ID: 1148052648

View in Genome Browser
Species Human (GRCh38)
Location 17:44776705-44776727
Sequence GGGTTGAGCGGAGCAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052648_1148052661 23 Left 1148052648 17:44776705-44776727 CCTGGGACTGCTCCGCTCAACCC 0: 1
1: 1
2: 0
3: 7
4: 129
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052648_1148052658 19 Left 1148052648 17:44776705-44776727 CCTGGGACTGCTCCGCTCAACCC 0: 1
1: 1
2: 0
3: 7
4: 129
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052648 Original CRISPR GGGTTGAGCGGAGCAGTCCC AGG (reversed) Intronic
900127169 1:1073752-1073774 GGGTGGGGCGGGGCAGTGCCAGG - Intronic
901652135 1:10749067-10749089 GGGTTGGGAGAAGCAGTCCGGGG + Intronic
902727297 1:18345716-18345738 GTGTTAAGCAGAACAGTCCCTGG - Intronic
905884678 1:41485264-41485286 GGGTTGAGGGGGGCATTTCCTGG - Intergenic
920930506 1:210383461-210383483 GGATTGAGGGGAGCAGGGCCAGG + Intronic
921960160 1:221026015-221026037 GGGTTGCTCTGAGCAGTCTCTGG + Intergenic
1064138263 10:12768893-12768915 GGGCTGAGAGTAGCAGTCCTGGG - Intronic
1064946358 10:20794183-20794205 GGGTGGAGCAGAGCAGGACCTGG + Intronic
1067568538 10:47355030-47355052 GGGTGCAGGGGAGCAGTCCATGG + Intronic
1068449371 10:57165821-57165843 GGGTTGTGTGGACCAGGCCCAGG - Intergenic
1069592256 10:69649556-69649578 GTGTTGAGGGGAGCAGTCTATGG + Intergenic
1071826504 10:89331024-89331046 AAGTTGAGGGCAGCAGTCCCAGG + Intronic
1072071672 10:91923985-91924007 GAGCTGAGCGGCGCAGGCCCAGG - Exonic
1072627199 10:97120246-97120268 GGGATGAGCTCAGCAGTCACAGG - Intronic
1078927549 11:15888169-15888191 GGGTACAGCAGAGCAGTCTCTGG + Intergenic
1080412689 11:32040749-32040771 GTGTTCAGTGGAGCAGTGCCTGG + Intronic
1084426069 11:69085172-69085194 GGGTGGGGCTGATCAGTCCCCGG + Intronic
1084679100 11:70655490-70655512 GGGTTAAGCGGAGCACTGCAGGG + Intronic
1085314012 11:75532407-75532429 GGTTGGAGGGAAGCAGTCCCCGG - Intergenic
1085842736 11:80031386-80031408 GTGTTGAGTGAATCAGTCCCTGG + Intergenic
1087034683 11:93743518-93743540 GGGTGGAGCGCAGCAGGCCTGGG - Intronic
1089259806 11:117216407-117216429 GAGTTGAGCAGCTCAGTCCCAGG - Intronic
1089466732 11:118690505-118690527 GGGATGAGCAGACCAGTGCCTGG - Intergenic
1090977914 11:131691756-131691778 GGGCTGGGCGCAGCGGTCCCGGG + Intronic
1096602847 12:52742492-52742514 GGGTGGAAAAGAGCAGTCCCCGG + Intergenic
1096687067 12:53295186-53295208 GGGTGGAGAGGAGCAGGGCCAGG + Intergenic
1098226834 12:68332610-68332632 GGGTTGGGTGGACCGGTCCCTGG + Intergenic
1099854168 12:88142521-88142543 GAATTGAGGGGAGCAGTCCTGGG + Intronic
1103524419 12:121558385-121558407 GTGTTGAGCCGTGCTGTCCCAGG - Intronic
1107351167 13:39516370-39516392 GTGGTGAGCCGAGCAGCCCCTGG + Intronic
1112061211 13:95741710-95741732 GTGTTGAGTGGGGCAGTCCCAGG + Intronic
1113398335 13:109969364-109969386 GTGTTGACAAGAGCAGTCCCGGG + Intergenic
1115771519 14:36666983-36667005 GGGCCGAGCGGAGCAGCCCTGGG + Intronic
1116057101 14:39877077-39877099 GGGATGAGCAGGGCAGCCCCAGG + Intergenic
1121410520 14:93745638-93745660 GGGTTGAAGGGAGCAGCCACAGG - Intronic
1122650979 14:103226974-103226996 GGCTGGAGTGGAGCAGCCCCGGG - Intergenic
1122848667 14:104514693-104514715 GGGTGGTGCAGAGGAGTCCCCGG + Intronic
1123109414 14:105858704-105858726 GGGTTGAGCTGAGCTGAACCAGG - Intergenic
1123178186 14:106442194-106442216 GGGTTGAGAGGTGCATTCTCTGG - Intergenic
1123948876 15:25251937-25251959 TGGTTGAGTGGAGCTGGCCCAGG + Intergenic
1124121658 15:26893735-26893757 GGGGTGAGGGGAGCAGGGCCCGG + Intronic
1126714336 15:51498186-51498208 GAGTTGAGCGGTGCAGTCATGGG - Intronic
1129692980 15:77724156-77724178 GGGCAGAGCTGAGCAGACCCTGG - Intronic
1132215213 15:100057374-100057396 GGGTTCTACGGAGCAGGCCCTGG - Intronic
1132480842 16:165425-165447 GGGTGGAGCGGAGCAGTCCCGGG + Intronic
1132515601 16:364355-364377 GGGTTGTGGGGAGGGGTCCCAGG - Intergenic
1132735495 16:1383956-1383978 GGGCTGAGCTGAGCAGGGCCCGG + Intronic
1133069088 16:3234073-3234095 GGGTGGAGCGGAGAAGGCCAAGG + Intronic
1133840799 16:9407495-9407517 GGCTAGAGAGGAGCAGTGCCAGG - Intergenic
1135374816 16:21936355-21936377 GGGGTGAGGCGAGCAGTCCCAGG + Intergenic
1136264770 16:29108779-29108801 GGGGTGAGGCGAGCAGTCCCAGG + Intergenic
1139533090 16:67553210-67553232 GAATGGAGCGGAGCAGTCACTGG - Intergenic
1141684536 16:85562719-85562741 GTGTTGGGGGGAGCGGTCCCAGG + Intergenic
1142053556 16:87976763-87976785 GGGGTGAGGTGAGCAGTCCCAGG + Intronic
1142145962 16:88493074-88493096 GGGGTGCGGGGAGCTGTCCCGGG + Intronic
1142145970 16:88493094-88493116 GGGGTGCGGGGAGCTGTCCCGGG + Intronic
1142145980 16:88493114-88493136 GGGGTGGGGGGAGCTGTCCCGGG + Intronic
1142146077 16:88493414-88493436 GGGGTGCGGGGAGCTGTCCCGGG + Intronic
1142146090 16:88493454-88493476 GGGCTGCGGGGAGCTGTCCCGGG + Intronic
1142146161 16:88493654-88493676 GGGGTGCGGGGAGCTGTCCCGGG + Intronic
1142791121 17:2266871-2266893 GGGTTGCAAGGAGCAGCCCCTGG - Intronic
1143655714 17:8292416-8292438 GGGTTGAGCAGAGCAGTGGCTGG + Intronic
1144724835 17:17496561-17496583 GGGCTGGGGGGAGCAGTCCAGGG + Intergenic
1145153187 17:20522853-20522875 GGGTTGAGCCTTGGAGTCCCTGG + Intergenic
1147228926 17:39003061-39003083 TGGTGGAGCGGAGAAGGCCCCGG - Intergenic
1148052648 17:44776705-44776727 GGGTTGAGCGGAGCAGTCCCAGG - Intronic
1153464676 18:5376306-5376328 GGGTTGAGCTGGGAAGTCTCTGG + Intergenic
1158184764 18:54759560-54759582 GGGTAGAGGAGGGCAGTCCCTGG + Intronic
1161233915 19:3188745-3188767 GGGGTGAGCGGAGGAGCCCATGG + Intronic
1161591754 19:5132109-5132131 GGGTTCAGGGGAGGAGACCCAGG - Intronic
1162191676 19:8951865-8951887 GGGTTGAGAAGAGAAGTCACAGG + Exonic
1162307767 19:9885765-9885787 GGGGTGAGGGGAGCAGGACCTGG - Intronic
1162920745 19:13901054-13901076 GGCTTGAGCTGAGGAGTTCCAGG - Intronic
1166000789 19:39876273-39876295 GGATTGAGCCCAGCAGTTCCAGG + Intronic
1166117962 19:40667363-40667385 GTGTTGAGGGGCGCAGCCCCAGG + Exonic
1167524150 19:49973183-49973205 AAGTTGAGTGGAGCAGTCCTTGG - Intergenic
1168147911 19:54429987-54430009 GGGTTGGGCAGTGCAGGCCCTGG + Intronic
929797573 2:45072075-45072097 GAGCTGAGTGGAGCAGTTCCTGG - Intergenic
930238936 2:48915931-48915953 GGGTGGGACAGAGCAGTCCCTGG - Intergenic
931720007 2:65060819-65060841 GGGTTGAGGGGAGGAGTAGCTGG + Intronic
935492270 2:103735345-103735367 GGGCTGAGTGGGCCAGTCCCTGG + Intergenic
937223818 2:120356940-120356962 GGGCTGGGCAGAGCAGACCCCGG - Intergenic
938213423 2:129487903-129487925 GGGCTGAGGGGAGCATTTCCAGG + Intergenic
940517329 2:154698232-154698254 GGGGTGCGGGGAGCGGTCCCAGG + Intergenic
941917947 2:170824139-170824161 GGGTTGTGGGGAGCAGACACAGG - Intronic
1169067059 20:2700000-2700022 GGGCTGAGCAGAGCAGGCTCTGG - Intronic
1175330146 20:58158057-58158079 TGGTTGTGCAGAGCAGGCCCAGG - Intronic
1175689505 20:61055393-61055415 GGGTTCCGTGGAGCAGTGCCAGG + Intergenic
1175976061 20:62711052-62711074 GGGGTGAGGGCAGCAGTGCCGGG + Intronic
1176243011 20:64083754-64083776 GCGTTGAGCGGAGCCGGCCGGGG - Intronic
1176375417 21:6084728-6084750 GGGTGGGGCAGAGCAGTGCCAGG - Intergenic
1178916559 21:36708421-36708443 CTGTTGAGCGGAGGAGTCCGGGG + Intronic
1179163105 21:38913620-38913642 GCGGTGGGCGGAGCGGTCCCTGG - Intergenic
1179748057 21:43453516-43453538 GGGTGGGGCAGAGCAGTGCCAGG + Intergenic
1179802814 21:43819477-43819499 GGGTGGGGAGGTGCAGTCCCAGG + Intergenic
1179886716 21:44317306-44317328 GTGCTGAGCCGAGCATTCCCAGG + Intronic
1182524521 22:30907055-30907077 GATTTGAGGGCAGCAGTCCCTGG + Exonic
954337651 3:49929253-49929275 GGGATGAGCGGGGCAGCACCTGG - Intronic
954784233 3:53081345-53081367 GGGTGGAGAGGAGCAGAGCCTGG + Intronic
968601624 4:1512564-1512586 GGGCTCAGCAGAGCAGTCCCTGG + Intergenic
968979808 4:3841152-3841174 GGGTTAAGTGAGGCAGTCCCTGG - Intergenic
971226517 4:24758401-24758423 GGGATGAGGGGTGCAGCCCCAGG + Intergenic
984862765 4:184254944-184254966 AGGATGATGGGAGCAGTCCCGGG - Intergenic
985569810 5:638809-638831 GGGTTGAGGGGAGGAGTCTGGGG + Intronic
992431658 5:76716243-76716265 GGGTGAAGCGGAGCAGCCCGAGG + Exonic
994797950 5:104330665-104330687 GTCTTGAGCAGATCAGTCCCAGG - Intergenic
1000616946 5:163437743-163437765 GGGGTGAGGTGAGCAGGCCCGGG + Exonic
1002090855 5:176805218-176805240 GGGTGGAGAGGAGCAGAGCCTGG - Intergenic
1007004237 6:38345356-38345378 GGGTTGAACTGAACAGTACCTGG - Intronic
1014432902 6:121390453-121390475 ACGTTGAGCGGAGCAATCCTAGG - Intergenic
1019529288 7:1495530-1495552 GGAATGAGCGGAGCACTTCCAGG + Exonic
1019731038 7:2629835-2629857 GGGATGAACAGGGCAGTCCCTGG - Intergenic
1021116742 7:16753618-16753640 GGGAGGGGCGGAGCGGTCCCGGG - Exonic
1022968056 7:35492781-35492803 GGATTGAGCGGAGCGGGTCCCGG - Intergenic
1032043540 7:128582677-128582699 GTGTTGAGCAGAGGAGTGCCGGG - Intergenic
1032591203 7:133193950-133193972 GGGTGGAAAGGGGCAGTCCCTGG - Intergenic
1034844447 7:154431316-154431338 GGGTGGTGTGGAGCAGGCCCTGG - Intronic
1035759790 8:2061153-2061175 GGGTTGAAAGGAGCTGTCTCCGG + Intronic
1036242447 8:7091874-7091896 GGTGAGAGCGGCGCAGTCCCGGG + Intergenic
1036453582 8:8890709-8890731 GGGTGGCCCGGAGCAGTTCCTGG + Exonic
1037179877 8:15992579-15992601 GGGTGGAGCAGGTCAGTCCCTGG + Intergenic
1039468015 8:37797425-37797447 GGGCTGAGCGGCGGCGTCCCTGG + Exonic
1040918315 8:52586985-52587007 GGGTTGAGCGCAGCGGGCCCTGG - Intergenic
1045790496 8:105978180-105978202 GGGTTTATAGGAGCAGACCCAGG - Intergenic
1048871718 8:138804423-138804445 TGCTTGAGCAGAGCAGGCCCTGG - Intronic
1048941864 8:139406821-139406843 GGCATGAGAGGAGCAGCCCCTGG + Intergenic
1049090473 8:140510676-140510698 GGTTTGAGCAGTGGAGTCCCGGG - Intergenic
1049293690 8:141818169-141818191 GGGTTGAGCTTGGCACTCCCAGG - Intergenic
1049560156 8:143306330-143306352 AGGATGCGCTGAGCAGTCCCGGG + Intronic
1049788321 8:144461902-144461924 GGGTTGCGGGGAGCAGTTGCGGG + Intronic
1049825126 8:144662925-144662947 GGGGTGTGGGGAGCAGTCCAAGG - Intergenic
1059906719 9:118994845-118994867 GGGTTCAGCTGAGCAGTTCTGGG + Intergenic
1060396682 9:123321280-123321302 GGGTTGTGGAGAGCAGTGCCAGG - Intergenic
1060847915 9:126851858-126851880 GGGTTGCTGGGAGCAGTCCTAGG - Intergenic
1061134409 9:128724930-128724952 GGGCTGAGTGGAGAAGGCCCTGG - Intergenic
1061144069 9:128787100-128787122 GGGTTGAGCGGGGCAACCTCGGG - Intergenic
1062152791 9:135030494-135030516 GGGTTGCGGGGAGCAGGCCTGGG - Intergenic
1190316665 X:49156239-49156261 GGGTTCAGAGGAGCAGGCCTGGG - Intergenic