ID: 1148046499

View in Genome Browser
Species Human (GRCh38)
Location 17:44748174-44748196
Sequence GCGGCAGGTTAGACCCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148046494_1148046499 22 Left 1148046494 17:44748129-44748151 CCACAGGCTGCAGAGCCAAGAGA 0: 1
1: 0
2: 7
3: 52
4: 435
Right 1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1148046492_1148046499 27 Left 1148046492 17:44748124-44748146 CCCAACCACAGGCTGCAGAGCCA 0: 1
1: 1
2: 4
3: 61
4: 513
Right 1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1148046495_1148046499 7 Left 1148046495 17:44748144-44748166 CCAAGAGAAGTGCACACAGTGCT 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1148046491_1148046499 28 Left 1148046491 17:44748123-44748145 CCCCAACCACAGGCTGCAGAGCC 0: 1
1: 0
2: 5
3: 94
4: 586
Right 1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1148046493_1148046499 26 Left 1148046493 17:44748125-44748147 CCAACCACAGGCTGCAGAGCCAA 0: 1
1: 0
2: 0
3: 28
4: 287
Right 1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148046499 Original CRISPR GCGGCAGGTTAGACCCAAAC AGG Intronic
903065758 1:20698363-20698385 CCGGGAGGTGAGACCCAAGCGGG - Exonic
903278726 1:22238075-22238097 GCGGCAGGTTAGACACGATAAGG - Intergenic
904814252 1:33183118-33183140 GCAGGAGGTGAGACCCGAACTGG + Intergenic
907118444 1:51989740-51989762 GCAGCAGGGTAGACCCAACCTGG + Intronic
919401365 1:197121579-197121601 GAGGCAGGTTAGATTCCAACAGG + Intronic
922143713 1:222917286-222917308 GCGGCAAGTGGCACCCAAACAGG + Intronic
1069961521 10:72081908-72081930 GTGGCATGTTAGAGCCAGACAGG - Intronic
1077096797 11:802416-802438 GCAACAGGTTAGACCCAGAAGGG + Intronic
1087272924 11:96129915-96129937 GCTGAAGGTTAGATCCAAATGGG - Intronic
1092124298 12:6064856-6064878 GCAACAGGCTAGACCCAAGCAGG + Intronic
1093635643 12:21464057-21464079 GAGGCAGGTTAGAAACAAAAAGG - Intronic
1094081594 12:26542353-26542375 TTGGCATGTTAGATCCAAACAGG - Intronic
1095178176 12:39117398-39117420 GCAGCTAGTTAGACACAAACAGG + Intergenic
1095958242 12:47818843-47818865 TGGGGAGGTCAGACCCAAACGGG + Intronic
1122508291 14:102246207-102246229 GCGGCAGGATAGACAAAAGCAGG - Intronic
1136598205 16:31266092-31266114 GCCGTAGGTTGGATCCAAACAGG - Exonic
1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG + Intronic
1154316147 18:13304657-13304679 GCAGCAGGTTAAACTCAAAAGGG - Intronic
1158820857 18:61157551-61157573 GAGACAGTTTAAACCCAAACAGG - Intergenic
1162698397 19:12495432-12495454 GAGGCAGGAGAGACACAAACTGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
930626589 2:53705569-53705591 GAGGCCTGTTAAACCCAAACAGG - Intronic
932266120 2:70368243-70368265 AGGGCAGGTGAGCCCCAAACTGG - Intergenic
932295061 2:70617233-70617255 GCTTAAGGTTAGGCCCAAACTGG - Intronic
934055520 2:88248285-88248307 AGGGCAGGTGAGCCCCAAACTGG + Intergenic
937348368 2:121142585-121142607 GTGGCAGGTCAGACCCATCCTGG - Intergenic
1173396703 20:42686959-42686981 GAGGCAGTTTAGACACAAAGAGG - Intronic
1174103169 20:48142710-48142732 ACAGCAAGTTAGACCCAAGCTGG - Intergenic
1174589228 20:51631986-51632008 GAGACAGGGGAGACCCAAACTGG + Intronic
1178551553 21:33543431-33543453 ACGGCAGGGGGGACCCAAACAGG - Intronic
1185041064 22:48504643-48504665 GGGGCAGGTGAGCCCCAAACAGG - Intronic
1185218221 22:49615740-49615762 GCGGCAGGTCAGTCCGAACCCGG + Intronic
982594590 4:157363178-157363200 GCTGCAGGTTAGTCACCAACTGG - Intronic
985673937 5:1220663-1220685 GCAGAAGGTTACACCCAAGCCGG - Intronic
997222596 5:132181549-132181571 GGGGCAGGTGAGCCCCAAAGTGG + Intergenic
999201555 5:149820374-149820396 GAGGCTGGCTAGACCCAAGCAGG - Intronic
999248479 5:150167707-150167729 GCGGCAGGTTCGCCCCAGAAGGG + Intronic
1000646480 5:163766172-163766194 AGGGCAGGTGAGACCCAAATTGG + Intergenic
1003525278 6:6891862-6891884 GGGGCAGGGTAGACACTAACAGG + Intergenic
1008952483 6:57175862-57175884 GCAGCAAGTTAAACCCAAAGAGG + Intronic
1015479216 6:133689714-133689736 GGGGCAGGTGAGCCCCAAAGTGG + Intergenic
1033857429 7:145581538-145581560 GGGGCAGATTAGTCACAAACAGG - Intergenic
1038266007 8:26040534-26040556 GGGGCAGGTCAGAAACAAACTGG + Intronic
1038317590 8:26501012-26501034 TGGGCAGGTTATACCCAAACTGG - Intronic
1040376546 8:46830641-46830663 GCAACAGCTAAGACCCAAACTGG - Intergenic
1044762697 8:95538417-95538439 GCTGAAGGTTAGACTCACACGGG - Intergenic
1052698438 9:31908783-31908805 GCGGCAAGTGGAACCCAAACAGG + Intergenic
1053467648 9:38321704-38321726 GGGGCAGTTTAGAGCCACACTGG + Intergenic
1057755395 9:97831261-97831283 TCGGAAGGTTAGACCCAGTCAGG + Intergenic
1059415643 9:114160814-114160836 GCGGGAGGTGACACCCAAGCTGG + Intronic
1190486555 X:50931584-50931606 AGGGCAGGTGAGAGCCAAACAGG - Intergenic