ID: 1148052301

View in Genome Browser
Species Human (GRCh38)
Location 17:44775315-44775337
Sequence CATGCTCCCCGCCGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052301_1148052309 -9 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052309 17:44775329-44775351 GGGAGCATGGGAGCGGGCCCTGG 0: 1
1: 0
2: 2
3: 46
4: 440
1148052301_1148052315 3 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052315 17:44775341-44775363 GCGGGCCCTGGGCGGGGTCCGGG 0: 1
1: 0
2: 9
3: 74
4: 739
1148052301_1148052311 -5 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052311 17:44775333-44775355 GCATGGGAGCGGGCCCTGGGCGG 0: 1
1: 0
2: 5
3: 47
4: 327
1148052301_1148052314 2 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052314 17:44775340-44775362 AGCGGGCCCTGGGCGGGGTCCGG 0: 1
1: 1
2: 2
3: 50
4: 480
1148052301_1148052320 28 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052320 17:44775366-44775388 AGACTCCCGACCTGTCCTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 243
1148052301_1148052310 -8 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052310 17:44775330-44775352 GGAGCATGGGAGCGGGCCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 269
1148052301_1148052313 -3 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052313 17:44775335-44775357 ATGGGAGCGGGCCCTGGGCGGGG 0: 1
1: 0
2: 4
3: 47
4: 356
1148052301_1148052312 -4 Left 1148052301 17:44775315-44775337 CCAGCCCCGCGGCGGGGAGCATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1148052312 17:44775334-44775356 CATGGGAGCGGGCCCTGGGCGGG 0: 1
1: 0
2: 5
3: 37
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052301 Original CRISPR CATGCTCCCCGCCGCGGGGC TGG (reversed) Intronic
900100167 1:959128-959150 CTTGCTCCTCTCAGCGGGGCTGG - Intronic
900754903 1:4426659-4426681 CATGCTCCCGTCCTGGGGGCAGG - Intergenic
901796225 1:11681073-11681095 GTGGCTCCCCGCGGCGGGGCCGG - Exonic
901934333 1:12617346-12617368 CATCCTCCGCGCCGCGGAGCCGG + Exonic
903986823 1:27234788-27234810 CATGCTCCCCGCCCGGCGCCTGG - Exonic
906109641 1:43313977-43313999 CATGCACCCAGGGGCGGGGCGGG - Intronic
911831026 1:102551448-102551470 CATGCTCCCTGCCCCCGGACAGG + Intergenic
912234575 1:107835493-107835515 CATGCCTCCCTCTGCGGGGCTGG + Intronic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
913680574 1:121185151-121185173 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
914032405 1:143972793-143972815 CTTCCTCCCGGCCGCCGGGCTGG + Intergenic
914157040 1:145095174-145095196 CTTCCTCCCGGCCGCCGGGCTGG - Intronic
915473300 1:156138386-156138408 CAGGCTCCCAGCCGCCAGGCAGG - Intronic
920467883 1:206203677-206203699 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
1064179252 10:13100395-13100417 CAGGCTCCGGGCCGCGGGGCAGG - Intronic
1065099549 10:22320702-22320724 CAGGTTCCGCGCCGCGGCGCCGG + Intronic
1067112082 10:43408227-43408249 CCAGCTCCCCGCCAGGGGGCCGG + Intronic
1069849809 10:71397381-71397403 CAACTTCCCCGCCGCGCGGCGGG - Intronic
1070162300 10:73873905-73873927 CAGGCTCCCAGCCCCGCGGCTGG - Intronic
1070954289 10:80454294-80454316 CAAGTTCCGCGGCGCGGGGCGGG - Exonic
1071291836 10:84194497-84194519 CAGGCTCCCAGCCGCGGGCGGGG - Intergenic
1075906066 10:126083123-126083145 CATGCTGCCTGGAGCGGGGCTGG + Intronic
1076156239 10:128207715-128207737 CATGCTGCCCGCCGCCCGCCTGG - Intergenic
1076705236 10:132297786-132297808 CCTGCTGCTGGCCGCGGGGCGGG - Intronic
1079035076 11:17014023-17014045 CCTCCTCCCAGCCGCGGGGCAGG + Exonic
1081767256 11:45620342-45620364 CATGCTGGCTGCAGCGGGGCAGG + Intergenic
1083571359 11:63763723-63763745 GCTGCTCCCGGCTGCGGGGCGGG + Exonic
1084161531 11:67353045-67353067 CTTCCTCCTCGTCGCGGGGCTGG + Exonic
1086981050 11:93197968-93197990 CATGCTCCTCGCCGCGCGGTTGG - Intergenic
1088315003 11:108498390-108498412 CCTCCTCGCCGCCGCGGAGCTGG - Exonic
1091498273 12:991154-991176 GCTGCGCCCCGCGGCGGGGCTGG + Intronic
1092886332 12:12927532-12927554 CATGCTCCCCTCCCAGGCGCTGG + Intergenic
1092886341 12:12927571-12927593 CATGCTCCCCTCCCAGGTGCCGG + Intergenic
1092886351 12:12927610-12927632 CATGCTCCCCTCCCAGGTGCTGG + Intergenic
1092886360 12:12927649-12927671 CATGCTCCCCTCCCAGGTGCTGG + Intergenic
1092886369 12:12927688-12927710 CATGCTCCCCTCCCAGGTGCTGG + Intergenic
1093548002 12:20369842-20369864 CTCACTCCCCGCCGCGGGGGTGG + Exonic
1096489718 12:52006964-52006986 CTGGCTCCCCTCGGCGGGGCTGG - Exonic
1097854998 12:64452454-64452476 CCCGCTCCGCGCCGCGCGGCCGG + Intronic
1100186451 12:92145260-92145282 CTTGGGCCCCGCCGCGGGACCGG - Intronic
1104746987 12:131216780-131216802 ACTGCTCCCCTCCACGGGGCTGG - Intergenic
1104785632 12:131446405-131446427 ACTGCTCCCCTCCACGGGGCTGG + Intergenic
1105000379 12:132686935-132686957 CATCGCCCCCGCCGCGCGGCAGG + Intronic
1108872160 13:55001045-55001067 CCTAGTCCCCGCCACGGGGCCGG + Intergenic
1116945396 14:50831027-50831049 CATGGTTCCCGCGGCGGCGCCGG - Exonic
1119778061 14:77260416-77260438 CATGGTCCCCTCCCAGGGGCCGG + Intergenic
1121100455 14:91246467-91246489 CATGCTGCCAGCAGAGGGGCTGG - Intronic
1121270188 14:92632664-92632686 CATCCTCCCAGCCACGGGCCTGG - Intronic
1124055141 15:26235254-26235276 CATGTGCCCAGCCGCTGGGCTGG - Intergenic
1124250643 15:28104661-28104683 CATGCTGCCTGCAGCTGGGCAGG - Intergenic
1128965414 15:72052762-72052784 CATGCTGGCTGCAGCGGGGCAGG - Intronic
1129298919 15:74614709-74614731 CATGCCCCTCCCCGCGGGTCTGG - Intronic
1129386980 15:75201792-75201814 CAGGCTCCCAGAGGCGGGGCCGG + Intronic
1130270821 15:82445944-82445966 CTGGCTCCTTGCCGCGGGGCTGG + Intergenic
1130463161 15:84173267-84173289 CTGGCTCCTTGCCGCGGGGCTGG + Intronic
1130489513 15:84421521-84421543 CTGGCTCCTTGCCGCGGGGCTGG - Intergenic
1130501104 15:84500283-84500305 CTGGCTCCTTGCCGCGGGGCTGG - Intergenic
1131231844 15:90665452-90665474 CGTCCTCACCGCCGCGGGGGGGG + Intergenic
1136586714 16:31191021-31191043 CACGGTCCCCGCCGCGGCCCCGG - Exonic
1138619072 16:58197710-58197732 CCTGCTGCCCGCGGCCGGGCCGG + Exonic
1140759628 16:78099442-78099464 CAGCCTCCCCGCCGCAGGGAAGG - Exonic
1141617868 16:85220493-85220515 CAGGCTCCTGGCCGCGGGCCCGG - Intergenic
1142672060 17:1491868-1491890 CCGGCTCCCCGCCGCGCTGCTGG + Intronic
1143078755 17:4366314-4366336 CATCCTCCCTGCCGAGGGCCCGG + Exonic
1144847158 17:18225870-18225892 CATGCAGCGCGGCGCGGGGCGGG + Intronic
1144991678 17:19237722-19237744 CATGCTCCAGTCCGTGGGGCGGG - Intronic
1146053126 17:29567936-29567958 CCAGCGCCCCGCTGCGGGGCGGG + Intronic
1146725295 17:35151111-35151133 CCCGCGCCCCACCGCGGGGCGGG + Intronic
1146725341 17:35151327-35151349 CCCGCGCCCCACCGCGGGGCGGG + Intronic
1147200706 17:38799604-38799626 CGGGCTCCCCGGGGCGGGGCGGG - Exonic
1147429570 17:40363146-40363168 CACGCTCCCCGGCGCGCGGGCGG + Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148021698 17:44557733-44557755 GCTGCTGCCCGCCGCCGGGCCGG + Exonic
1148052301 17:44775315-44775337 CATGCTCCCCGCCGCGGGGCTGG - Intronic
1150259047 17:63773723-63773745 CATAATCCCCGCCCCTGGGCCGG + Exonic
1152688609 17:81707360-81707382 CCTGCGCCACGCAGCGGGGCCGG + Exonic
1154202228 18:12307885-12307907 AATGCTCCCGGGCGCGGCGCTGG + Intronic
1155497607 18:26458187-26458209 CATGCTCCCAGGCGGCGGGCTGG - Intronic
1159798050 18:72867628-72867650 CATCGTCGCCGCCGCGGGGTCGG + Exonic
1160566143 18:79787935-79787957 CGGGGTCCGCGCCGCGGGGCGGG + Intergenic
1160668437 19:344514-344536 CATGCGCGGCGGCGCGGGGCGGG - Intronic
1161068804 19:2250506-2250528 CATGCCCCCCGCCACGGCCCGGG - Intronic
1161593046 19:5137343-5137365 CTCGCTCCCCGCAGCGGGGGTGG + Intronic
1162362952 19:10230698-10230720 CACGCCCCCCGCCGGGGGACCGG + Intronic
1162914209 19:13865545-13865567 CCTGCTCGCAGCCCCGGGGCGGG + Intronic
1163548098 19:17951063-17951085 GAGGCTCCCCGCCGGGGGGCTGG + Intergenic
1163636054 19:18437643-18437665 CACACTCACCGCCGCGGTGCTGG - Exonic
1164649389 19:29881049-29881071 CAGGCTCCCCGCTGCTGGGCAGG - Intergenic
1165994284 19:39833393-39833415 TGCCCTCCCCGCCGCGGGGCCGG - Exonic
1167302015 19:48683500-48683522 CATGCTCCCCACCCAGGCGCTGG + Intergenic
1167688265 19:50969602-50969624 CCTGCTCCCCAGCCCGGGGCAGG - Intronic
1168423034 19:56217617-56217639 GATGGGCCCCGACGCGGGGCAGG + Intergenic
926738720 2:16093842-16093864 CATGCTGCCTCCTGCGGGGCTGG - Intergenic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
931762776 2:65432007-65432029 AAAGCTGCCCGCCGCGGGACAGG - Exonic
932542051 2:72665072-72665094 CATGCCTCCCTCCGCAGGGCCGG + Intronic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
935648734 2:105363855-105363877 CCTGCTCCCAGCCACAGGGCTGG - Intronic
947637826 2:231689001-231689023 CCTGCTCCCGGCCGCCGGCCAGG - Intergenic
948267639 2:236647151-236647173 CATTCTCCCTGCAGAGGGGCGGG + Intergenic
1171435050 20:25115913-25115935 CAGACTCCCGGCCCCGGGGCTGG + Intergenic
1171953380 20:31440963-31440985 CATGCTCCCTGGAGCTGGGCAGG - Intronic
1174454658 20:50640626-50640648 CCTGCCCCCCTCCGCAGGGCTGG + Intronic
1174472142 20:50769096-50769118 CCTGCCCCCCTCCGCAGGGCTGG - Intergenic
1175521243 20:59604063-59604085 CCTCCTCCCTGCCGGGGGGCGGG - Intronic
1176549147 21:8214011-8214033 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176557040 21:8258232-8258254 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176568079 21:8397049-8397071 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176575982 21:8441269-8441291 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1178314537 21:31557995-31558017 CCTCCCCCCGGCCGCGGGGCGGG - Intronic
1179596687 21:42447392-42447414 TGTGCTCCCCGCAGCTGGGCTGG - Exonic
1179675005 21:42975033-42975055 CGCGCGCCCCGGCGCGGGGCGGG + Intronic
1180064594 21:45405911-45405933 GAGGCTCCTCGCCGCGGGCCGGG + Intronic
1181539215 22:23564450-23564472 CAGGCTTCCAGCCGAGGGGCCGG + Intergenic
1181553848 22:23656224-23656246 CAGGCTCCCAGCTGAGGGGCAGG - Intergenic
1182547575 22:31084928-31084950 CGGGCTCCTCCCCGCGGGGCCGG + Intronic
1183437728 22:37805046-37805068 CCTGCTCCCCGCCGCCGCCCTGG - Intergenic
1184240735 22:43210217-43210239 CAAGCTCGCCGCCGCAGTGCTGG + Exonic
1185172459 22:49301863-49301885 AATTCTCCCCGTGGCGGGGCCGG + Intergenic
1203254032 22_KI270733v1_random:130327-130349 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203262088 22_KI270733v1_random:175406-175428 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
950567716 3:13780897-13780919 CATGCTTCCTGCCACGGGGTCGG + Intergenic
950618128 3:14178636-14178658 CAAGCGCACCGCCTCGGGGCGGG - Exonic
954637112 3:52076998-52077020 CATGCTCCCCAAAGAGGGGCTGG + Intronic
956211446 3:66805606-66805628 CATACTCCCAGCTGAGGGGCTGG - Intergenic
961482487 3:127193054-127193076 AATGCGCGCAGCCGCGGGGCGGG - Intergenic
963733081 3:148991448-148991470 CATCCTCCCAGCTGCGCGGCCGG - Exonic
964118847 3:153162168-153162190 CATGCTCGCCGGGGAGGGGCGGG + Intergenic
964132252 3:153302657-153302679 CATCCTCTCTGCCCCGGGGCTGG - Intergenic
969240237 4:5892594-5892616 CATTGTCCCGGCCGAGGGGCAGG + Exonic
969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG + Intronic
970173141 4:13308965-13308987 AATGCTCCTCTCTGCGGGGCCGG - Intergenic
971308591 4:25505216-25505238 CACGCTCACCGCCGCGGTGCTGG + Intergenic
974098620 4:57392714-57392736 CATGCTCCCCTCCTAAGGGCTGG + Intergenic
979547275 4:121951977-121951999 CATCGCCGCCGCCGCGGGGCTGG - Intergenic
982985785 4:162203811-162203833 CAGCTGCCCCGCCGCGGGGCAGG + Intergenic
983577154 4:169271444-169271466 CCTCCTCCCCCCGGCGGGGCTGG + Intergenic
985820343 5:2155907-2155929 CATGTTCCCCAGCGCGGGGAGGG - Intergenic
986066576 5:4240346-4240368 CATGCTCCCCTCCCAAGGGCTGG + Intergenic
988577761 5:32444022-32444044 GCCGCTCCCCGCCGCGGGCCGGG + Intronic
992080343 5:73230577-73230599 AATGCTCCGGGCCGCGGGGCTGG + Intergenic
995106455 5:108381746-108381768 CGGGCTCCCGGCAGCGGGGCAGG + Exonic
995183696 5:109251097-109251119 CATGCTCCCAGGCCCGGCGCTGG + Intergenic
997694859 5:135852664-135852686 CTGGCTCCCCGCAGCGGTGCTGG - Exonic
998157716 5:139795949-139795971 GCTGGTCCCCGCCGCGGGTCCGG - Exonic
1002105952 5:176879535-176879557 CACCCACCCCGCCGCCGGGCAGG - Intronic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003290747 6:4776497-4776519 ATCGCGCCCCGCCGCGGGGCCGG - Exonic
1006920621 6:37625083-37625105 CAGGCTCCGCGCCCAGGGGCGGG - Intergenic
1014198163 6:118581877-118581899 AAGGCTCCCCGCAGCGGGCCAGG - Intronic
1016461876 6:144286356-144286378 CACGTTCCCCGCCGGGCGGCTGG - Intronic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1026188515 7:68103091-68103113 CCTGCACCCCGCCGAGGAGCAGG + Intergenic
1029424377 7:100487003-100487025 CATGCTGCCCACCGAGTGGCAGG - Exonic
1032196598 7:129792911-129792933 CCTCCTCCCCGGCGGGGGGCTGG - Intergenic
1034439989 7:151081484-151081506 CTTGCTCCCCGCGCCGCGGCGGG - Exonic
1037547816 8:19940383-19940405 CGTGCTCGCAGCCGCGCGGCGGG - Intronic
1039466349 8:37788045-37788067 CAGGCTCCCCGCCACAGGCCCGG + Intronic
1042367331 8:67952305-67952327 CATTCTCGCCGCCGGGGGCCGGG + Exonic
1044248997 8:89984531-89984553 ACTGCTGCCCGCCGCGGGCCCGG - Exonic
1047555369 8:125923526-125923548 CCTGCTCCCTGCCTTGGGGCTGG + Intergenic
1049802145 8:144522835-144522857 CATGCTGCCCGCCTCGGGCCGGG + Exonic
1049955260 9:687222-687244 AATGCTCGCAGCCTCGGGGCTGG - Intronic
1057054393 9:91949772-91949794 TATGCTCCCGGCCGCTGCGCCGG - Intronic
1060998392 9:127887732-127887754 CATGCTCCCATCAGCGAGGCTGG - Intronic
1061275359 9:129566979-129567001 CAGGCTTCCAGCCGAGGGGCCGG + Intergenic
1062125069 9:134855778-134855800 CATGCTCCCCAAGGCAGGGCAGG + Intergenic
1203470433 Un_GL000220v1:113471-113493 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203478254 Un_GL000220v1:157443-157465 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1186239076 X:7546898-7546920 CACGCTCCCCGCCGCACGGCAGG + Intergenic
1188260021 X:28011905-28011927 CATGCTCCCTGCCGCAAAGCTGG + Intergenic