTGG - Intergenic
1056809192 9:89751077-89751099 CTTTCTCACAGCATGGTGGCTGG + Intergenic
1059248886 9:112870715-112870737 GATTCTCCCAGCACAGTGTCAGG - Exonic
1061950264 9:133932136-133932158 GTTTGCCCCAGCTTGGAATCCGG - Intronic
1186543300 X:10422843-10422865 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1189147012 X:38665766-38665788 GTTATACCCAGCTTGGTGTCAGG + Intronic
1189150222 X:38699098-38699120 GTGTCCCCCAGCATGGTTGTGGG + Intergenic
1189161459 X:38813406-38813428 GCTTCCTCCAGCATGGTAGCTGG - Intergenic
1195200288 X:102543304-102543326 CTTTACCCTAGCATGGTGTAGGG - Intergenic
1196820482 X:119696622-119696644 CTTGGGCCCAGCATGGTGTCTGG + Intergenic
1197845472 X:130797499-130797521 GTTTCCCCAAGCCTAATGTCAGG - Intronic
1198154714 X:133947379-133947401 GTTGGCCCCAGAATGGTCTCTGG + Intronic
1198411045 X:136368514-136368536 GCTTCTTACAGCATGGTGTCTGG - Intronic
1199978123 X:152906078-152906100 CTTTCTCCCCTCATGGTGTCTGG - Intergenic