ID: 1148050811

View in Genome Browser
Species Human (GRCh38)
Location 17:44769234-44769256
Sequence CCTCCTATGTAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 280}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148050798_1148050811 7 Left 1148050798 17:44769204-44769226 CCATTCCCACCCATTCGCCCCTG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050799_1148050811 2 Left 1148050799 17:44769209-44769231 CCCACCCATTCGCCCCTGTCCGA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050797_1148050811 11 Left 1148050797 17:44769200-44769222 CCATCCATTCCCACCCATTCGCC 0: 1
1: 0
2: 0
3: 28
4: 332
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050794_1148050811 30 Left 1148050794 17:44769181-44769203 CCAGTTTCCAGGGGCCTAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050800_1148050811 1 Left 1148050800 17:44769210-44769232 CCACCCATTCGCCCCTGTCCGAG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050796_1148050811 16 Left 1148050796 17:44769195-44769217 CCTAGCCATCCATTCCCACCCAT 0: 1
1: 0
2: 0
3: 46
4: 296
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050803_1148050811 -3 Left 1148050803 17:44769214-44769236 CCATTCGCCCCTGTCCGAGGCCT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050802_1148050811 -2 Left 1148050802 17:44769213-44769235 CCCATTCGCCCCTGTCCGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 57
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050804_1148050811 -10 Left 1148050804 17:44769221-44769243 CCCCTGTCCGAGGCCTCCTATGT 0: 1
1: 0
2: 2
3: 21
4: 136
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280
1148050795_1148050811 23 Left 1148050795 17:44769188-44769210 CCAGGGGCCTAGCCATCCATTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148050811 Original CRISPR CCTCCTATGTAGATGGAGGC TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900824834 1:4918168-4918190 CATCTTATGTAGATGGTGGCAGG + Intergenic
901645853 1:10716349-10716371 CTTCCTCTGGAAATGGAGGCAGG - Intronic
901674130 1:10872997-10873019 CCTCCTCTGCTGATTGAGGCTGG + Intergenic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
903479508 1:23642993-23643015 CCTCCTAAGTAGCTGGAAACAGG - Intergenic
904215646 1:28916523-28916545 CCTACTCAGTAGGTGGAGGCAGG + Intronic
905921213 1:41720136-41720158 TCTGCGATGTAGATGGAGGGTGG - Intronic
906332743 1:44901225-44901247 CCTCCTATGGAGGCTGAGGCAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908212955 1:61920414-61920436 CCTCTTATGTGGATGGTGGCAGG - Intronic
910374037 1:86549837-86549859 ACATCCATGTAGATGGAGGCAGG + Intronic
911134825 1:94428664-94428686 CATCTTATGTGGATGGCGGCAGG - Intronic
913254058 1:116938422-116938444 CATCTTATGTGGATGGCGGCAGG + Intronic
914049335 1:144118700-144118722 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
914129849 1:144846744-144846766 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
915696894 1:157752351-157752373 CATCTTATGTGGATGGCGGCAGG - Intronic
916576308 1:166070230-166070252 CCTCCTAAGTAGAAGCAGACTGG - Exonic
917290989 1:173471937-173471959 CATCTTATGTTGATGGTGGCAGG - Intergenic
918886490 1:190200812-190200834 CATCTTATGTGGATGGCGGCAGG - Intronic
919972597 1:202590757-202590779 CTTCCTATGGAGACGAAGGCAGG + Exonic
921610543 1:217207537-217207559 CATCTTATGTGGATGGTGGCAGG - Intergenic
922140233 1:222877339-222877361 CCTCTTACGTGGATGGCGGCAGG + Intronic
922319986 1:224478857-224478879 CATCTTATGTGGATGGTGGCAGG + Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
1062942931 10:1438311-1438333 TCTCCTTAGCAGATGGAGGCAGG + Intronic
1062942950 10:1438403-1438425 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942979 10:1438539-1438561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942989 10:1438585-1438607 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943021 10:1438721-1438743 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943041 10:1438812-1438834 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943072 10:1438948-1438970 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943103 10:1439084-1439106 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943123 10:1439175-1439197 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943139 10:1439266-1439288 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943183 10:1439448-1439470 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943203 10:1439539-1439561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943224 10:1439630-1439652 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943233 10:1439676-1439698 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943242 10:1439722-1439744 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943262 10:1439813-1439835 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943311 10:1440041-1440063 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943319 10:1440087-1440109 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1063369363 10:5511272-5511294 CCTCCTATGAAGATGGCACCAGG + Intergenic
1063378715 10:5570655-5570677 CCTCCTCACTAGCTGGAGGCAGG + Intergenic
1066048242 10:31612960-31612982 GCTCCTTTCTAGATGGACGCTGG + Intergenic
1066527780 10:36300018-36300040 CATCTTATGTGGATGGTGGCAGG + Intergenic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1072355789 10:94609133-94609155 CCTACTCGGAAGATGGAGGCAGG - Intronic
1072548289 10:96457304-96457326 AGTCCTATATAGAGGGAGGCTGG - Intronic
1073600790 10:104844114-104844136 CATCCTGTGAAAATGGAGGCAGG - Intronic
1073939398 10:108677749-108677771 CATCTTATGTAGATGATGGCAGG - Intergenic
1074123098 10:110507872-110507894 CCTCCTAGGAAGATGGATGGGGG - Intronic
1078612210 11:12830476-12830498 CCTCCTTTTTAGAAGCAGGCAGG + Intronic
1078686754 11:13539085-13539107 CATCTTATGTGGATGGTGGCAGG - Intergenic
1079908173 11:26275581-26275603 CCTCCTTTGAGGATGGAGGCAGG + Intergenic
1079962319 11:26940116-26940138 CATCTTATGTAGATGGTGGCAGG + Intergenic
1080247724 11:30198414-30198436 CATCATATGATGATGGAGGCAGG - Intergenic
1080959985 11:37146795-37146817 CATCTTATGTGGATGGTGGCAGG + Intergenic
1081002686 11:37694654-37694676 CATCTTATGTGGATGGTGGCAGG - Intergenic
1081602569 11:44505464-44505486 CCACCTTTGGAGATGGAGGAAGG + Intergenic
1083629171 11:64086987-64087009 GCTGCTGTGTAGGTGGAGGCCGG - Intronic
1085073665 11:73571772-73571794 CTTCCTAGGTGGATGGCGGCCGG - Intronic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG + Intergenic
1090360455 11:126168847-126168869 CATCTTATGTGGATGGCGGCAGG + Intergenic
1090819507 11:130328559-130328581 CCTCCTGAGTAGATGGAAGCTGG - Intergenic
1093967930 12:25346657-25346679 TTTCCTGAGTAGATGGAGGCAGG + Intergenic
1095267394 12:40176204-40176226 CATTGTATATAGATGGAGGCAGG + Intergenic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1099609661 12:84851565-84851587 CATCTTATGTGGATGGTGGCAGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1101909765 12:108852668-108852690 CTTTCTCTGTAGTTGGAGGCTGG - Exonic
1102536057 12:113582493-113582515 TCTCCTCTGCAGATGGAGTCAGG + Intergenic
1104591856 12:130090407-130090429 CGTCTTATGTGGATGGTGGCAGG + Intergenic
1105452437 13:20512121-20512143 CCTCCTGCCTAGATGGAAGCAGG + Intronic
1106485381 13:30167700-30167722 CATCTTATGTGGATGGTGGCAGG - Intergenic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1110785667 13:79522736-79522758 CTTCCTCAGTAGATGGTGGCTGG + Intronic
1111336714 13:86835637-86835659 CATCATATGTGGATGGTGGCAGG + Intergenic
1111819442 13:93194991-93195013 CATCTTATGTAGATGGAGGCAGG - Intergenic
1112052968 13:95662445-95662467 CATCTTATGTGGATGGCGGCAGG - Intergenic
1112860415 13:103823876-103823898 CATTTTATGTAGATGGCGGCAGG + Intergenic
1113836440 13:113331208-113331230 CCTCCTATCTGGATGGAAGCCGG - Intronic
1118630722 14:67700026-67700048 GCTCCTTGGGAGATGGAGGCAGG + Intergenic
1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG + Intronic
1120229092 14:81823294-81823316 CATCTTACGTGGATGGAGGCAGG + Intergenic
1121812557 14:96904127-96904149 GCTCCTCTGTACATGAAGGCAGG + Intronic
1122122912 14:99564029-99564051 CCACCTGTGTACATGTAGGCTGG - Intronic
1123419271 15:20118271-20118293 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1123528493 15:21124814-21124836 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1124046049 15:26150737-26150759 CATCTTATGTGGATGGTGGCAGG - Intergenic
1128632149 15:69278587-69278609 CCTCCTAAGGAGATGGATGCTGG + Intergenic
1130048804 15:80466435-80466457 ACTCCTATGTACAGGGAAGCAGG - Intronic
1132347823 15:101119035-101119057 ACTCATATGTAGCTGGAGGTTGG + Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1136013561 16:27380802-27380824 CATCTTATGTAAATGGAGGCAGG - Intergenic
1136490205 16:30602942-30602964 CCACCTCTGTGGAGGGAGGCTGG + Exonic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1137612352 16:49827223-49827245 CCTGCTCTGTGGCTGGAGGCTGG - Intronic
1138805463 16:60084696-60084718 CATCCTATGCAAATGGCGGCAGG + Intergenic
1139122888 16:64042340-64042362 CATCCTATGTGGATGGCGGCAGG + Intergenic
1140236128 16:73160556-73160578 CCCTCTATGTAGATGGAGGGAGG - Intergenic
1203137824 16_KI270728v1_random:1740454-1740476 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
1142585079 17:967153-967175 ACACCTGTGTAGCTGGAGGCTGG - Intronic
1144779607 17:17801206-17801228 CCTCCTATCCAGATGGAGCCTGG + Intronic
1146477503 17:33174755-33174777 GCTCATATGGAGATGGAGCCTGG + Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1149655636 17:58308427-58308449 CCACCTCTGCTGATGGAGGCAGG + Intronic
1151051671 17:70985251-70985273 CATCCTACGTGGATGGTGGCAGG + Intergenic
1152017709 17:77762537-77762559 CCTCCTGAGTAGCTGGAGCCGGG + Intergenic
1152412969 17:80139106-80139128 CCACCTGTGTGGCTGGAGGCAGG + Exonic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1152990998 18:363330-363352 CTTCCTTGGTAGGTGGAGGCCGG + Intronic
1153994285 18:10426272-10426294 CCTCTTATGGAAATGGAGACTGG - Intergenic
1155351505 18:24911840-24911862 CCTCCTGAGTAGATGCAGGCAGG + Intergenic
1155594072 18:27462264-27462286 CCTGCTCTGGAGCTGGAGGCAGG - Intergenic
1155810489 18:30227101-30227123 CATCTTAAGTGGATGGAGGCAGG - Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1157819610 18:50756490-50756512 CATCTTATGTGGATGGTGGCAGG - Intergenic
1159157202 18:64600585-64600607 CATCTTATGTGGATGGTGGCAGG + Intergenic
1159507891 18:69359806-69359828 CATCTTATGTGGATGGTGGCAGG - Intergenic
1160305071 18:77725213-77725235 CATCTTATGTGGATGGTGGCAGG - Intergenic
1161406135 19:4092157-4092179 CCTCTTTTGCAGCTGGAGGCAGG + Intronic
1161656198 19:5516770-5516792 CCTCCCAAGTAGATGGGGACTGG + Intergenic
1162449511 19:10746278-10746300 CCACCAATGTGGCTGGAGGCAGG + Intronic
1163070639 19:14837726-14837748 TCCCTTATGTAGATGGAGGCGGG - Intergenic
1165387753 19:35521414-35521436 CCTCCTGTATAAAGGGAGGCAGG - Intergenic
1165981321 19:39726775-39726797 CCTCCTATGGAGATTGAGAGTGG + Intergenic
1166358290 19:42240340-42240362 CCTCCTATGTGGAGGGGAGCAGG - Intronic
1167440924 19:49508382-49508404 ACTCCTTTGGAGAGGGAGGCAGG + Intronic
1167675125 19:50879089-50879111 CCTCCTATGTTGTTGAAGGAGGG + Exonic
1168191464 19:54741426-54741448 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168193735 19:54758054-54758076 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168195790 19:54772792-54772814 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168197687 19:54787644-54787666 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168204161 19:54837023-54837045 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168206361 19:54853200-54853222 CTTCCTATGTGGATGGAGCCTGG - Intronic
1202688783 1_KI270712v1_random:71595-71617 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
925638164 2:5961908-5961930 CATCTTATGTGGATGGCGGCAGG - Intergenic
925886134 2:8394905-8394927 CATGCTATGTAGAGGTAGGCAGG - Intergenic
926764509 2:16312523-16312545 CCCTGCATGTAGATGGAGGCTGG - Intergenic
926870097 2:17406967-17406989 CATCTTATGTGGATGGTGGCAGG - Intergenic
926925192 2:17980331-17980353 CCTGCTAAGTATTTGGAGGCTGG - Intronic
927255829 2:21040145-21040167 CATCTTATGTAGATGGTGGCTGG - Intronic
928246450 2:29632796-29632818 CATCTTATGTGGATGGTGGCAGG + Intronic
928804232 2:35131641-35131663 CTTCTTATGTAGATGGCGGCAGG + Intergenic
929026180 2:37604750-37604772 CATCCTATGTAGTTTGTGGCTGG - Intergenic
929192812 2:39155292-39155314 CCTCCTAAGTAAAAGGAGTCAGG + Intergenic
931330600 2:61277926-61277948 CATCTTATGTGGATGGCGGCAGG - Intronic
931439164 2:62275506-62275528 CATCTTACGTAGATGGCGGCAGG - Intergenic
933957652 2:87384504-87384526 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
934241772 2:90276399-90276421 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
934271400 2:91540286-91540308 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
935243252 2:101196145-101196167 CATCTTATGTGGATGGTGGCAGG - Intronic
937763058 2:125628484-125628506 CATCTTATGTGGATGGTGGCAGG - Intergenic
940543122 2:155046861-155046883 CATCTTATGTGGATGGTGGCAGG + Intergenic
941775881 2:169393315-169393337 CCTCATAGGTGGATGGAGGAGGG - Intergenic
942982010 2:182094170-182094192 CATCTTATGTGGATGGTGGCAGG + Intronic
943145967 2:184045149-184045171 CATCTTATGTGGATGGCGGCAGG + Intergenic
943176511 2:184481698-184481720 CATCTTATGTGGATGGAAGCCGG - Intergenic
944701062 2:202246566-202246588 CATCTTATGTGGATGGCGGCAGG - Intergenic
945729780 2:213519495-213519517 CATCTTATGTGGATGGCGGCAGG - Intronic
947116572 2:226777730-226777752 CATCTTATGTGGATGGAAGCAGG - Intronic
947202060 2:227622631-227622653 GCTCCCATGGTGATGGAGGCTGG + Intronic
947228918 2:227866113-227866135 CCTGCTGTGGGGATGGAGGCAGG + Intergenic
947296552 2:228636716-228636738 CATCTTATGTGGATGGTGGCAGG + Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172690573 20:36786634-36786656 CGTCCTAGGAAGAGGGAGGCAGG + Exonic
1175162850 20:57021747-57021769 CCTACTAGGTAGATGGAGGGTGG + Intergenic
1177972886 21:27812141-27812163 CATCTTACGTGGATGGAGGCAGG + Intergenic
1179469262 21:41599656-41599678 CATCTTATGTAGATGGCAGCAGG - Intergenic
1180552642 22:16553006-16553028 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
1181351388 22:22261030-22261052 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182709919 22:32314790-32314812 CGTCTTATGTGGATGGTGGCAGG + Intergenic
1182760297 22:32717317-32717339 TCTCCTGGGTAGATGAAGGCTGG + Intronic
1183765850 22:39874034-39874056 CATCTTATGTGGATGGTGGCAGG + Intronic
1184312078 22:43652315-43652337 CATCTTATGTAGATGGTGGCAGG - Intronic
1184397474 22:44251631-44251653 CATCTTATGTGGATGGTGGCAGG + Intronic
1184854639 22:47139663-47139685 CCTCCTAAGTGGCTGGAAGCAGG - Intronic
1184874533 22:47265310-47265332 CATCTTATGTGGATGGTGGCAGG + Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950196434 3:11012350-11012372 CCTCCTATGTGGGTGGAGCTGGG - Intronic
950978834 3:17280174-17280196 CCTACTATAGAGATGGGGGCAGG + Intronic
951289838 3:20862417-20862439 CATCTTATGTGGATGGATGCTGG + Intergenic
951478089 3:23129966-23129988 CCTCCTGTTTCTATGGAGGCAGG - Intergenic
953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG + Intergenic
953475552 3:43202968-43202990 CCTCCTCTGTAAATGAGGGCTGG - Intergenic
954882026 3:53843027-53843049 CCACCTGTGTGGGTGGAGGCTGG + Intronic
955206870 3:56903983-56904005 CCTCCCAAGTAGCTGGAAGCAGG + Intronic
955457015 3:59133836-59133858 TCTCCTATGTAGGTAGAGGAAGG - Intergenic
955682749 3:61519253-61519275 CATCCTATGTGGATGGCGGCAGG + Intergenic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
955826446 3:62952372-62952394 CATCTTATGTGGATGGTGGCAGG - Intergenic
956579123 3:70791005-70791027 CATCTTATGTGGATGGTGGCAGG - Intergenic
956938722 3:74132887-74132909 CATCTTATGTGGATGGCGGCAGG + Intergenic
957300479 3:78386832-78386854 CATCTTATGTAGATGGCAGCAGG + Intergenic
957398541 3:79677432-79677454 CATCGTATGTGGATGGTGGCAGG + Intronic
957524769 3:81365986-81366008 CCTCCAATGTATATGGAATCGGG + Intergenic
958645811 3:96872373-96872395 CCTCCTGTGTTTATGGAGGGTGG + Intronic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
959273242 3:104241263-104241285 CATCTTATGTGGATGGTGGCAGG - Intergenic
959380915 3:105640747-105640769 CATCTTATGTAGATGGCAGCAGG + Intergenic
960554150 3:119009003-119009025 GCTTCTGTGTATATGGAGGCTGG - Intronic
962182881 3:133226923-133226945 CATCTTATGTGGATGGTGGCAGG + Intronic
963510144 3:146236619-146236641 CATCTTATGTGGATGGTGGCAGG - Intronic
965067907 3:163875595-163875617 CACCTTATGTGGATGGAGGCAGG - Intergenic
966394061 3:179483175-179483197 ACTCCTTTGTGGAAGGAGGCAGG - Intergenic
970140470 4:12976636-12976658 CATCTTATGTGGATGGCGGCAGG + Intergenic
970746774 4:19307667-19307689 CATCTTATGTGGATGGTGGCAGG - Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
972081029 4:35149862-35149884 CATCTTATGTGGATGGTGGCAGG + Intergenic
972113378 4:35594776-35594798 CCTCTTACGTGGATGGTGGCAGG + Intergenic
973613127 4:52656485-52656507 CCTCCCATGTATAGGAAGGCTGG - Intronic
974555955 4:63447332-63447354 CATCTTATGTAGATGGTGGCAGG + Intergenic
976514239 4:85946031-85946053 CATCTTATGTGGATGGCGGCAGG + Intronic
976683167 4:87780122-87780144 GCTCCTATATACATGGAGGGCGG - Intergenic
976726717 4:88222508-88222530 CATCTTATGTGGATGGTGGCAGG - Intronic
978181359 4:105800214-105800236 CATCTTATGTGGATGGCGGCAGG + Intronic
979370399 4:119879138-119879160 CATCTTATGTGGATGGTGGCAGG - Intergenic
979810319 4:125028555-125028577 CATCCTATGTGGATGGTGGCAGG + Intergenic
980556093 4:134407665-134407687 CGTCTTATGTGGATGGTGGCAGG - Intergenic
983431648 4:167658977-167658999 CATCTTATGTGGATGGTGGCAGG + Intergenic
983588271 4:169379524-169379546 CCTCCTATCAAGATGGAACCAGG + Intergenic
985100448 4:186452993-186453015 CATCTTATGTGGATGGCGGCAGG + Intronic
986690681 5:10311245-10311267 CATCTTATGTGGATGGTGGCAGG + Intergenic
986945872 5:13018900-13018922 CCTCTTGTCTACATGGAGGCTGG - Intergenic
989651741 5:43697752-43697774 CATCTTATGTGGATGGTGGCAGG + Intronic
990064009 5:51689764-51689786 CATCCTATGTGAATGGTGGCAGG - Intergenic
992871857 5:81014381-81014403 CATCTTATGTGGATGGTGGCAGG + Intronic
994542938 5:101122490-101122512 CATCTTATGTGGATGGTGGCAGG + Intergenic
994801389 5:104381374-104381396 CATCTTATGTGGATGGTGGCAGG + Intergenic
995240932 5:109884869-109884891 CATGCTATGAAGATGGAGTCCGG - Intergenic
996015689 5:118531740-118531762 TCTCCTATGAAGATGGAAACTGG - Intergenic
996029098 5:118685115-118685137 CCTCCTATCCAGATTGGGGCTGG - Intergenic
997092836 5:130877544-130877566 CATCTTATGTGGATGGCGGCAGG - Intergenic
998700043 5:144687921-144687943 CGTCTTATGTAGATGGCAGCAGG + Intergenic
998757795 5:145399811-145399833 CATCTTACGTAGATGGTGGCAGG + Intergenic
1000229235 5:159299421-159299443 CATCTTATGTGGATGGAAGCAGG + Intergenic
1002934363 6:1659146-1659168 CCTGCTCTGTGGAGGGAGGCTGG + Intronic
1003470385 6:6424503-6424525 CCTCTTATGTGGATGGCAGCAGG + Intergenic
1006449350 6:34097109-34097131 GCTCCAATCTAGATGGAGGCAGG + Intronic
1006918222 6:37609947-37609969 CCTCCTCTGTAGATGGCTCCTGG - Intergenic
1008681315 6:53876165-53876187 CATCTTATGTGGATGGTGGCAGG + Intronic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1016075799 6:139794425-139794447 CATCTTATGTGGATGGTGGCAGG + Intergenic
1020432755 7:8130333-8130355 CCACCTCTGTGGATGAAGGCAGG + Intronic
1020782572 7:12535320-12535342 CATCCTATGTGGATGGCAGCAGG + Intergenic
1021594215 7:22297334-22297356 CCACCAATATAGATGCAGGCAGG + Intronic
1021633695 7:22670576-22670598 CCTGCCCTGTAGATGGAGACTGG + Intergenic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022492742 7:30833326-30833348 CATCTTATGTGGATGGTGGCAGG + Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026812886 7:73483751-73483773 GCTACTTTGGAGATGGAGGCAGG - Intronic
1027797979 7:82717800-82717822 CCTCCTGAGTAGCTGGAGCCAGG - Intergenic
1028315075 7:89391474-89391496 CATCTTATGTGGATGGCGGCAGG - Intergenic
1031438549 7:121763794-121763816 CCTCTTATATGGATGGTGGCAGG + Intergenic
1031480962 7:122278020-122278042 CATCTTACGTAGATGGTGGCAGG - Intergenic
1032443006 7:131956555-131956577 CCTCCTACGTGGATGGCAGCAGG - Intergenic
1033707557 7:143903800-143903822 CATCTTATGTGGATGGCGGCAGG + Intergenic
1033998864 7:147386971-147386993 CATCTTATGTGGATGGTGGCAGG + Intronic
1034077202 7:148243542-148243564 CATCTTACGTGGATGGAGGCAGG + Intronic
1034234987 7:149559711-149559733 CCTACTAGGGAGATTGAGGCAGG - Intergenic
1035267653 7:157700558-157700580 CCCCCTATGCTGATGGCGGCTGG + Intronic
1035844632 8:2849571-2849593 CATCTTATGTGGATGGTGGCAGG - Intergenic
1036702075 8:11019490-11019512 CCTCCTCTGGGGATGGAGACAGG + Intronic
1037464713 8:19148921-19148943 GACCCTATGAAGATGGAGGCAGG + Intergenic
1040579978 8:48689680-48689702 CCTCCTGGGTGGCTGGAGGCAGG + Intergenic
1041131659 8:54708466-54708488 CCTACTCTGGAGATTGAGGCAGG - Intergenic
1041551066 8:59102167-59102189 CATCTTATGTGGATGGCGGCAGG + Intronic
1042284428 8:67092557-67092579 CCTCCTGAGTAGCTGGAGGCAGG + Intronic
1042391393 8:68239827-68239849 CATCTTATGTGGATGGTGGCAGG + Intergenic
1042428517 8:68676861-68676883 CATCTTATGTGGATGGTGGCAGG + Intronic
1043481777 8:80660358-80660380 GCTACTTTGGAGATGGAGGCAGG + Intronic
1043734255 8:83724260-83724282 GCTCCTAGGTGGAAGGAGGCAGG - Intergenic
1045940686 8:107734943-107734965 CATCCTATGTGGATGGCAGCAGG + Intergenic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1048479172 8:134771896-134771918 CATCTTATGTGGATGGAGGCAGG + Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049839986 8:144764741-144764763 TCTCCTGTGTAGGTGGAGACTGG + Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050214475 9:3307081-3307103 CATCTTATGTGGATGGTGGCAGG - Intronic
1052267538 9:26591508-26591530 CATCATATGTGGATGGTGGCAGG + Intergenic
1054879422 9:70129312-70129334 CATCTTATGTGGATGGAAGCAGG - Intronic
1055863176 9:80779390-80779412 CATCTTATGTGGATGGCGGCAGG - Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1060035789 9:120254516-120254538 GCTCCTCTGTAGGTTGAGGCTGG - Intergenic
1060631223 9:125160558-125160580 CATCTTATGTGGATGGCGGCAGG - Intronic
1061366313 9:130173768-130173790 CCCCATGTGTTGATGGAGGCTGG + Intronic
1185716363 X:2345886-2345908 GCTCATATGGTGATGGAGGCTGG - Intronic
1186331202 X:8536059-8536081 GCTCTTTTGAAGATGGAGGCAGG + Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186514205 X:10154055-10154077 CCTCCTGTTCTGATGGAGGCTGG - Intergenic
1187505566 X:19875660-19875682 CCACCTGTGTATATGGAGGGTGG + Intronic
1188103751 X:26123651-26123673 CTTCCCATATAGATGGGGGCAGG - Intergenic
1188788017 X:34373007-34373029 GGTCTTGTGTAGATGGAGGCTGG - Intergenic
1189242282 X:39534585-39534607 CATCTTATGTGGATGGTGGCAGG - Intergenic
1189533012 X:41906622-41906644 CCTCCTATGCACATGAGGGCAGG + Intronic
1189960772 X:46323046-46323068 CATCCTACGTGGATGGTGGCAGG + Intergenic
1193188157 X:78538197-78538219 CATCTTACGTGGATGGAGGCAGG + Intergenic
1193519467 X:82511426-82511448 CATCTTATGTGGATGGTGGCAGG + Intergenic
1196337677 X:114557812-114557834 CCTCCCATGGGGTTGGAGGCAGG - Intergenic
1197246278 X:124170497-124170519 CATCTTATGTGGATGGAGGCAGG + Intronic
1198116361 X:133548854-133548876 CATCTTATGTGGATGGCGGCAGG - Intronic
1198888050 X:141361262-141361284 CATCTTATGTGGATGGCGGCAGG + Intergenic
1199284400 X:146039649-146039671 CATCTTACGTAGATGGTGGCAGG - Intergenic