ID: 1148037852

View in Genome Browser
Species Human (GRCh38)
Location 17:44681838-44681860
Sequence GTGGATATGCGGAGTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148037852_1148037858 8 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037858 17:44681869-44681891 ATAGATTACTGCCATTTTAGAGG 0: 1
1: 0
2: 4
3: 33
4: 344
1148037852_1148037859 9 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037859 17:44681870-44681892 TAGATTACTGCCATTTTAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 302
1148037852_1148037862 28 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037862 17:44681889-44681911 AGGGGAAAATTAAGCTATAGAGG 0: 1
1: 0
2: 1
3: 19
4: 234
1148037852_1148037863 29 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037863 17:44681890-44681912 GGGGAAAATTAAGCTATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 185
1148037852_1148037864 30 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037864 17:44681891-44681913 GGGAAAATTAAGCTATAGAGGGG 0: 1
1: 0
2: 3
3: 28
4: 283
1148037852_1148037860 10 Left 1148037852 17:44681838-44681860 CCAATATCACTCCGCATATCCAC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1148037860 17:44681871-44681893 AGATTACTGCCATTTTAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148037852 Original CRISPR GTGGATATGCGGAGTGATAT TGG (reversed) Intronic
907105977 1:51883033-51883055 TTGGATTTGAGGAGTGATAGTGG + Intergenic
910134665 1:83953449-83953471 ATGAATATTTGGAGTGATATAGG - Intronic
912859910 1:113204667-113204689 GTGGATATGGTGAGAGATAGGGG + Intergenic
919593593 1:199534084-199534106 GTGGAAATGCAGAATGGTATAGG - Intergenic
921592017 1:217015125-217015147 GTGGGTATGTGGAGTAGTATAGG - Intronic
923732518 1:236566451-236566473 GAGGATATTCAGAGTGCTATGGG + Intronic
1064179510 10:13102041-13102063 GTGGAAATGCAGAGTGTTCTTGG + Intronic
1064741241 10:18437211-18437233 GTGGATATCAGGAGAGATACTGG - Intronic
1066816125 10:39416156-39416178 GTGGATATTTGGAATGATTTGGG + Intergenic
1066816154 10:39416840-39416862 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1066816363 10:39420920-39420942 GTGGATATTTGGAGGGATTTTGG + Intergenic
1066817502 10:39438482-39438504 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1066821816 10:39503301-39503323 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1067985206 10:51136157-51136179 GTGGATATGGGGTGTGAGAGAGG + Intronic
1074294548 10:112171629-112171651 GTGCAAATGCGGAGAGATACAGG - Intronic
1076581149 10:131512595-131512617 GTGCATATGCTGTGTGTTATGGG + Intergenic
1078831067 11:14977614-14977636 GTGGATATGGGGGTTGAGATGGG + Intronic
1079650473 11:22922212-22922234 GTGGGTATGCTAAGTGATCTTGG + Intergenic
1082318471 11:50762895-50762917 GTGGATATTTGGAGCGATATTGG - Intergenic
1082605828 11:55231376-55231398 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1087789776 11:102393672-102393694 GTGGACATGCAGAGAGATCTTGG + Intergenic
1095061306 12:37694223-37694245 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1095063359 12:37732119-37732141 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1099266093 12:80449684-80449706 GTAGATATGCGGCATGATTTCGG + Intronic
1105138202 13:17060679-17060701 GTGGATATTTGGAGTGCTCTGGG + Intergenic
1105144383 13:17161468-17161490 GTGGATATTTGGAGTGCTCTGGG + Intergenic
1109360822 13:61292941-61292963 GTGGATCTGCGAAGTGATGATGG - Intergenic
1113721997 13:112565049-112565071 GAGGATATGATGAGTGGTATAGG - Intronic
1113999198 14:16134189-16134211 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1114866929 14:26606920-26606942 GTGGAATTGCTGAGTCATATGGG - Intergenic
1116586025 14:46705777-46705799 ATGGATATGCAGAGTGTTAAAGG + Intergenic
1123226414 15:17038237-17038259 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1123243256 15:17326293-17326315 GTGGATATTTGGAGAGATTTGGG + Intergenic
1123884482 15:24711145-24711167 TTGGATATGGTGAGTGATAAGGG + Intergenic
1130937732 15:88484642-88484664 GTGGAGATGGGGAGTGTTACAGG - Intergenic
1134901784 16:17944609-17944631 GGGGGTTTGGGGAGTGATATGGG + Intergenic
1137080426 16:36045024-36045046 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1142399048 16:89849699-89849721 GTGGTTCTGTGGAGTGATATGGG - Intronic
1148037852 17:44681838-44681860 GTGGATATGCGGAGTGATATTGG - Intronic
1149086186 17:52719093-52719115 GAGGATATAAGGAGTAATATGGG + Intergenic
1153925526 18:9832065-9832087 GTGGATACGCCGAGCGATCTGGG + Intronic
1154495033 18:14949666-14949688 GTGGAAAGGCCGAGTGGTATAGG - Intergenic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1158641962 18:59211583-59211605 GTGGAAATGCAGAATGCTATAGG + Intergenic
1164341445 19:24404937-24404959 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1164350774 19:27337061-27337083 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1167011089 19:46808338-46808360 GTGGAAATCCTGAGTGATAGTGG - Intergenic
926545419 2:14234005-14234027 GTTGATATGCTGTGTGATCTTGG - Intergenic
930027292 2:47036913-47036935 GGGGATATGCTGAGTGATCTAGG - Intronic
932927683 2:75995288-75995310 ATGGATATGCAGAAAGATATAGG - Intergenic
933289713 2:80424454-80424476 TTTGATATGCTGGGTGATATTGG + Intronic
936388105 2:112048353-112048375 GTGGATATGAGGAGTGCTTTTGG - Intergenic
937961414 2:127463048-127463070 GGGGAAATGGGGAGTGTTATGGG + Intronic
1171736121 20:28787821-28787843 GTGGATATTTGGAGCGATTTGGG - Intergenic
1171761608 20:29204984-29205006 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1171821835 20:29854865-29854887 GTGGATATGTGGAGCCATTTGGG + Intergenic
1171825258 20:29894442-29894464 GTGGATATTTGGAGTGGTTTGGG + Intergenic
1171830009 20:29984267-29984289 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1175293130 20:57891471-57891493 GTGAATATCTGGAGTGATTTTGG - Intergenic
1176535660 21:8046412-8046434 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1176700828 21:10047894-10047916 GTAGATATGCGGCGTTATTTCGG - Intergenic
1177940010 21:27398527-27398549 GTGGGAATGAGGAGTGCTATGGG - Intergenic
1179325742 21:40342505-40342527 GTGGATATGAAGTGTGATGTAGG + Intronic
954321254 3:49833417-49833439 GTGGATATGGGGAGTGAGGGAGG - Intronic
956931286 3:74046250-74046272 TTTGATATGGGGAGTGTTATGGG + Intergenic
957366789 3:79235305-79235327 TTGCATTTGGGGAGTGATATTGG + Intronic
958206179 3:90397518-90397540 GTGGATATTTGGAGTGCTTTAGG - Intergenic
965705729 3:171506001-171506023 ATGGATTTGCTGAGTCATATGGG + Intergenic
966601343 3:181778292-181778314 ATTGATATGCGGTGTGCTATGGG - Intergenic
973389929 4:49546300-49546322 GTGTATATGCCCTGTGATATTGG + Intergenic
975992559 4:80272915-80272937 TTGGAAATACGGAATGATATTGG - Intronic
984657478 4:182334763-182334785 TTGAATATGCTGAGAGATATGGG - Intronic
989864974 5:46490787-46490809 GTGGATATTTGTAGTGATTTGGG + Intergenic
989881298 5:46789497-46789519 GTGGATATTTGTAGTGATTTGGG + Intergenic
1002394947 5:178945472-178945494 GTGTGTATGTGGAGGGATATGGG + Intronic
1202774080 5_GL000208v1_random:47197-47219 GTGGATATTTGGAGTGCTTTGGG - Intergenic
1009499632 6:64394463-64394485 GTAGATATGCGGCGTTATTTCGG - Intronic
1010331780 6:74631182-74631204 GTGGAAATGGGGAGTCATAAGGG - Intergenic
1010780381 6:79939347-79939369 GTGGATATGCTTAATGATACTGG - Intronic
1014002980 6:116385495-116385517 TTGGATATGGAGAGTGAAATAGG + Intronic
1014577890 6:123095966-123095988 GTGGATTTGCGGAGTTAATTAGG + Intergenic
1023019785 7:36001133-36001155 CTTGAAATGGGGAGTGATATAGG + Intergenic
1023092861 7:36632803-36632825 ATGGCTATGAGGAGTGTTATGGG + Intronic
1023720307 7:43086413-43086435 TTGTATATGAGGAGAGATATGGG - Intergenic
1025489631 7:61098490-61098512 GTGGACATTTGGAGTGATTTGGG + Intergenic
1036701657 8:11017249-11017271 ATGGATATGCGTATAGATATAGG + Intronic
1039066684 8:33614688-33614710 CTGAATATTGGGAGTGATATGGG + Intergenic
1040141172 8:43915906-43915928 GTGGATATTTGGAGTGCTTTAGG + Intergenic
1040170171 8:44403088-44403110 GTGGATATTTGGAATGATTTGGG + Intergenic
1040240637 8:45445003-45445025 GTGGATATTTGGAATGATTTGGG + Intergenic
1040273756 8:45987451-45987473 GTGGATATTTGGAGGGATTTGGG + Intergenic
1047592930 8:126346267-126346289 GTAGATATGCGGTGTTATTTCGG - Intergenic
1055105246 9:72505328-72505350 GAGGATAAGCAGAGTGTTATGGG - Intergenic
1055349844 9:75375248-75375270 AGGGATATGCAGAGTGTTATTGG - Intergenic
1203357090 Un_KI270442v1:165045-165067 GTGGATATTTGAAGTGATTTGGG + Intergenic
1203398728 Un_KI270519v1:57100-57122 GTGGATACTTGGAGTGATTTGGG + Intergenic
1203400730 Un_KI270519v1:92623-92645 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1203409472 Un_KI270538v1:90572-90594 GTGGATATTTGTAGTGATTTGGG - Intergenic
1188770521 X:34147941-34147963 GTGGATATATGGAGTGGGATGGG + Intergenic
1190685339 X:52868120-52868142 GTGGACATGCGCAGTGAGGTCGG + Intergenic
1191000777 X:55658004-55658026 GTGGACATGCGCAGTGAGGTCGG + Intergenic
1191569305 X:62588724-62588746 GTGGATATTTGGAGTGCTTTGGG + Intergenic
1201064671 Y:10085133-10085155 GTGGATATTTGGAGTGATTTGGG - Intergenic