ID: 1148052647

View in Genome Browser
Species Human (GRCh38)
Location 17:44776700-44776722
Sequence GAGCGGAGCAGTCCCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052647_1148052658 24 Left 1148052647 17:44776700-44776722 CCAGTCCTGGGACTGCTCCGCTC 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052647_1148052661 28 Left 1148052647 17:44776700-44776722 CCAGTCCTGGGACTGCTCCGCTC 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052647 Original CRISPR GAGCGGAGCAGTCCCAGGAC TGG (reversed) Intronic
900144460 1:1151793-1151815 GAGCGGGGCAGCCCCAGGCTGGG - Intergenic
901065110 1:6490676-6490698 GAGAGGAGGGGTCCCAGGAAGGG + Intronic
902436784 1:16403210-16403232 GCACTGAGCAGTCCCAGGAAAGG - Intronic
903181505 1:21607221-21607243 GAGTGGAGTAGTTCCTGGACAGG - Intronic
904364506 1:30001815-30001837 GAGCAGAGCAAGCCCAGGAGGGG - Intergenic
905358310 1:37400515-37400537 GAGCTCAGCAGTTCCAGGAGGGG + Intergenic
906527722 1:46505825-46505847 GAGTGGGGCAGGCCCTGGACTGG + Intergenic
906640889 1:47439622-47439644 GACCGCAGCAGGCCCAGGGCCGG + Exonic
906792915 1:48674399-48674421 GAGCAGAGTAGACCCAGGTCTGG + Intronic
907403621 1:54240674-54240696 GAGCAGAGCAGTCCAGGAACAGG - Intronic
907413481 1:54298371-54298393 CAGCGAAGCAGTCCCAGCAAGGG + Intronic
910266782 1:85346354-85346376 GATCTGAGCAGTCTCAGGATAGG - Intronic
912419182 1:109531870-109531892 AAGAGGTGCAGTCCTAGGACTGG - Intergenic
912449366 1:109759844-109759866 GAGAGGGGGAGTCCTAGGACTGG + Intronic
915972784 1:160366253-160366275 GAGTGGAGGAGTGCCAAGACAGG - Intergenic
916964156 1:169918018-169918040 GAGCTTAGAAGTCCCATGACAGG - Intergenic
920350795 1:205336712-205336734 GTGGGGAGCAGACCCAGGGCTGG + Exonic
920380706 1:205533124-205533146 GGGCAGAGGAGTCCCAGGCCTGG + Intergenic
922528490 1:226325061-226325083 AAGCTGAGAAGTCCCATGACAGG + Intergenic
923385501 1:233461890-233461912 AGGCTGAGAAGTCCCAGGACAGG + Intergenic
1071499551 10:86193670-86193692 GAGCTGAGGGGTCCCAGGAATGG - Intronic
1071731054 10:88248994-88249016 GAGGGGACCAGGCCCAGGATTGG - Intergenic
1073639917 10:105241360-105241382 GAGCGCAGCAGCCCCAGGTGAGG + Intronic
1073867019 10:107816547-107816569 GAGGGGAGCATTCCAAGCACAGG - Intergenic
1075528089 10:123202783-123202805 AAGCTGGGCAGTCCCAGGGCAGG + Intergenic
1075974570 10:126684424-126684446 GAGCGGAACAGTCGCAACACAGG + Intergenic
1076439714 10:130472893-130472915 GAGTCCAGCAGTCCCAGGCCAGG + Intergenic
1076446223 10:130516096-130516118 AAGAGGAGAAGTCGCAGGACAGG - Intergenic
1076667425 10:132101122-132101144 GAGCTGGGCACTCCCAGGCCTGG + Intergenic
1076760679 10:132604405-132604427 GAGCGTAGCAGTCACGGGAAAGG - Intronic
1077551732 11:3203451-3203473 GAGCAGAGCAGGCACAGGACCGG - Intergenic
1077962548 11:7089987-7090009 GCGCGGCGCCGCCCCAGGACGGG + Exonic
1079277143 11:19051796-19051818 CAGCTGAGCAGTCCCATTACTGG + Intergenic
1083295390 11:61712557-61712579 GAGCGGAGCCTGCCCAGGACTGG - Intronic
1083591011 11:63894901-63894923 GAGCAGAGCTGTCCCATCACTGG - Intronic
1083892197 11:65601131-65601153 GAGCCGAGGAGTCTCAGGACTGG - Intronic
1084741401 11:71141739-71141761 GAGAGGAGCAGGCCCAGGGCTGG - Intronic
1085250474 11:75140432-75140454 GGGCAGAGCAGCGCCAGGACAGG - Intronic
1087944007 11:104136062-104136084 GAGAGGAGCATTCCTAGCACAGG + Intronic
1091106197 11:132921818-132921840 GAGCGAGGCAGTTCCAGGAATGG - Intronic
1092264598 12:6970967-6970989 GTGGGGAGCAGGCACAGGACTGG + Exonic
1092429383 12:8396843-8396865 GAGCGGCGCAGGCCCGGGCCCGG - Intergenic
1094807751 12:34108263-34108285 CTGCGGAGCCCTCCCAGGACAGG + Intergenic
1096100939 12:48970137-48970159 GCGCGGAGCAGTTCCAGCGCTGG + Exonic
1096235351 12:49922572-49922594 GAGCTGAGCAGGCACAGGGCTGG - Intergenic
1096459511 12:51814500-51814522 GAGCCAGGCGGTCCCAGGACAGG + Intergenic
1103701157 12:122849378-122849400 GAGCAGGGCAGGCCCTGGACCGG + Intronic
1105893566 13:24699343-24699365 GAGCTGGGCAGTCGCAGGGCTGG + Intronic
1108313883 13:49220093-49220115 GAGCGGAGCAGGGCCGGGCCGGG + Intergenic
1113574913 13:111388506-111388528 GAGCGAGGCAGGCCCAGGACTGG - Intergenic
1114031537 14:18584258-18584280 CTGCGGAGCCGTCCGAGGACAGG + Intergenic
1114452098 14:22833962-22833984 GAGTGGGGCACTCCCAGGACAGG + Intronic
1116803462 14:49467340-49467362 AAGCGTCACAGTCCCAGGACAGG + Intergenic
1119432084 14:74575094-74575116 GAGCCTAGAAGTCCCAGGAGAGG - Intronic
1119702991 14:76767961-76767983 GGGAGCTGCAGTCCCAGGACTGG - Intronic
1119947794 14:78713250-78713272 GAGCTAAGCAGACCCAGGAAGGG - Intronic
1121438088 14:93932083-93932105 CATTGGAGCAGTCCCAGGCCAGG + Intergenic
1122624208 14:103075802-103075824 GAGCGGAGCGGGACCAGGCCCGG - Intergenic
1123953252 15:25305831-25305853 GGTCAGAGCAGTCCCAGGTCTGG - Intergenic
1124052793 15:26214454-26214476 GAGCAAAGCAGTCCCAGAGCTGG - Intergenic
1126896124 15:53258622-53258644 GAGAGGCTCACTCCCAGGACTGG + Intergenic
1128309469 15:66621515-66621537 GAGGAGAACAGTGCCAGGACAGG + Intronic
1131118112 15:89806628-89806650 GAACGGAGCAGCCCCAGGCCGGG + Exonic
1131870991 15:96764651-96764673 GAGCGGAGCAGGCTCTGGGCGGG - Intergenic
1132802923 16:1763057-1763079 GAGGGGAGGAGCCTCAGGACAGG - Intronic
1137758565 16:50921882-50921904 GAGCGGTGTAGTCCCAGTCCTGG + Intergenic
1139478949 16:67217740-67217762 GGTTGGAGCAGTCACAGGACAGG - Intronic
1139492672 16:67294839-67294861 GAGTGAAGCAGGCCCAGGATTGG - Intronic
1141691888 16:85601283-85601305 GAGGGGAGCAGCCCCAGGAGAGG + Intergenic
1142144969 16:88489126-88489148 GAGCCGGGCAGTCCCTGGAGCGG + Exonic
1142887499 17:2921835-2921857 GAGCTGTGCAGTCCCCGGCCTGG - Intronic
1146080195 17:29772967-29772989 AAGCCGAGAAGTCCCATGACTGG - Intronic
1147140641 17:38458805-38458827 GTGAGGAGTTGTCCCAGGACCGG - Intronic
1148052647 17:44776700-44776722 GAGCGGAGCAGTCCCAGGACTGG - Intronic
1148565833 17:48632429-48632451 GAGGGGAGCAGAATCAGGACTGG - Intronic
1152301278 17:79496372-79496394 GAGAGGAAGAGCCCCAGGACAGG - Intronic
1152381954 17:79946760-79946782 GAGCAGAGCAGTCCCAGTGGTGG - Intronic
1152542941 17:80985894-80985916 GGCCTGACCAGTCCCAGGACTGG + Intergenic
1152742285 17:82023558-82023580 GTGCGGAGCAGTCCCAGCGCCGG - Exonic
1153771849 18:8423118-8423140 GAGCTGTGCAGGCCCAGGGCTGG - Intergenic
1153939561 18:9966465-9966487 GAGAGGAGCAGGCCTACGACAGG - Intergenic
1155146927 18:23092159-23092181 AAGCTGAGAAGTCCCATGACAGG + Intergenic
1155333047 18:24737470-24737492 GAGTAGAGCAGTTCCAGGAAGGG + Intergenic
1155654532 18:28177838-28177860 GAGCGGCGCAGGGCGAGGACCGG - Intergenic
1155728581 18:29122346-29122368 GAGCGCTGATGTCCCAGGACAGG - Intergenic
1156267287 18:35500176-35500198 GAGCTAAGCATTCCCAGGAGAGG - Intergenic
1158673899 18:59501249-59501271 GGACGAAGCAGCCCCAGGACAGG - Intronic
1159960209 18:74549795-74549817 GAGCAGTGCTGTCCCAGGTCTGG - Intronic
1161575155 19:5050982-5051004 GAGGGGAACAGCCGCAGGACCGG - Intronic
1161765429 19:6205266-6205288 GAGCTGAGCATGCTCAGGACTGG - Intergenic
1163221045 19:15921446-15921468 TGGGGGAACAGTCCCAGGACAGG - Intronic
1164189593 19:22901876-22901898 GGGCGGAACAGTCTCAGGTCTGG + Intergenic
1167447014 19:49543580-49543602 GAGAGGAGGTGTCCCAGGCCAGG - Exonic
1167473696 19:49688681-49688703 GAGGGGCGCAGACCCAGGAGAGG - Exonic
1167596763 19:50432212-50432234 GCGGGGAGCGGTCCCAGGAGGGG + Intergenic
925140229 2:1544934-1544956 GAGGTGAGAAGTCCCAGGACAGG - Intergenic
925879102 2:8336020-8336042 GAGCTGAGCAGTTCCAGCATAGG + Intergenic
927495317 2:23548016-23548038 GAGCTGAACTGTCCCAAGACAGG - Intronic
927533941 2:23837258-23837280 GATCGGAGCAGGCGCAGGAGTGG + Intronic
928230453 2:29494279-29494301 GAGCAGACCAGTACCAGGTCTGG - Intronic
929445995 2:42001882-42001904 GTGCGGAGCACTCCGCGGACAGG + Intergenic
930071373 2:47369233-47369255 GAGGTGAGCAGTCCCGGGAAGGG + Exonic
931178572 2:59877370-59877392 GAGTCCAGCACTCCCAGGACTGG - Intergenic
932166109 2:69508746-69508768 GAGCATAGCAGTCCCAGGAGAGG + Intronic
932330781 2:70897244-70897266 GAGAGCAGCAGGCCCGGGACAGG + Intergenic
933737109 2:85504087-85504109 GTGCGGGGCAGGCCCAGCACAGG + Intergenic
934648691 2:96074265-96074287 AAGCGGACCAGGCTCAGGACAGG + Intergenic
934951761 2:98580499-98580521 GAGGGGTTCAGCCCCAGGACTGG - Intronic
935088987 2:99876111-99876133 AAGTGGAGGAGGCCCAGGACTGG - Intronic
935363004 2:102263589-102263611 ATGAAGAGCAGTCCCAGGACTGG - Intergenic
937236977 2:120437014-120437036 GAGAGGAGGAGTCCCAGGGCTGG + Intergenic
938115954 2:128603057-128603079 CAGCGGAGGAGGCCCAGGGCTGG + Intergenic
938213424 2:129487908-129487930 GAGGGGAGCATTTCCAGGAGTGG + Intergenic
938496659 2:131801535-131801557 CTGCGGAGCCGTCCGAGGACAGG - Exonic
941962610 2:171268815-171268837 TAGCGGGGCAGTCTCAGGATAGG + Intergenic
942225171 2:173808573-173808595 GGGCTGAGAAGTCCCATGACAGG + Intergenic
1169175212 20:3505441-3505463 GAGCTGAGAAGTCCCACGACAGG - Intronic
1172773266 20:37393595-37393617 TAGGGGAGGAGTCCCGGGACAGG - Intronic
1173808433 20:45941129-45941151 GAGCGGAGCAGTTCCACTTCGGG - Exonic
1173902632 20:46601999-46602021 GAGCAGAGGAGGCTCAGGACAGG + Intronic
1174126842 20:48312653-48312675 GAGGGGGTCAGGCCCAGGACTGG - Intergenic
1174161553 20:48554527-48554549 GAGGGGAGCAGGCAAAGGACCGG + Intergenic
1174483907 20:50849485-50849507 GAGCAAAGCAGAGCCAGGACAGG + Intronic
1175269100 20:57721259-57721281 GAGCTGAGCAGGGCAAGGACAGG + Intergenic
1175336045 20:58197062-58197084 GAGAGGAGGAGGCCCAGGAGAGG - Intergenic
1175336063 20:58197110-58197132 GAGAGGAGGAGGCCCAGGAGAGG - Intergenic
1176193008 20:63822425-63822447 GAGCCCATCAGTCCCAGGGCTGG - Intronic
1176375415 21:6084723-6084745 GGGCAGAGCAGTGCCAGGGCCGG - Intergenic
1176866571 21:14057723-14057745 GACCAGAGCAGTGCAAGGACAGG + Intergenic
1177586352 21:23101413-23101435 GAGCGGACCTGTCCCAGTGCTGG + Intergenic
1178334536 21:31731802-31731824 GAGCGGCGGAGTCCGAGGCCCGG + Exonic
1179748059 21:43453521-43453543 GGGCAGAGCAGTGCCAGGGCCGG + Intergenic
1179883374 21:44302718-44302740 GGCCCGAGAAGTCCCAGGACTGG - Intronic
1179925904 21:44533931-44533953 GAGCGGGCCAGGCTCAGGACGGG + Intronic
1180455649 22:15511315-15511337 CTGCGGAGCCGTCCGAGGACAGG + Intergenic
1181769834 22:25117351-25117373 GAGAGGGGAAGTCACAGGACTGG + Intronic
1183379062 22:37481702-37481724 GGGCCGGGCAGTCCCAGGGCCGG - Intronic
1183979101 22:41529408-41529430 GAGCCCAGCAGGCCCAGCACAGG + Intronic
1184669384 22:46004805-46004827 GAGAGAGGCAGTCCCAGCACAGG + Intergenic
1184670732 22:46011255-46011277 GAGCGGAGCTGGGGCAGGACAGG + Intergenic
1184716234 22:46283385-46283407 GGGAGCAGCAGCCCCAGGACCGG - Intronic
1184768083 22:46582392-46582414 GAGCAGAGAGGTCCCAGGAACGG - Intronic
1184971864 22:48028189-48028211 GAGAGGAGCCCTCCCAGGAGTGG + Intergenic
949105845 3:198295-198317 CCGCGGAGCAGCCCCAGGGCCGG + Intronic
949945037 3:9183140-9183162 GAGAGGAGGAGGCCCAGGAAGGG + Intronic
952970094 3:38645299-38645321 GTGGGGAGCAGACCCACGACAGG - Intronic
953125144 3:40085653-40085675 GAGCAGAGCAGCCCCAGCAAGGG + Intronic
954436180 3:50497549-50497571 GAGAGGAGCGGGACCAGGACCGG + Intronic
954659979 3:52221855-52221877 GGGCGAAACAGTCCCAGGAGAGG + Exonic
955024162 3:55151320-55151342 GAGCAGAGCAGTCCCCGCACAGG + Intergenic
956536234 3:70280144-70280166 GAGTGCAGCAGTCACAGGTCAGG - Intergenic
966113220 3:176428782-176428804 GAGGTAAGCAGTCCCAGTACTGG + Intergenic
967514465 3:190350067-190350089 GAGCGGACCAGGCACAGGGCAGG + Intronic
968266906 3:197369716-197369738 GAGTGGAGCAGGGCCAGGGCTGG - Intergenic
968471277 4:783482-783504 GAGCTGCCCAGTCCCAGGGCAGG - Intergenic
970271639 4:14354283-14354305 GAGCCCAGCAGTCTCAGAACAGG - Intergenic
970432329 4:16000784-16000806 GAGAGGGGCAGCTCCAGGACAGG + Intronic
975742083 4:77439143-77439165 AAGCGGAGAAGTCCCATAACAGG - Intergenic
976322499 4:83731845-83731867 AAGCTGAGAAGTCCCATGACAGG - Intergenic
977587220 4:98787053-98787075 GAGGGCAGCAGTACCAGGAGTGG + Intergenic
998321904 5:141240583-141240605 GACCAGAGCAGTCCCAGTTCTGG - Intergenic
998399697 5:141842168-141842190 GAGGGGAGGAGGCACAGGACAGG - Intergenic
999361704 5:150991496-150991518 GAGTTGGGCAGTCCCAGTACTGG + Intergenic
1000877816 5:166662964-166662986 GAGTGGAGCTGTCCCAGCAGGGG - Intergenic
1002884530 6:1281723-1281745 GGGCTGCGCAGTCCCAGGAGAGG + Intergenic
1004864226 6:19837663-19837685 GAGCGGAGCCGGCCGCGGACGGG + Exonic
1007250598 6:40492366-40492388 GAGAGGAGCTGGGCCAGGACAGG - Intronic
1017665898 6:156720047-156720069 GCGCAGAGCCGGCCCAGGACGGG + Intergenic
1018687903 6:166317922-166317944 GTGGGGTGTAGTCCCAGGACAGG - Intergenic
1018750113 6:166797045-166797067 GAGCAAAGCAGTCACAGCACTGG + Intronic
1019306341 7:337048-337070 GAGGGAAGCTGTCCCAGGACAGG + Intergenic
1019528822 7:1493707-1493729 GAGGGGAGCAGACCCAGCACAGG + Intronic
1022496340 7:30855372-30855394 GAGTGCAGCAGTCACAGGAGAGG + Intronic
1022800786 7:33775412-33775434 GAGCTGAGGAGTCCCAGGAGAGG + Intergenic
1024459877 7:49648965-49648987 AGGCTGAGAAGTCCCAGGACAGG - Intergenic
1029075080 7:97928500-97928522 GAGCGGCGCAGGCCCGGGCCCGG - Intergenic
1029113262 7:98224018-98224040 GAGCGGAGCAGTCACTTGTCAGG + Intronic
1029402994 7:100357055-100357077 TTGCAGGGCAGTCCCAGGACTGG - Intronic
1030042512 7:105464747-105464769 GAGTTGAGAAGTCCCACGACAGG - Intronic
1034040420 7:147871507-147871529 CAGAGGAGGAGTCCCAGGAGGGG - Intronic
1034413893 7:150955178-150955200 GAGCGGGGAAGTCCCAGCAACGG + Intronic
1034553069 7:151833410-151833432 GAGCGGAGGAGGCCCTGGAAAGG + Intronic
1036242448 8:7091879-7091901 GAGCGGCGCAGTCCCGGGCCCGG + Intergenic
1037882194 8:22578853-22578875 GCGCGGGGCAGTCCCTGGACCGG + Exonic
1037890321 8:22620650-22620672 GAGGGCAGCAGGCCCAGGAAGGG + Exonic
1040696589 8:50007045-50007067 GGGAGGAGGAGTCCCAGGACAGG + Intronic
1040866781 8:52055514-52055536 CAGTGGAGAAGCCCCAGGACAGG - Intergenic
1046521831 8:115334778-115334800 GAGTGCAGAAGTCCCAGGAAAGG - Intergenic
1047247713 8:123159182-123159204 GGGTGTAGCAGTCCCAGGACTGG + Intergenic
1047289874 8:123520421-123520443 GAGCCGTGCAGTACCAGGAATGG + Intronic
1048256122 8:132906525-132906547 AAGGGGAGCAGGCCCAGGCCAGG + Intronic
1049708512 8:144053500-144053522 GTGCTGAGCAGTCCCAGGCCAGG - Intronic
1052252968 9:26421639-26421661 GAGTGGAGCAATCTCAGTACTGG - Intergenic
1055755139 9:79550170-79550192 AAGAGAAGCAGTCCCTGGACAGG - Intergenic
1055787354 9:79884808-79884830 GCCAGGAGCACTCCCAGGACAGG + Intergenic
1056706060 9:88953594-88953616 GAGTGGGGCAGTTCCAGGTCTGG + Intergenic
1057225079 9:93288917-93288939 GGGCAGAGCAGTCACAGGAGGGG - Exonic
1060499056 9:124139069-124139091 GGGAGGAGCAGTGCCAGGAAAGG - Intergenic
1061168335 9:128937492-128937514 GAGCAGAGCAGGGCAAGGACTGG - Intronic
1061519917 9:131111892-131111914 GAGAGGGGCAGGGCCAGGACCGG - Intronic
1061609942 9:131739709-131739731 GAGCGGCGGAGCCCCAGGGCCGG + Intronic
1062369546 9:136230794-136230816 GAGCGGAGCAGTGCTGGGTCTGG - Intronic
1062569717 9:137179475-137179497 GATCCCAGCAGTCCCAGTACAGG - Intronic
1062610579 9:137371663-137371685 GAGCTGAGCACCCCCAGGCCAGG + Intronic
1187396597 X:18924656-18924678 GAGCAGGGCAGCCCCATGACTGG - Intronic
1191697250 X:64003013-64003035 GAGCAGAGCAGTCCAAGCAAAGG + Intergenic
1194532401 X:95068099-95068121 GAGATGAGCACTCCCAGTACCGG + Intergenic
1195655404 X:107327401-107327423 GAGTGGACCTGTCCCAGGACAGG + Intergenic
1199736987 X:150693850-150693872 GAGGGCAGCAGTCCCCGGATGGG - Intronic
1200822190 Y:7597979-7598001 GAGCTGAGCTGACCCAGCACTGG + Intergenic
1202238111 Y:22736038-22736060 GAGCTGAGCTGACCCAGCACTGG - Intergenic