ID: 1148047511

View in Genome Browser
Species Human (GRCh38)
Location 17:44753206-44753228
Sequence GGCCACTTGGACGCCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148047503_1148047511 16 Left 1148047503 17:44753167-44753189 CCCTTGGTGAAGCCTGAGAGCTT No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047502_1148047511 19 Left 1148047502 17:44753164-44753186 CCTCCCTTGGTGAAGCCTGAGAG No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047500_1148047511 26 Left 1148047500 17:44753157-44753179 CCCAACTCCTCCCTTGGTGAAGC No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047504_1148047511 15 Left 1148047504 17:44753168-44753190 CCTTGGTGAAGCCTGAGAGCTTC No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047505_1148047511 4 Left 1148047505 17:44753179-44753201 CCTGAGAGCTTCAGAGATTAAAA No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047499_1148047511 27 Left 1148047499 17:44753156-44753178 CCCCAACTCCTCCCTTGGTGAAG No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047498_1148047511 28 Left 1148047498 17:44753155-44753177 CCCCCAACTCCTCCCTTGGTGAA No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data
1148047501_1148047511 25 Left 1148047501 17:44753158-44753180 CCAACTCCTCCCTTGGTGAAGCC No data
Right 1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148047511 Original CRISPR GGCCACTTGGACGCCTGAGA GGG Intergenic
No off target data available for this crispr