ID: 1148049241

View in Genome Browser
Species Human (GRCh38)
Location 17:44761007-44761029
Sequence CCCCCAGTGACTGCGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148049241_1148049258 29 Left 1148049241 17:44761007-44761029 CCAAGGCCCGCAGTCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1148049258 17:44761059-44761081 AACTGCCCAGGCTCCCTGGGAGG 0: 1
1: 0
2: 4
3: 23
4: 302
1148049241_1148049256 25 Left 1148049241 17:44761007-44761029 CCAAGGCCCGCAGTCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1148049256 17:44761055-44761077 CAGCAACTGCCCAGGCTCCCTGG 0: 1
1: 0
2: 4
3: 51
4: 422
1148049241_1148049254 17 Left 1148049241 17:44761007-44761029 CCAAGGCCCGCAGTCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1148049254 17:44761047-44761069 GCTGCCTTCAGCAACTGCCCAGG 0: 1
1: 0
2: 4
3: 29
4: 227
1148049241_1148049257 26 Left 1148049241 17:44761007-44761029 CCAAGGCCCGCAGTCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1148049257 17:44761056-44761078 AGCAACTGCCCAGGCTCCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 244
1148049241_1148049253 -8 Left 1148049241 17:44761007-44761029 CCAAGGCCCGCAGTCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1148049253 17:44761022-44761044 ACTGGGGGTGGGGTGGGGGGTGG 0: 3
1: 18
2: 175
3: 1083
4: 5787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148049241 Original CRISPR CCCCCAGTGACTGCGGGCCT TGG (reversed) Intronic
900142195 1:1143370-1143392 CCCCCAGGCAGTGCGGGGCTGGG - Intergenic
900475112 1:2872446-2872468 GCCCCAGTGCCTGGGGGCCAGGG - Intergenic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
901055048 1:6445461-6445483 CCCCCAGTAAGTGCTGGGCTGGG + Intronic
902198184 1:14813980-14814002 CCCCCAGGAACTGGGGGCCAGGG + Intronic
902216870 1:14939870-14939892 ACCCCAGTCACAGGGGGCCTGGG + Intronic
902778399 1:18689372-18689394 CCCACAGTGACTGGGGGGCTGGG + Intronic
903517603 1:23922470-23922492 CCCCCAGTCACTGAGCTCCTTGG + Intergenic
905461912 1:38127688-38127710 CACCCAGTGACTCTGGGGCTTGG + Intergenic
905798356 1:40828132-40828154 CCCCCAGTGAGAGTGGCCCTGGG + Intronic
905863976 1:41366826-41366848 CCCCCACTTTCTGCGGGTCTGGG + Intronic
906513368 1:46424045-46424067 CCCCCAGCCACAGGGGGCCTTGG + Intergenic
906532440 1:46531534-46531556 GCCCCAGTCACTGCTTGCCTAGG + Intergenic
915657725 1:157375522-157375544 ACCCCAGAGACTGCGACCCTAGG + Intergenic
919665062 1:200283670-200283692 ACCCCAGAAACTGCAGGCCTGGG - Intergenic
920099889 1:203510450-203510472 CCCCCAGTGCATGAGGTCCTTGG + Intergenic
920254917 1:204648257-204648279 CCCACAGTGAGAGAGGGCCTGGG + Intronic
920839170 1:209539451-209539473 CCCCCAGAGACTGGGGACATAGG - Intergenic
1064971555 10:21072174-21072196 CTCCCAGTGGCTGCAGCCCTTGG + Intronic
1067102401 10:43342829-43342851 CCCCCAGTGCCTGCTGCGCTGGG + Intergenic
1069562236 10:69439013-69439035 ACCCCAGTGTCTGGGTGCCTAGG - Intergenic
1069581211 10:69568355-69568377 CGCCTAGTGATTGAGGGCCTTGG + Intergenic
1073099539 10:100999596-100999618 CGCCCTGTGACTGCGTGTCTGGG - Exonic
1073187639 10:101626246-101626268 CCCCAAGTGACTGCCAGCCTGGG + Intronic
1076368111 10:129935303-129935325 TGCCCAGTGACTGGCGGCCTGGG + Intronic
1077046940 11:550943-550965 ACCCCAGGGACTGAGGGACTGGG - Intronic
1077113477 11:872388-872410 CCTCAAGTGACTGCCTGCCTCGG + Intronic
1077182791 11:1224031-1224053 CCCCCAGTGGCTCCCAGCCTGGG + Intronic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1077914632 11:6603450-6603472 GCCCCAGTAGCCGCGGGCCTTGG - Exonic
1079351360 11:19694647-19694669 ACCCCAGTGACTAAGGGCATTGG - Intronic
1080503959 11:32893805-32893827 CCCCCAGTGTCTCCGGGACGCGG - Intronic
1080521642 11:33072527-33072549 CCCCCAGGGACTGTGGGCAATGG - Exonic
1083433881 11:62629749-62629771 AGCCCAGAGACTGAGGGCCTAGG - Intronic
1083641911 11:64150261-64150283 CCCCCAGTGACTCTGGGGCATGG - Intronic
1083784093 11:64933973-64933995 CCCCCAGTGAAAGCTGGGCTGGG - Exonic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1085053633 11:73392124-73392146 CCCCCACTGACTCGGGCCCTGGG + Intronic
1088686781 11:112290342-112290364 CTCCCAGGGATTGCAGGCCTGGG + Intergenic
1091841321 12:3623414-3623436 CCCCCAGTGTCTGCAGTCCTGGG - Intronic
1094089782 12:26635833-26635855 CTCCCAGTGGCTGAGGGTCTGGG + Intronic
1096673081 12:53211593-53211615 CCCCCAGTCACTGGCGGTCTGGG + Exonic
1096781233 12:53993412-53993434 CCCCAACTGACTGTGTGCCTGGG - Intronic
1102475442 12:113185555-113185577 TCGCCAGTGCCTGCGGCCCTCGG + Exonic
1111516392 13:89337465-89337487 CCTCAAGTGACTGCCCGCCTTGG - Intergenic
1111657858 13:91175175-91175197 GCCCCGGTGCCCGCGGGCCTGGG + Intergenic
1113366133 13:109677567-109677589 CTCCCAGTGTCTTCTGGCCTTGG + Intergenic
1116833565 14:49746693-49746715 CCCCCAGTCACTGAGGACTTTGG + Intronic
1116833761 14:49748209-49748231 CCCCCAGTCACTGAGGTCTTTGG - Intronic
1117920546 14:60722794-60722816 CCGGCAGTCTCTGCGGGCCTCGG + Intronic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1122208216 14:100159089-100159111 CGCCCAGTGACTGCGGGTGGAGG + Intronic
1122774505 14:104111345-104111367 CCCCCAGTGACTCCTGCCCCAGG + Intronic
1122804169 14:104248280-104248302 CCCCCAGGGCCTGGAGGCCTGGG - Intergenic
1122995176 14:105259674-105259696 CCTCAAGTGACTGCCCGCCTTGG - Intronic
1128303315 15:66581028-66581050 TCCCCACTGGCTGTGGGCCTGGG + Intergenic
1128708766 15:69856695-69856717 CCACCAATGACTGCAGGCCCTGG - Intergenic
1129186505 15:73910566-73910588 CTCTCAGTGACTGCGGGGCCAGG + Intergenic
1129452172 15:75657285-75657307 CCCCCAGTCACTGCTGGTATAGG - Exonic
1129728325 15:77915416-77915438 CCCCCAGTTCCTGGGGGGCTGGG + Intergenic
1129928325 15:79385595-79385617 CAACCAGTGACTGCAGACCTGGG - Intronic
1129968013 15:79754028-79754050 CCCACAGTGCCTTCTGGCCTGGG + Intergenic
1131772859 15:95759627-95759649 CCTCAAGTGACTGCCTGCCTCGG + Intergenic
1131827187 15:96331219-96331241 CACCCAGCGACTGCGGGCGGCGG + Exonic
1132392737 15:101450718-101450740 CCCCCAGTGCCTTCTGGCCCGGG + Intronic
1132789490 16:1677945-1677967 CGACCAGGGACTGCGGGCATGGG - Intronic
1132993295 16:2808537-2808559 CTCCCAGTGCCTGCCTGCCTGGG + Intergenic
1133185002 16:4089785-4089807 CCACCAGTGCCTGCGTGCCAAGG + Intronic
1133981468 16:10635964-10635986 CCTCCTCTGACTGGGGGCCTGGG + Intronic
1141463334 16:84191340-84191362 CCCCCAGGCACTTTGGGCCTGGG - Exonic
1141829861 16:86504234-86504256 CCCCCAGTGTCTGGGGGCAATGG - Intergenic
1141981083 16:87550873-87550895 CCCCCAGCGTCTGCAGCCCTGGG + Intergenic
1142379475 16:89723279-89723301 CCCCCAGTGCCTGCACGGCTTGG + Exonic
1144490713 17:15706310-15706332 CCCCCAGTTTCTGCTGGCCCTGG - Intronic
1145262164 17:21360947-21360969 CCCCCAGCCTCTACGGGCCTCGG - Intergenic
1145766526 17:27461674-27461696 CCCGCAGTGGCTGTGAGCCTGGG + Intronic
1147160084 17:38564481-38564503 TCCCCAGTCTCTGCTGGCCTTGG + Intronic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1149932297 17:60768800-60768822 GCACCAGTGTCAGCGGGCCTAGG + Intronic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1158548735 18:58417291-58417313 TCCCCAGTGACAGAGGGCCTGGG - Intergenic
1158960533 18:62584307-62584329 CCTGCAGAGAATGCGGGCCTTGG + Intronic
1159697873 18:71583610-71583632 CCCCCAGAGACTGCATGTCTTGG - Intergenic
1160373073 18:78390547-78390569 GCCACGGTGGCTGCGGGCCTGGG + Intergenic
1161156614 19:2735109-2735131 CACCCTCTGACTGCAGGCCTGGG - Intronic
1161217433 19:3101404-3101426 CCCCCAGGGACTGTGGGGCCGGG + Intronic
1161444810 19:4312117-4312139 CCATCAGTCACTGGGGGCCTTGG + Intronic
1161477239 19:4493588-4493610 CCGCCAGGCTCTGCGGGCCTCGG - Intronic
1161490484 19:4558326-4558348 CCCCCAGGGACTGTGAGTCTGGG - Exonic
1163253347 19:16139898-16139920 CCCTCAGTGTCCGCAGGCCTCGG - Intronic
1165374100 19:35429491-35429513 CCCCCACTGACAGCTGGACTTGG + Intergenic
1166417535 19:42607047-42607069 TCCCCAGTGACTTGGGCCCTGGG - Intronic
927519338 2:23689630-23689652 GCAGCAGTGACTGGGGGCCTCGG + Intronic
929450731 2:42035400-42035422 CCCCCAGTGACTCAGGGCACAGG - Intergenic
929452566 2:42047483-42047505 CCTCCTGGGACTGGGGGCCTCGG - Intergenic
934496381 2:94804545-94804567 CCCCCAGTGCTTGTGGGCCTCGG - Intergenic
936025146 2:109025992-109026014 CCCCCAGGGAGGGCAGGCCTTGG - Intergenic
936281913 2:111148768-111148790 CCCACAAAGACTGAGGGCCTAGG - Intronic
937044755 2:118845329-118845351 CTCCCAGACACTGCGGGCCGGGG + Intronic
938465392 2:131521677-131521699 CCCCCAGTGTCCACAGGCCTGGG + Intergenic
940461459 2:153968152-153968174 GCCACAGTGACTGCAGTCCTTGG - Intronic
940831455 2:158470862-158470884 CTCCCACTGAGTGCGGGGCTGGG + Intronic
940831790 2:158474761-158474783 CTCCCACTGAGTGCGGGGCTGGG - Intronic
943729678 2:191288597-191288619 CTCCCAGTGTCTGTGTGCCTGGG - Intronic
946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG + Intronic
948453158 2:238091228-238091250 ACCCCAATGATTGCTGGCCTTGG + Exonic
949064840 2:241983767-241983789 ACCCCAGAGCCTGTGGGCCTGGG + Intergenic
1168896295 20:1325917-1325939 CCACCAGTGACTGAGTGACTGGG + Intronic
1174040734 20:47697651-47697673 CCCCCAGTTACCAGGGGCCTGGG - Intronic
1175442625 20:59002167-59002189 CCCCCAGTGCCTTCGGGGCTGGG - Intronic
1175915401 20:62423598-62423620 CCCATGGTGCCTGCGGGCCTGGG + Intronic
1175960898 20:62635948-62635970 CCCCCACGGGCTGCGGGCTTCGG - Intergenic
1176387087 21:6143542-6143564 CCCTCAGGGACAGAGGGCCTTGG - Intergenic
1177925490 21:27209087-27209109 CCTCAAGTGATTGCCGGCCTCGG - Intergenic
1178493883 21:33071053-33071075 CTCCAAGTGAGGGCGGGCCTGGG + Exonic
1179729749 21:43361017-43361039 GCCCCATTGACTGCAGGTCTTGG + Intergenic
1179736386 21:43394710-43394732 CCCTCAGGGACAGAGGGCCTTGG + Intergenic
1179926489 21:44537968-44537990 CCCCCAGCCACTGAGGGCCCTGG + Intronic
1180999821 22:19982805-19982827 CCCCCAGTGACTGAGACTCTGGG + Intronic
1181359298 22:22322695-22322717 CCCTCAGTGTCTGCGGCCCCAGG + Intergenic
1182702986 22:32255488-32255510 CCACCAGTGAGTGCTAGCCTAGG + Intergenic
1184117927 22:42432690-42432712 CCATGAGTGACTTCGGGCCTTGG + Intergenic
1184231876 22:43162787-43162809 CCCCCAATCTCTGCAGGCCTTGG + Exonic
1184560418 22:45259860-45259882 CCCCCATGGCCTGCGGCCCTAGG + Intergenic
1184877400 22:47284246-47284268 CCCACAGTGTCTGGGGTCCTGGG + Intergenic
1185223448 22:49640381-49640403 CCCCCAGAGGGTGCGGGTCTCGG + Intronic
1185254027 22:49822017-49822039 TTCCCAGTGACTGCCGGCATCGG - Intronic
1185367284 22:50442445-50442467 TTCCCAGTGACTGCCGGCATCGG - Intronic
950419208 3:12887016-12887038 CCTCCAGTGAGAGCGAGCCTCGG + Intergenic
950773653 3:15332164-15332186 CCCCCAGTAACTGTGGTCCGGGG - Intronic
951140218 3:19149048-19149070 CCCACAGTGAATACGGGCGTCGG - Intronic
951777580 3:26326364-26326386 CCCCAAGTGACTGAGGGAGTAGG - Intergenic
954792430 3:53143186-53143208 CCCTCCCTGACTGCAGGCCTGGG - Intergenic
957084992 3:75670080-75670102 CCCCCAGTGACACCGGATCTAGG - Intergenic
960687226 3:120306828-120306850 TCTGCAGAGACTGCGGGCCTCGG - Intergenic
960735299 3:120772865-120772887 CCCCCACTCACTGCAGGCCTTGG + Intronic
962804401 3:138916279-138916301 CCCGTAGTGGTTGCGGGCCTGGG + Intergenic
966220260 3:177544491-177544513 TCCCCAGTGCCTGGAGGCCTGGG + Intergenic
967016691 3:185488712-185488734 CCTCCAGTGACTGCAGGCCAAGG + Exonic
968728393 4:2258752-2258774 CCCCCTGTGCCTACTGGCCTGGG - Intronic
976862541 4:89683038-89683060 TCCCCAGAGTCTCCGGGCCTTGG + Intergenic
982025190 4:151245832-151245854 CCTCAAGTGACTGCCTGCCTTGG + Intronic
984057688 4:174949505-174949527 CCCCCAGTGACTCCTGGCGAAGG - Intronic
984734493 4:183098074-183098096 CCCCCTCTGACTGAGGGGCTGGG + Intergenic
985908302 5:2859271-2859293 GCCCCTGTGATTGTGGGCCTGGG + Intergenic
986107244 5:4671536-4671558 CCCCCAGTGAATTGGGCCCTGGG - Intergenic
988609976 5:32714157-32714179 CCCCCAGTCCCAGCCGGCCTTGG - Intronic
988727022 5:33936404-33936426 GCCCCAGTGACCGCGGGACACGG + Exonic
989168038 5:38449528-38449550 CCCCCAGAGACTGAAGGCTTGGG - Intronic
996605012 5:125311645-125311667 CCCCCAGTGACTGCAGCCCCAGG + Intergenic
999727092 5:154446242-154446264 TCCCCAAGGACTCCGGGCCTGGG - Exonic
1002824838 6:763419-763441 CCCCCAGTGCCAGTGAGCCTTGG - Intergenic
1003310184 6:4963773-4963795 CCCTGAGTGACCGAGGGCCTGGG - Intergenic
1004944913 6:20601762-20601784 CTCCCAATCTCTGCGGGCCTCGG - Intronic
1006135672 6:31894883-31894905 CCTCAAGTGATTGCCGGCCTTGG + Intronic
1013359543 6:109381968-109381990 TTCCCAGTGGCTGCGGGGCTGGG - Intronic
1016753030 6:147651913-147651935 CCCCCACTCTGTGCGGGCCTGGG - Intronic
1017566881 6:155696324-155696346 CCCGCAGTGAATGCCTGCCTCGG - Intergenic
1018774409 6:166999618-166999640 CCCCCAGTGCCCGCCGGCCCCGG - Intronic
1019347817 7:539262-539284 CCCCCACTCACTGCGGGCAGAGG + Intergenic
1020280592 7:6648152-6648174 CCTCCAGGGCCTGAGGGCCTTGG + Intronic
1026994588 7:74607040-74607062 CCCCCAGTCCCTGGAGGCCTGGG + Intergenic
1028406981 7:90485894-90485916 CCCACAGAGACTTCTGGCCTTGG - Intronic
1032193468 7:129777408-129777430 CCCCCAGGCACTGCGGCACTTGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034436507 7:151065078-151065100 CAGCCAGTGAGTGCGGGCCTGGG - Intronic
1034900473 7:154905250-154905272 ACCCCAGAGTCTGGGGGCCTTGG - Intergenic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1036615161 8:10382108-10382130 CCCCCAGTGACCGCTGGACTGGG + Intronic
1039458061 8:37721024-37721046 CCCCTGGTGACTCTGGGCCTCGG + Intergenic
1040448188 8:47517415-47517437 CACCCAGTGTCTGTGGGCATGGG - Intronic
1042485097 8:69339242-69339264 CCCACAGTGCCTGAGGGGCTGGG - Intergenic
1046754824 8:117962517-117962539 CCTCAAGTGACTGCTGGCTTTGG - Intronic
1049210054 8:141381865-141381887 CCACCACTGACTGTGGTCCTTGG - Intergenic
1049222435 8:141434181-141434203 CCTCCTGTGACTCCAGGCCTGGG + Intergenic
1049354400 8:142180368-142180390 CCCCCAGAGAGTACGGGGCTTGG - Intergenic
1049376119 8:142289998-142290020 CCCCCAGGCACTGTGGGCCCTGG + Intronic
1049401579 8:142429976-142429998 CTCCCAGTGCCTATGGGCCTCGG + Intergenic
1052186452 9:25602370-25602392 CCCACAGTGACTGGGAGACTGGG + Intergenic
1053470681 9:38344348-38344370 CTCCCAGTCTCTGTGGGCCTGGG + Intergenic
1053660761 9:40275902-40275924 CCCCCAGTGCTTGTGGGCCTCGG + Intronic
1053911139 9:42905247-42905269 CCCCCAGTGCTTGTGGGCCTCGG + Intergenic
1054372883 9:64422118-64422140 TCCCCAGTGCTTGTGGGCCTCGG + Intergenic
1054523849 9:66100382-66100404 CCCCCAGTGCTTGTGGGCCTCGG - Intergenic
1054680513 9:67911895-67911917 CCCCCAGTGCTTGTGGGCCTCGG + Intergenic
1055757656 9:79572830-79572852 CACCCAGTGAGTGCGGGCGGCGG + Exonic
1057179595 9:93022531-93022553 CTCACTGTGACTGGGGGCCTGGG + Intronic
1057242490 9:93423637-93423659 CCCCCAGCCACTGCTGCCCTTGG - Intergenic
1057386055 9:94606798-94606820 CCCCCAGTAAGTGAGGGCCCGGG - Exonic
1059317121 9:113435397-113435419 CCTCAAGTGACTGCCTGCCTCGG + Intergenic
1061036694 9:128118261-128118283 AGCCCAGTGACTGCGGGCTGTGG - Intergenic
1061989210 9:134149131-134149153 TCCCCAGTGACTGTTGGCGTGGG + Intronic
1062034526 9:134377037-134377059 AGCCCTGTGACTGCTGGCCTAGG + Intronic
1062038406 9:134392910-134392932 CGGCCAGTGACTGTGGGACTCGG - Intronic
1062040409 9:134401877-134401899 CCCCAGGTGAGTGCGGGGCTGGG + Exonic
1062542014 9:137045761-137045783 CCTGCAGGGCCTGCGGGCCTGGG + Intronic
1185507512 X:641901-641923 CCCCGAGTGCCCGAGGGCCTGGG + Intronic
1192694301 X:73398571-73398593 CCCCAAGTGACTGCTAGGCTAGG - Intergenic
1195246642 X:103001314-103001336 CCCCCAGTGACAGGGAGACTGGG + Intergenic
1200080293 X:153572850-153572872 CCCCCTGTGCCTGCTGCCCTTGG - Intronic