ID: 1148044449

View in Genome Browser
Species Human (GRCh38)
Location 17:44734174-44734196
Sequence CTGCTGAACTGAAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148044446_1148044449 -7 Left 1148044446 17:44734158-44734180 CCAGAGGTAGGTCATCCTGCTGA 0: 1
1: 0
2: 1
3: 23
4: 118
Right 1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG 0: 1
1: 0
2: 0
3: 21
4: 255
1148044445_1148044449 2 Left 1148044445 17:44734149-44734171 CCAAAGAAGCCAGAGGTAGGTCA 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG 0: 1
1: 0
2: 0
3: 21
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148044449 Original CRISPR CTGCTGAACTGAAGGACAAA TGG Intronic
903295134 1:22338943-22338965 CTGCTGAGCAGAAGCAAAAAGGG - Intergenic
906819628 1:48915747-48915769 CTGCTGTACTAAAGGATAGAAGG + Intronic
908671034 1:66547963-66547985 TTGGTGAACTCAAGGACAAGAGG + Intronic
909528762 1:76658005-76658027 CTGGCGAACTGCAGGAGAAAGGG + Intergenic
911034481 1:93526381-93526403 CTGCTGACCTTAAGGAGACATGG - Intronic
911881564 1:103245651-103245673 CCACTGAAATGAAGGAGAAAGGG - Intergenic
912423619 1:109566089-109566111 CTCTTGAACTGATGGTCAAAGGG + Intronic
915049406 1:153051837-153051859 GAGCTGAACTGAAGGACACTGGG + Intergenic
915196181 1:154191668-154191690 CTGCTGAATTTAAGTAGAAATGG - Intronic
917254043 1:173095550-173095572 CTGCAGTACTGAATGACCAAGGG + Intergenic
919528798 1:198689129-198689151 CTTCTGAAAAGAAGGACAAGAGG - Intronic
920097576 1:203496587-203496609 CTGCTGCAGTGAAGGCCAAGAGG - Intronic
921208634 1:212872791-212872813 GTGATCAACAGAAGGACAAAAGG - Exonic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922617608 1:226972040-226972062 CTGCAAGACTGAAGGATAAATGG - Intronic
923472500 1:234304590-234304612 GAGCTGAACCGAAGGACTAAAGG - Intronic
924957472 1:248943719-248943741 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1062795139 10:339153-339175 CTGCTGAACTGCATGGGAAAGGG + Intronic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063260536 10:4384539-4384561 CTGCTCTATTGAAGGACTAAGGG + Intergenic
1064237853 10:13593106-13593128 ATTCTGAAATGAAGGACCAATGG + Intronic
1064513714 10:16123524-16123546 CTGCTGACATGAAGCTCAAAGGG + Intergenic
1064578957 10:16774056-16774078 CTGATGAACAGAAAGAAAAATGG + Intronic
1064984217 10:21193600-21193622 CTGAGCAACAGAAGGACAAAGGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065838052 10:29677173-29677195 CTGCTGAGCTGAAGGCAAAAAGG - Intronic
1070754071 10:78980846-78980868 CTGCAGAAGCGGAGGACAAATGG - Intergenic
1070974895 10:80598681-80598703 CTGTTGAACTGAATAACTAATGG - Intronic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1073453526 10:103623179-103623201 CTGCTGAACGGAATGACACAAGG + Intronic
1073528743 10:104211543-104211565 CTGCTGAACTCAGGGGCGAAAGG - Intronic
1081401009 11:42642866-42642888 CTGTGCAACTGAAGGAGAAAAGG + Intergenic
1085759230 11:79227549-79227571 CTGCTGCACTGAAGCCCAAGAGG + Intronic
1086240721 11:84686956-84686978 CTCCTAAACTGAAGGACTAAAGG - Intronic
1086269912 11:85050169-85050191 CTTCTGAACTGAGGGTAAAAAGG + Intronic
1086876125 11:92097670-92097692 ATGCTAAACTGAATGAAAAATGG + Intergenic
1087113289 11:94494319-94494341 GTGCTGAACTCAAGGACCTAGGG - Intronic
1087324846 11:96709228-96709250 CCACTAAACTGAAGAACAAATGG - Intergenic
1087650700 11:100863624-100863646 TTGTTGAACTGAAGGACAGAAGG + Intronic
1088514504 11:110615570-110615592 CTCCAGAACAAAAGGACAAATGG - Exonic
1090239368 11:125171246-125171268 TTGCTGAATGGAAGAACAAAGGG - Intronic
1092764158 12:11837531-11837553 CTGCTGAAGTGGGGAACAAACGG - Intronic
1095291628 12:40485392-40485414 CAGCTGAAGTGACGGACAATTGG + Exonic
1099264273 12:80424875-80424897 TTGCTGCACTTAAGCACAAATGG - Intronic
1101617299 12:106350729-106350751 CTGGTTAACTGAAGCAGAAAAGG + Intergenic
1104509297 12:129361454-129361476 CTGCAGAAATAAAGGGCAAATGG + Intronic
1106077827 13:26476053-26476075 ATGCTGAACTGAATGACAGCAGG + Intergenic
1106244175 13:27933228-27933250 CCACTGGACTGGAGGACAAAGGG - Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107382742 13:39875176-39875198 CTGCTGAGCTGACTGACATAAGG + Intergenic
1107434585 13:40371108-40371130 CTGCTGAGCTGAATGACAGGAGG - Intergenic
1107905093 13:45054311-45054333 CTGCTGGACTTAAGGAGCAAAGG + Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108349491 13:49578504-49578526 CTGAGGAACTGAAGGTCTAATGG + Intronic
1108551520 13:51550324-51550346 CTTCTGAAGGGAAGGACAAGAGG + Intergenic
1110090684 13:71443472-71443494 CTGCTGAACTGAAAAGCTAAGGG - Intronic
1110879090 13:80548296-80548318 ATGCTGAACTACAGAACAAAGGG - Intergenic
1111958696 13:94785427-94785449 CTGCCCAACTGAATGAAAAATGG - Intergenic
1115067901 14:29287196-29287218 GTGCTGAACTGAAGCACAGATGG - Intergenic
1115342516 14:32307676-32307698 ATGGAGAACTGAAGGAAAAAGGG + Intergenic
1116781996 14:49246204-49246226 CAGCAGAACTGAAGGAGATAGGG + Intergenic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1122023574 14:98858877-98858899 CTGGTGAGCTGAAGCACATATGG - Intergenic
1122322746 14:100865530-100865552 CTGATGGGCAGAAGGACAAAGGG - Intergenic
1122788011 14:104172830-104172852 CTGCCGAACTGAAAGGCAGAGGG + Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1125305221 15:38304682-38304704 CTGCTGAAATGAAGACCAGAAGG - Intronic
1125429632 15:39581688-39581710 TTGCTGAAATGAAGGACAACAGG - Intronic
1127862812 15:63008600-63008622 CTCCTGGGCTGAAGGATAAAAGG + Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1133363923 16:5196102-5196124 CTGCTCATGTGAAGCACAAAGGG - Intergenic
1134367718 16:13594822-13594844 CTCCTGGACTGAAGGACCACGGG + Intergenic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1137700698 16:50495788-50495810 CTTCAGAACTGAAGGACTGAAGG - Intergenic
1137793208 16:51192735-51192757 CTGGTACACTGAAGGACACAGGG - Intergenic
1138620507 16:58207293-58207315 CTTCTGAACAGAAGGCCTAAGGG - Intergenic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1142902753 17:3023284-3023306 CTGCTGAAATAAAGAACAAATGG - Intronic
1143007210 17:3844956-3844978 ATGTTGAACTGAATGACTAAAGG + Intronic
1146497465 17:33336000-33336022 TTGCTGAACAGAAGGACAGAGGG - Intronic
1146696902 17:34916098-34916120 TTCCTGAACTGTAGGAAAAATGG + Intergenic
1147911571 17:43859140-43859162 CCGCTGCACTGAAGTACAAGGGG + Intronic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1148069690 17:44901060-44901082 CTGCTGATGAGAAGTACAAACGG + Exonic
1148522418 17:48291828-48291850 CTGTTCAACTGAATTACAAAGGG - Intronic
1149399104 17:56275763-56275785 CTGTTGAAATGAAAGACAGAAGG + Intronic
1149480169 17:56996887-56996909 CTGCCAAACAGAAGGACACATGG - Intronic
1150125436 17:62631884-62631906 CTGCAGAACTGAAGTAGAGATGG + Intronic
1150835412 17:68559106-68559128 CTTCTGACCTATAGGACAAATGG + Intronic
1151427554 17:74040840-74040862 CTGCGAAACAGAAGGAGAAATGG + Intergenic
1153334946 18:3913890-3913912 ATACTGAACTAAATGACAAATGG + Intronic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1157490132 18:48117338-48117360 ATGCTGAACTGAGAGACAAGTGG + Intronic
1158142703 18:54272196-54272218 CTGATTTACTGAAGAACAAAGGG + Intronic
1159992381 18:74924660-74924682 CTGCTGAAGTGAACTACACATGG - Intronic
1160019669 18:75170613-75170635 CTGCTGAACTGAACGAACCACGG - Intergenic
1160448166 18:78943177-78943199 CTGCAGAACTGCAGGATCAAAGG - Intergenic
1160653686 19:248015-248037 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1163850769 19:19662143-19662165 CTGCTTAGCTGCAGGTCAAAAGG + Intronic
1164426899 19:28149726-28149748 CCACTGAGCTGAAGGACAGAGGG + Intergenic
1164785700 19:30928681-30928703 CAGCTGAACAGAAGGACAGGAGG - Intergenic
1165798526 19:38533150-38533172 CTTCTGAGCAGAAGGATAAAAGG + Intronic
1165896124 19:39142199-39142221 CTGCAAAACTCCAGGACAAATGG - Intronic
1167343646 19:48931504-48931526 CTGCTGAATAGAAACACAAATGG - Intergenic
925306934 2:2854451-2854473 CTGATGTACTGAAGGAACAAAGG + Intergenic
925859435 2:8160547-8160569 CTGAGAAACTCAAGGACAAAGGG - Intergenic
926987055 2:18636238-18636260 GAGCTGAACTGAAGGAGATAGGG - Intergenic
926998115 2:18760815-18760837 CTGCTGAAGTGAAAGCCAACTGG + Intergenic
927051313 2:19332067-19332089 CTGATGAACTGCAGAAGAAATGG - Intergenic
928176782 2:29039380-29039402 CTGCTAAACTGGAGGTCAAGGGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929676528 2:43937677-43937699 CAGCTGAACTCAAGGACATTTGG + Intronic
929886534 2:45883738-45883760 ATGCTGGAAGGAAGGACAAATGG + Intronic
932145116 2:69309298-69309320 CTATGGAACTGAAGCACAAAAGG - Intergenic
932177998 2:69620206-69620228 CTGATAAACTGAATGACAAGAGG + Intronic
932589920 2:73059129-73059151 CTGCTGAAGTGCAGGACAAGGGG + Intronic
933114528 2:78451129-78451151 ATCCTGAACTGAATGAAAAAAGG - Intergenic
934574580 2:95391990-95392012 CTGCTGAAGTGAAGGTCACAGGG + Intergenic
936570051 2:113605011-113605033 ATGCTGATAAGAAGGACAAAGGG - Intergenic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
936750068 2:115631399-115631421 GAGCAGAACTGAAGGAGAAAGGG - Intronic
937756662 2:125547403-125547425 CTTCTTAAGTGAAGGAGAAATGG + Intergenic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
938335420 2:130491306-130491328 CAGCTGCATTGAAGGACAACAGG - Intronic
938354404 2:130629361-130629383 CAGCTGCATTGAAGGACAACAGG + Intronic
938430825 2:131236144-131236166 CAGCTGCATTGAAGGACAACAGG + Intronic
939110334 2:137999009-137999031 TTGCTGAACAGAAGAATAAAAGG + Intronic
942342557 2:174963326-174963348 TTGCTGAACTGATGAACGAATGG + Intronic
942536767 2:176973408-176973430 CTGCAGAAAGGAAAGACAAAAGG + Intergenic
943559726 2:189446386-189446408 CTTCTGAACTGAAGTACTCATGG + Intronic
944273552 2:197809476-197809498 GTTCTGAACTGAAGGAAAGAAGG - Intronic
944342004 2:198612201-198612223 CTGCTGGGATGAAGGACTAAGGG - Intergenic
944434112 2:199668479-199668501 CTGCTCATCTGAAGGTCAAGTGG - Intergenic
944643791 2:201756922-201756944 CTGCTGAACTGATTGAGAAAAGG + Intronic
945043619 2:205763260-205763282 CTGATGAACTGAATTACAAGGGG - Intronic
945051210 2:205825942-205825964 TGGCTGAGCTGAAGGACAAGGGG + Intergenic
945281324 2:208038090-208038112 CTGGGGAACTTATGGACAAAAGG - Intergenic
945909521 2:215632594-215632616 CAGCTGAACTGAAGGAAACTGGG - Intergenic
945966549 2:216193575-216193597 CTTCTGCACTGGAGAACAAAAGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947850898 2:233286992-233287014 CTGCTGAACTAATGGAATAAGGG - Intronic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
1170132979 20:13042724-13042746 TTGCTGAACTGGGAGACAAAGGG + Intronic
1171953310 20:31440539-31440561 CTGCTGACCTAAATGACAAAGGG + Exonic
1172751838 20:37256799-37256821 CTGCTTACCTGAGGGTCAAAGGG + Exonic
1172921770 20:38489452-38489474 CCGCTGAACCCAAGAACAAAGGG - Intronic
1175284507 20:57828993-57829015 CTGCTGAACTGACGGAGCAGAGG - Intergenic
1175675944 20:60946928-60946950 TTGGGGAACTGAAAGACAAATGG + Intergenic
1176277952 20:64285000-64285022 ATGCTGATAAGAAGGACAAAGGG + Intronic
1177127900 21:17218556-17218578 CTGCATAAATGAAGGAAAAATGG + Intergenic
1179460297 21:41530069-41530091 CTGCTGAGCTGTAGGACCAAAGG - Intronic
1180263933 21:46697610-46697632 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1182165729 22:28171067-28171089 CTGGTGTACTGAACCACAAAGGG + Intronic
1185033671 22:48459512-48459534 CTGCTGGACCTTAGGACAAATGG - Intergenic
1185430165 22:50805967-50805989 ATGCTGATAAGAAGGACAAAGGG + Intergenic
950618285 3:14180000-14180022 TTGTTGAACTGAGGGACATAGGG + Intronic
951869340 3:27343118-27343140 CTGCTTAAATTAAGTACAAAGGG + Intronic
951923392 3:27880286-27880308 ACTCTGAACTGAAGGACACATGG + Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952750814 3:36823430-36823452 GTGATGAACTGAAGGAGAGAGGG + Intergenic
953683170 3:45055316-45055338 CAGCTGAAGTGAAGGACACTTGG + Intergenic
955188425 3:56737191-56737213 ATGGTGAACTGAAGAACAATCGG - Exonic
956014882 3:64872066-64872088 CTGCTCCACACAAGGACAAATGG + Intergenic
956530766 3:70215792-70215814 CTGATGAACTGACAGACTAAAGG + Intergenic
957157911 3:76569217-76569239 CTTCTGAACTGAAACACAATTGG - Intronic
957425321 3:80031161-80031183 CTGCTGAACTGTAGGACACTTGG + Intergenic
958637794 3:96766776-96766798 TTGCTGATAAGAAGGACAAAAGG - Intergenic
961220423 3:125194878-125194900 CTGCTGAACTGCAGTCCAATGGG + Intronic
962076905 3:132091471-132091493 ATGCTGAACTGTAGGAAACATGG + Intronic
964312138 3:155404966-155404988 ATGCTAAACTGAAGGTCCAAGGG + Intronic
965172057 3:165278278-165278300 GAGCTGAACTGAAGGAGACAGGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966090062 3:176123020-176123042 CTGCTGATCTGATGGAAGAAGGG - Intergenic
966488622 3:180500754-180500776 GAGCTGAACTGAAGGAGATAGGG - Intergenic
967531464 3:190553407-190553429 CTCCTGACCTGATGGAGAAAAGG + Intronic
968373117 4:12997-13019 ATGCTGATAAGAAGGACAAAGGG - Intergenic
970734086 4:19145148-19145170 CTGCTAAAATCAAGAACAAAAGG + Intergenic
971640055 4:29119507-29119529 CTGCTGAAAGAAAAGACAAATGG - Intergenic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
972176240 4:36409910-36409932 CTGCAGAGCTCTAGGACAAAAGG - Intergenic
973067474 4:45814719-45814741 ATGCTCAACTAAAGCACAAATGG - Intergenic
973574044 4:52267999-52268021 CAGCTGAAGTGATGGTCAAAGGG - Intergenic
974248218 4:59350279-59350301 TTGGTGAACTGAAAGAAAAAGGG + Intergenic
976050327 4:81004275-81004297 CTTCTCAACTGAAGTAAAAATGG + Intergenic
978084645 4:104635663-104635685 GGCCTGAACTTAAGGACAAAAGG - Intergenic
979187725 4:117819214-117819236 ATGCAGAAATCAAGGACAAAAGG + Intergenic
980181994 4:129412691-129412713 CTGCTGAACTAAAAGAAGAAGGG - Intergenic
981288431 4:143046509-143046531 CTGCTGTACTGTTGAACAAAGGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984648532 4:182244580-182244602 CTCCTAAACTGATGGACAAGAGG + Intronic
985462275 4:190119567-190119589 ATGCTGATAAGAAGGACAAAGGG + Intergenic
986790883 5:11158704-11158726 CTGATCAACTGTAGGAGAAATGG + Intronic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
989430676 5:41351547-41351569 CCGCTGAACTGAAAGCCCAAGGG + Intronic
989820706 5:45792421-45792443 GTGTTGAACTAAAGGCCAAAGGG - Intergenic
991263874 5:64693960-64693982 CTCCTGAAATCAAGGACAAGTGG + Intronic
991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG + Intergenic
995229328 5:109740683-109740705 CTCCTAAACTGAAGGGCCAAGGG - Intronic
996028750 5:118681802-118681824 CTGCAGAAAAGGAGGACAAATGG + Intergenic
996378894 5:122844626-122844648 CCTCTGCACTCAAGGACAAACGG + Intronic
997355311 5:133259017-133259039 CTGCTGGACTGAGGGAGCAAGGG + Intronic
997723950 5:136104753-136104775 CTGCTGAAATTCAGGGCAAAAGG - Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
1000381950 5:160637160-160637182 CTGATGAATAGAAGGATAAATGG - Intronic
1001307162 5:170583724-170583746 CTGCTGAGCTGATGGAAAAAGGG + Intronic
1002754945 6:149542-149564 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1003642881 6:7890352-7890374 GTGCGGAACTGAAGTACAAGAGG + Intronic
1003998960 6:11575417-11575439 CTGCTGCACCTAAGGAGAAACGG - Exonic
1006104973 6:31710965-31710987 CAGTGGAGCTGAAGGACAAATGG + Intronic
1007271224 6:40638738-40638760 TTCCTGAACTGAAGTAGAAAGGG + Intergenic
1012896062 6:104950897-104950919 CTGCTGAACTAAATTAAAAATGG + Intergenic
1013888865 6:115001749-115001771 CTGCTGAACTGGGGCACAGAAGG - Intergenic
1018012941 6:159688360-159688382 GTGCTGAATTTTAGGACAAACGG - Intronic
1018095643 6:160385027-160385049 CTGCTGAACTTAAGAACACTGGG - Intronic
1018806128 6:167261747-167261769 GAGCTGAACTGAAGGAGATAGGG + Intergenic
1018994842 6:168702867-168702889 CTCCTGAACATGAGGACAAAAGG + Intergenic
1020847674 7:13307484-13307506 CTTCTGAAATAAAGGAAAAAAGG + Intergenic
1021189502 7:17603290-17603312 CTGCTCAGCTGCAGGAGAAAGGG - Intergenic
1021244765 7:18247454-18247476 CTGCTGAAGTGATGGACAGTTGG + Intronic
1021557084 7:21930788-21930810 CAGCAGAACTGAAGGAGACAGGG + Intronic
1022823211 7:33981633-33981655 CTGCTGAATTCATGAACAAATGG + Intronic
1022869429 7:34460343-34460365 CAGCAGAACTGAAGGAAATAGGG + Intergenic
1023055787 7:36288781-36288803 GAGCTGAACTCCAGGACAAAGGG + Intronic
1023512508 7:40968648-40968670 CTGCTGATCTCAAGACCAAAAGG + Intergenic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1024272618 7:47654083-47654105 CAGCAGAACTGAAGGGCAAGAGG - Intergenic
1024491387 7:49989719-49989741 CTGCAGACCAGAAGGAAAAAAGG + Intronic
1024618675 7:51138264-51138286 CTGCAGAACTCAAGGACTCAAGG - Intronic
1024736567 7:52311409-52311431 CCGATGAACTGAAGGCCGAAAGG - Intergenic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1029957987 7:104659678-104659700 CAGCTGAACTGAATGATAGAAGG + Intronic
1033938180 7:146615648-146615670 TGGCTCAACTGAAGGGCAAATGG + Intronic
1035513216 8:207810-207832 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1038427223 8:27471589-27471611 CTGATGAATGGATGGACAAAAGG + Intronic
1038466217 8:27766293-27766315 CTGGAGCCCTGAAGGACAAAGGG + Intronic
1038632267 8:29257176-29257198 CTGTTGAAATGAATGACTAATGG + Intronic
1041171068 8:55142190-55142212 CTGCTGATCTGCTGGTCAAACGG + Exonic
1042761887 8:72280290-72280312 CTGGGAAACTGAAGCACAAAAGG + Intergenic
1042854249 8:73249644-73249666 TTGATAGACTGAAGGACAAATGG + Intronic
1043679603 8:83006278-83006300 CTTATGAACTAAAGGAAAAAAGG + Intergenic
1044356437 8:91228061-91228083 CTCCTGATCTGAAGTCCAAAAGG + Intronic
1045417098 8:101978248-101978270 TTGCTTAACTAAAGGATAAAAGG - Intronic
1047913144 8:129553040-129553062 CTGTTGAACTGAAAGGCATAGGG + Intergenic
1048173089 8:132127175-132127197 CTGGCAATCTGAAGGACAAAGGG - Exonic
1048881464 8:138876008-138876030 CCGCTGAACAGCAGGACAAAGGG - Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1051906455 9:22100542-22100564 CTGATGAACAGAAAAACAAAAGG - Intergenic
1052201073 9:25781020-25781042 CTTCTGTACTGAAGGAAAAGGGG - Intergenic
1052336754 9:27328109-27328131 CTGATGCACTAAAGGACATAAGG + Exonic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1060089334 9:120729293-120729315 TTGCAGAACTGAAGCTCAAAGGG + Intergenic
1060600275 9:124872675-124872697 CTCCAGAACTGAAAGACAGAGGG + Intronic
1061643058 9:131974893-131974915 CTTCTGAACTGAGGGAAAGAAGG - Intronic
1062684923 9:137807253-137807275 CTGCTCAACTGAAACACAGAGGG - Intronic
1187793393 X:22975542-22975564 CTCCTGAAATGAAAAACAAAAGG - Intergenic
1187997848 X:24947746-24947768 CTGCTCAACTGAAAGTCACATGG - Intronic
1189164276 X:38844950-38844972 CTGCTGGAATGAAGGACAATGGG - Intergenic
1189330642 X:40142758-40142780 GTGCTGAAATCAAGGAGAAATGG - Intronic
1189882403 X:45505865-45505887 GGGCTAAACTGAAGCACAAAGGG + Intergenic
1192482365 X:71496832-71496854 CTGCTGAAGCGAAAGTCAAAGGG - Intronic
1192781670 X:74299507-74299529 CTGGGGAATTGAAAGACAAAAGG + Intergenic
1194131536 X:90088283-90088305 CTCCTGAACTGCTGGAGAAAAGG + Intergenic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1195589402 X:106606765-106606787 CTGCCAAACTGTATGACAAAGGG - Intergenic
1197479625 X:126966275-126966297 CTGCTGACCTGGTGGAGAAAAGG - Intergenic
1198567236 X:137916845-137916867 CTACTGAACTGAAGGAAGGAAGG - Intergenic
1199866155 X:151851990-151852012 CTGCAGAACTGAGGGACAGGCGG + Intergenic
1199972815 X:152873155-152873177 CTGCTGAACTGAAACACCATTGG + Intergenic
1200838348 Y:7754639-7754661 CTCCTGGACAGAAGGCCAAATGG + Intergenic
1201422001 Y:13809705-13809727 GAGCAGAACTGAAGGACATAGGG - Intergenic
1201460408 Y:14216297-14216319 CTGCTGAACTGCAGAAAACAAGG - Intergenic
1201947149 Y:19523566-19523588 TTGCTGAAATGAAGGAGATAAGG - Intergenic