ID: 1148052649

View in Genome Browser
Species Human (GRCh38)
Location 17:44776717-44776739
Sequence GAGAGAGGGGTGGGGTTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1508
Summary {0: 1, 1: 2, 2: 4, 3: 145, 4: 1356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052649_1148052661 11 Left 1148052649 17:44776717-44776739 CCGCTCAACCCCACCCCTCTCTC 0: 1
1: 2
2: 4
3: 145
4: 1356
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052649_1148052658 7 Left 1148052649 17:44776717-44776739 CCGCTCAACCCCACCCCTCTCTC 0: 1
1: 2
2: 4
3: 145
4: 1356
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052649 Original CRISPR GAGAGAGGGGTGGGGTTGAG CGG (reversed) Intronic
900086802 1:902460-902482 GAGAGAGGGGTGCGTTTGTGGGG + Intergenic
900174029 1:1284128-1284150 GTGAGGGGGGTGGGGTCGGGGGG + Intronic
900205060 1:1428015-1428037 GAGAGAGGGGAGGGGAGGGGAGG + Intergenic
900407965 1:2500771-2500793 GAGGGAGGGGAGGGGAGGAGAGG - Intronic
900479940 1:2893184-2893206 CAGAGTGGGGTGGGGTGGAGTGG - Intergenic
900801056 1:4737330-4737352 GAGAGAGGTGAGGGGCCGAGGGG - Intronic
900900287 1:5511229-5511251 GAGAGAGTGGTGGGACGGAGGGG + Intergenic
900974046 1:6006493-6006515 GGGAGTGGAGTGGGGCTGAGGGG - Intronic
901223398 1:7596843-7596865 GAGACATGGGTGGGGGTGGGGGG - Intronic
901234220 1:7658999-7659021 GGGGGATGGGTGGGGCTGAGTGG - Intronic
901340774 1:8497038-8497060 TACAGAGGGGTGGGGGTGAGGGG - Intronic
901407734 1:9060948-9060970 GAGAGAGGGGTGGGGGTGAGGGG + Intronic
901511617 1:9720662-9720684 GTGAGTGGGGTGGGGGTGTGGGG + Intronic
901829449 1:11883248-11883270 AAGAGCGGGATGGGGTTGGGGGG - Intergenic
901844092 1:11971204-11971226 GTGGGAGGGGTAGGGTGGAGTGG + Intronic
902081427 1:13823593-13823615 GAGAGAGGGGTGGTACTGAAGGG - Exonic
902256167 1:15189997-15190019 GAGAGAGGGAAGGGGATGAGGGG - Intronic
902791415 1:18770816-18770838 GAGGGGGTGGTGGAGTTGAGGGG + Intergenic
903014700 1:20354287-20354309 GAGGGAAGGGTGGGGAGGAGAGG + Intronic
903014979 1:20355797-20355819 GATGGAGGGGTGGGGGTGGGGGG - Intergenic
903088368 1:20884913-20884935 GGGTTGGGGGTGGGGTTGAGCGG + Intronic
903293983 1:22332173-22332195 GAGAGAGGGGTGGGTGAGGGTGG - Intergenic
903332551 1:22603390-22603412 AAGAGTGGGGTGGGGTGGGGAGG - Exonic
903420251 1:23213843-23213865 GAGAGAGGGGCTGGGTAGCGTGG - Intergenic
903497294 1:23778323-23778345 GCGGGGGGGGTGGGGTCGAGCGG - Intergenic
903515602 1:23908917-23908939 GAGAGACAGGTGGGGTGGTGGGG + Intronic
903613442 1:24633882-24633904 GGGACAGGGCAGGGGTTGAGAGG + Intronic
904055456 1:27667051-27667073 GAGAGAGAGGTGGGGGTGGGTGG + Intronic
904298851 1:29541350-29541372 GAGATGAGGGTGGGGTGGAGTGG + Intergenic
904322650 1:29707419-29707441 AAGAGAGGGGAGGGGAGGAGAGG + Intergenic
904322702 1:29707529-29707551 AAGAGAGGGGAGGGGAGGAGAGG + Intergenic
904322728 1:29707587-29707609 GAGGGAGGGGAGGGGAAGAGAGG + Intergenic
904352655 1:29918961-29918983 GAGAAAGGGGTGTGGATAAGTGG - Intergenic
904361651 1:29977242-29977264 GGGAGAGGGGAGTAGTTGAGAGG - Intergenic
904471707 1:30740395-30740417 GAGTGGGGGGTGGGGGGGAGGGG - Intronic
904521752 1:31101263-31101285 AAGAAGGGGGTGGGGTAGAGAGG + Intergenic
904567383 1:31435772-31435794 CAGAGAGGGGTGGGGTGGCGAGG + Intergenic
904824484 1:33265566-33265588 GAGAGTGGGGTGGGGTGCAGTGG + Intronic
904918148 1:33985238-33985260 CAGGGAGGGGTGGGGTGGATGGG - Intronic
905164675 1:36072776-36072798 GAAAAATGGGTGGGGTAGAGGGG - Intergenic
905275515 1:36815373-36815395 GAGAGAAGGAAGGGGTTGGGTGG - Intronic
905291389 1:36924079-36924101 GAGACAGCGGTGGGGCTAAGGGG + Intronic
905404830 1:37725703-37725725 GAGAGATGGGTGGAGATGAAGGG + Intronic
905519731 1:38588763-38588785 GGGTGGGTGGTGGGGTTGAGAGG - Intergenic
905706187 1:40060668-40060690 GAGTGTGGGGTGGGGGTGGGGGG - Intronic
905798905 1:40831021-40831043 GAGCTGGGGGTGGGGGTGAGTGG - Intronic
905884681 1:41485276-41485298 GTGACAGGGCAGGGGTTGAGGGG - Intergenic
906056651 1:42923319-42923341 AGGATAGGGTTGGGGTTGAGTGG + Intergenic
906237607 1:44221329-44221351 GATTGAGGGGTGGGGATGGGGGG + Exonic
906545402 1:46616487-46616509 GGCAGAGGGGAGGGGTTGGGGGG - Intronic
906781630 1:48577781-48577803 GAGAGAGGGGTGAGAGTGAGGGG + Intronic
906954548 1:50361235-50361257 AAGAGTGGGGTGGGGGTGGGGGG + Intergenic
907255123 1:53173390-53173412 GAGGGAGGGGAGGGGAGGAGAGG - Intergenic
907272889 1:53301021-53301043 GTGTGGGGGGTGGGGTGGAGTGG + Intronic
907455788 1:54574667-54574689 GGGAGCGGGGTGGGGATGATGGG - Intronic
907486881 1:54784186-54784208 CAGAGGGAGGTGGGGTAGAGAGG + Intronic
907577748 1:55543111-55543133 GAGAGAAGGGGTGGGTTGTGGGG - Intergenic
907866862 1:58407113-58407135 AAGAAAGAGGTGGGGGTGAGAGG - Intronic
907990459 1:59577508-59577530 GAGAGAGGGGTTGGGTATAGTGG + Intronic
908059782 1:60335282-60335304 GAGTGTGGAGTGGGGTAGAGTGG - Intergenic
908262409 1:62349409-62349431 AAGAGAGGGGTGGGGAAGGGAGG + Intergenic
908901468 1:68961272-68961294 GAGAGGGGGGTGGGGTGGGGAGG - Intergenic
908951942 1:69570429-69570451 GAGCAAGGGGTGGGGGTGAAGGG - Intronic
909262134 1:73503937-73503959 CAGCGAGGAGTGGGGTTGTGAGG + Intergenic
909433498 1:75615811-75615833 GAGAGAGGGGAGGCGGCGAGGGG + Intergenic
909533044 1:76702029-76702051 GAGAGGGGGGTGGGGAGGTGGGG + Intergenic
909958340 1:81803357-81803379 GACTGCGGGGTGGGGGTGAGGGG + Intronic
909990967 1:82222256-82222278 GAGAGAAGGGAGGAGTTGAAAGG - Intergenic
910236495 1:85041931-85041953 GAGAGAGAGGTTTGGATGAGAGG - Intronic
910262713 1:85307636-85307658 GAGAGAGGAGAGGGGTGGGGAGG - Intergenic
910434237 1:87188820-87188842 GAGGCAGGGGTAGGGTGGAGTGG + Intergenic
910507864 1:87970779-87970801 GAGGAAGGGGTGGGGTAGGGGGG - Intergenic
911075893 1:93874587-93874609 GACAGCTGGGTGGGGTAGAGAGG + Intronic
911445443 1:97986302-97986324 GAGGGTGGGGTGGGGTGGACAGG - Intergenic
912010154 1:104948886-104948908 GAGAGAGAGGTGGAATTGAGGGG + Intergenic
912275730 1:108256562-108256584 GAGGGAGGGGAGGGGAGGAGAGG - Intergenic
912292496 1:108437792-108437814 GAGGGAGGGGAGGGGAGGAGAGG + Intronic
912702833 1:111890972-111890994 CTGAGTGGGGTGGGTTTGAGGGG + Intronic
913052663 1:115130933-115130955 GAGAGCTGGGTGAGCTTGAGGGG + Intergenic
913144561 1:115976586-115976608 GAGAGGGCGGTGGGGTGGCGGGG + Exonic
913231895 1:116746869-116746891 GAGAGGGAGGAGGGGATGAGGGG - Intergenic
913278700 1:117164351-117164373 GGCAGGGGGGTGGGGTTGCGGGG + Intronic
913663898 1:121030094-121030116 GGGAGAGGGATGAGGTAGAGAGG - Intergenic
914015292 1:143813373-143813395 GGGAGAGGGATGAGGTAGAGAGG - Intergenic
914162526 1:145147852-145147874 GGGAGAGGGATGAGGTAGAGAGG + Intergenic
914346674 1:146806049-146806071 GAGAGAGAGCTGGTGGTGAGGGG + Intergenic
914653910 1:149721914-149721936 GGGAGAGGGATGAGGTAGAGAGG - Intergenic
915150530 1:153827148-153827170 GGGTGTGGGTTGGGGTTGAGGGG + Intronic
915297333 1:154930525-154930547 GTGAGACTGGTGGGGTTGGGTGG - Intronic
915525942 1:156476301-156476323 GTGAATGGGGTGGGGGTGAGAGG - Intronic
915595564 1:156894667-156894689 GAGACGGGGGTGGGGGTGAAGGG - Intronic
915622645 1:157095324-157095346 GAGTGAGGGGTGGAGGTGAGGGG + Intronic
915735022 1:158078966-158078988 GAGAGAGGCTGGGGGCTGAGTGG - Intronic
916029348 1:160862705-160862727 GAGAGTCTGGTGGGGTGGAGGGG - Exonic
916441071 1:164825206-164825228 GATAGTGGGGTGGGATGGAGAGG - Intronic
916649677 1:166823071-166823093 GAGAGTGGGGTGGCATGGAGGGG + Intergenic
916719801 1:167475804-167475826 AAGAGAGGGGTCGGGCTGTGGGG + Intronic
917288273 1:173444176-173444198 GAGAAAGGGGTCGGGTGGAGTGG - Intergenic
917531910 1:175843160-175843182 GGGAGGGGGGTGGGGTTGCTGGG + Intergenic
917725304 1:177822051-177822073 GGAAGTGGGGTGGGGTGGAGTGG + Intergenic
917740152 1:177953848-177953870 GAGAGTAGGGTGGGGGTGTGGGG - Intronic
917771296 1:178282052-178282074 GAGAGAGGGTTGGTGTAGATTGG + Intronic
918093740 1:181318017-181318039 GGGAAAGGGGTGGGGATGGGAGG - Intergenic
918220795 1:182434590-182434612 GAGAGAGGGGTGGGGATGTGGGG + Intergenic
918491024 1:185081576-185081598 TAGAGACGGGTGGGGTGGGGGGG + Intronic
919195938 1:194286416-194286438 GAGTGTGGGGTGGGGTGGGGCGG - Intergenic
919646718 1:200102599-200102621 GAGGTAGGGGTGGAGTTTAGTGG - Intronic
919704162 1:200660399-200660421 GTGAGAGGGGTGGGAGTGACAGG + Intronic
919728570 1:200899101-200899123 GAGAGAGGGGTAGTGGGGAGAGG + Intronic
919866973 1:201789816-201789838 GGTAGAGGGGAGGGGATGAGAGG - Intronic
920046550 1:203136422-203136444 CAGAGAGGTGTGGGGCTGAGGGG + Intronic
920049173 1:203152934-203152956 GAGAAAGGGATGAGGTTCAGAGG + Intronic
920348027 1:205319097-205319119 GAGGCAGGGGTGGGGTGGGGTGG + Intronic
920371051 1:205479548-205479570 GGGAGGGGGGTGGGGTGGTGGGG + Intergenic
920675936 1:208038782-208038804 GTGTGAGGGCAGGGGTTGAGAGG - Intronic
920844965 1:209585929-209585951 GCGAGGGGGTTGGGGCTGAGTGG + Intronic
921206829 1:212856818-212856840 GTCAGCGGGGTGAGGTTGAGGGG + Intergenic
921217064 1:212946854-212946876 GAGAAAAGGGTGGATTTGAGAGG + Intergenic
922162414 1:223088401-223088423 GAGGGAGACATGGGGTTGAGAGG - Intergenic
922272056 1:224043562-224043584 GGGAGAGGGGTGTGCTGGAGGGG - Intergenic
922337901 1:224632604-224632626 GAGAGCGGGGTGGGGTGGTGAGG + Intronic
922377693 1:224985467-224985489 AAGAGCTGGGTGGGGGTGAGGGG + Intronic
922448231 1:225715928-225715950 TAGACAGGGATGGGGTGGAGAGG + Intergenic
922820796 1:228484101-228484123 GAGAGAGAGGTGGGGGCGGGGGG - Intergenic
922882341 1:228990402-228990424 GGGGGTGGGGTGGGGTGGAGTGG + Intergenic
922897958 1:229115152-229115174 GGGAGCGGGATGGGGTGGAGCGG - Intergenic
922934389 1:229412096-229412118 GAGAGAGGGTAGGGGTGGCGTGG - Intergenic
923101266 1:230819702-230819724 GAGGGAGGGTTTGGGTTGAGGGG - Intergenic
923519273 1:234723377-234723399 CAGAGCAGGGTGGGGTGGAGGGG + Intergenic
924119914 1:240785668-240785690 GAGAGAGGGATGGGGGTCACTGG + Intronic
924270287 1:242325390-242325412 GAGAGAGAGTGGGGGTTGTGGGG + Intronic
924286640 1:242494125-242494147 GAGAGAGGAGAGGGGAGGAGAGG - Intronic
924436642 1:244048808-244048830 GAGGGAGGGGCGGGGGGGAGCGG + Intergenic
924552346 1:245090243-245090265 GACAGATGGGAGGGGGTGAGAGG + Intronic
924764843 1:247022747-247022769 GAGAGAGAGGTGGGAGAGAGAGG + Intergenic
924810929 1:247401349-247401371 GAGCGTGGGATGGGGTGGAGGGG + Intergenic
1062821928 10:541427-541449 GAGAGACGGGTGTGGTCGGGTGG - Intronic
1062821988 10:541647-541669 GAGAGACGGGTGTGGTCGGGTGG - Intronic
1062878527 10:960232-960254 GACAGAGGGGGAGGGATGAGAGG + Intergenic
1062960818 10:1572698-1572720 GAGAGAGGGCTGGGGAAGAAGGG + Intronic
1063117155 10:3079652-3079674 GAGAGCGGGGTGGGGGGGGGGGG + Intronic
1063979927 10:11444773-11444795 GGGAGCGAGGTGGGGGTGAGTGG - Intergenic
1063984170 10:11483588-11483610 GAGAGAGGGGGAGGGGGGAGGGG + Intronic
1063984214 10:11483676-11483698 GAGAGAGGTGGGGGGTGGGGAGG + Intronic
1064123461 10:12638893-12638915 GAGAGAAGTGGGGGGATGAGAGG - Intronic
1064147631 10:12838005-12838027 GAGAGAAAGGTGGGCTGGAGGGG + Intergenic
1064421217 10:15192420-15192442 GAGAGAGGGGCTGGGTACAGTGG - Intergenic
1064624244 10:17246156-17246178 TTGAGAGGCGTGGGCTTGAGGGG - Intergenic
1064865008 10:19869463-19869485 GAGAAAGGGGGGGGGGGGAGAGG + Intronic
1065593636 10:27291107-27291129 GAAAGAGGGGAGGGGAGGAGAGG - Intergenic
1066186793 10:33017569-33017591 GAGGGAAGGCTGGGGTTAAGTGG - Intergenic
1066778334 10:38911744-38911766 CAGAGAGGAGTGGAGTGGAGTGG + Intergenic
1067436753 10:46284116-46284138 GAGAGAGGGCTGGGGCGGGGAGG + Intergenic
1068230743 10:54167660-54167682 GTGAAAGAGGAGGGGTTGAGGGG - Intronic
1068658561 10:59599710-59599732 GGGATGGGGGTGGGGTGGAGGGG + Intergenic
1068859940 10:61837807-61837829 GAGAAAGGGGTGGGTTAGGGTGG + Intergenic
1069037389 10:63659761-63659783 GGGAGAGGGGTGTGGTTATGGGG - Intergenic
1069162458 10:65108469-65108491 GAGAGAGGGGGACGGTAGAGGGG + Intergenic
1069535236 10:69248271-69248293 TAGGGAGGGGAGGGGATGAGAGG - Intronic
1069581240 10:69568544-69568566 GAGAGAGTGGAGGGGTGGGGTGG - Intergenic
1069717900 10:70532595-70532617 GAGGGAGGTGTGGGGGTCAGAGG - Intronic
1069825678 10:71253712-71253734 GAGAGTTGGGTGGGGGTGTGAGG + Intronic
1069893477 10:71666303-71666325 GAGTGAGCGGTGGGGTGGAGGGG - Intronic
1070285981 10:75084062-75084084 GTGAGGGGGGTGGAGTTGGGGGG + Intergenic
1070456049 10:76618576-76618598 GAGTGTGGGAAGGGGTTGAGGGG + Intergenic
1070516848 10:77215862-77215884 GAGAGACAGGTGGGGGGGAGGGG - Intronic
1070648441 10:78217899-78217921 GAGAGATGAGTGGGGAGGAGTGG - Intergenic
1070810430 10:79294937-79294959 GAGAGAGGGGGGGGGGTCAGGGG + Intronic
1070833077 10:79432109-79432131 GAGGCAGAGGTGGGGTTCAGGGG + Intronic
1071310258 10:84336661-84336683 GAGAGGTGGGTTGGGTTGGGGGG + Intronic
1071636013 10:87254851-87254873 GAGAGATGGGTGGACTTGTGTGG - Intergenic
1071659227 10:87483093-87483115 GAGAGATGGGTGGACTTGTGTGG + Intergenic
1072610856 10:97017019-97017041 CAGAGAGCCTTGGGGTTGAGGGG + Intronic
1072754314 10:98008415-98008437 GAGTGGGGGGTGGGGTGGGGGGG + Intronic
1072915141 10:99533147-99533169 GAGAAAGGGGTGGAGGTGACCGG - Exonic
1072986639 10:100146574-100146596 GAGTTAGAGGTGGGGTGGAGTGG + Intergenic
1073006488 10:100329374-100329396 GACAGATGGGTGGGGATGACTGG - Intronic
1073164157 10:101429500-101429522 GAGGGAGGGGAGGGGGGGAGGGG - Intronic
1073178453 10:101570235-101570257 GAGAGTGGAGTGGGGTGGAGTGG - Intergenic
1073463052 10:103677490-103677512 AAGACAGGGGTGGGGATGGGGGG + Intronic
1073960866 10:108926064-108926086 GAAAGTGGGGTGGGGGTGGGTGG - Intergenic
1074096317 10:110316485-110316507 GGGAGTTGGCTGGGGTTGAGGGG - Intergenic
1074428441 10:113372446-113372468 GAAATGGGGGTGGGGTGGAGGGG + Intergenic
1074727251 10:116324546-116324568 GAGAGAGGACTGGGATTGAAAGG + Exonic
1074828486 10:117231809-117231831 GAGTGAGGGATGGGGTGGGGTGG + Intergenic
1074942180 10:118246539-118246561 TAGAGAGAGGAGGGGTTCAGAGG + Intergenic
1075299222 10:121306538-121306560 GAGTGGGTGGTGGGGTTGACTGG + Intergenic
1075537879 10:123286318-123286340 GCGAGAGGTGTGGGATTCAGTGG - Intergenic
1075626296 10:123966566-123966588 GGGAGTGGGGTGGGGTGGGGAGG + Intergenic
1076102704 10:127795668-127795690 GGGAGTGGGGTGGGGTTGGGGGG + Intergenic
1076322933 10:129596937-129596959 GTGAGGGGGGTGGGGTGTAGTGG + Intronic
1076330927 10:129665596-129665618 TAGCGAGGGATGGGATTGAGGGG + Intronic
1076595669 10:131623252-131623274 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595674 10:131623265-131623287 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595679 10:131623278-131623300 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595747 10:131623475-131623497 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595755 10:131623499-131623521 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595763 10:131623523-131623545 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595778 10:131623561-131623583 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076595861 10:131623781-131623803 GGGAGAGAGGTGGGGGAGAGAGG + Intergenic
1076653534 10:132006199-132006221 GAGCGGGGGGTGGGGTGGGGTGG + Intergenic
1076771323 10:132666974-132666996 CAGAGGGGGTTGGGGGTGAGAGG - Intronic
1076790628 10:132775065-132775087 GAGAGAGGGGCAGGGGGGAGGGG + Intronic
1076815402 10:132912126-132912148 GAGAGAGATGTGGGGGTGGGGGG - Intronic
1076829271 10:132985968-132985990 GAGAAAGGGTAGGGGTTCAGGGG + Intergenic
1077001701 11:326651-326673 GAGAGAGGCGAAGGCTTGAGGGG - Intronic
1077016388 11:400770-400792 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016395 11:400785-400807 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016415 11:400830-400852 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016434 11:400876-400898 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016441 11:400891-400913 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016455 11:400922-400944 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016475 11:400968-400990 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016507 11:401046-401068 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016746 11:401664-401686 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016783 11:401743-401765 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016790 11:401758-401780 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016974 11:402153-402175 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017144 11:402525-402547 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017170 11:402579-402601 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017194 11:402632-402654 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017218 11:402685-402707 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017224 11:402700-402722 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017253 11:402762-402784 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017279 11:402816-402838 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017286 11:402831-402853 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017300 11:402862-402884 GTGAGCGGGGTCGGGGTGAGCGG - Intronic
1077017313 11:402893-402915 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017339 11:402947-402969 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017353 11:402978-403000 GTGAGTGGGGCGGGGGTGAGCGG - Intronic
1077186111 11:1236112-1236134 GGGAGCAGGGTGGGGTGGAGTGG + Intronic
1077204482 11:1336088-1336110 GAGAAAGGAGTGGGGTGGGGAGG + Intergenic
1077302067 11:1852018-1852040 GAGAGAGGCCAGGGGTTGGGAGG - Intergenic
1077552324 11:3206180-3206202 GGGAGAAGGGAGGGGATGAGAGG - Intergenic
1077921157 11:6642624-6642646 GAGGGTGGGGTGGGGTGGGGGGG + Intronic
1078013707 11:7594042-7594064 GAATGAAGGGAGGGGTTGAGCGG + Intronic
1078473942 11:11614314-11614336 GAGAGAGGGGTGAGAGAGAGAGG + Intronic
1078551961 11:12287374-12287396 GAGCCAGGGGTGGGGTGGAGGGG - Intronic
1079126104 11:17719635-17719657 GAGGGAGGGGTGGGGGACAGTGG + Exonic
1079173199 11:18115723-18115745 GAGAGAGATGTGGAGTTGAGGGG - Intronic
1079189322 11:18264770-18264792 GAGAGAGGGGAGGGGAGGGGAGG + Intergenic
1079248877 11:18772969-18772991 GAAAGAGGAGTGGGGGTGAGAGG + Intronic
1079308131 11:19342630-19342652 GAGAGAGAGGTGGGGGAGGGAGG + Intergenic
1079318461 11:19430135-19430157 CTGAGAGGGGTGGGGGTAAGGGG - Intronic
1080272651 11:30467227-30467249 GAGACAGGGGTGAGGGTGAAGGG + Intronic
1080362057 11:31526892-31526914 GAGAAAGGGATAGGGTTAAGAGG - Intronic
1080649227 11:34209603-34209625 GGGGTAGGGGTGGGGGTGAGGGG + Intronic
1080649253 11:34209660-34209682 GGGTGAGGGGTAGGGGTGAGGGG + Intronic
1080649263 11:34209679-34209701 GGGGTAGGGGTGGGGGTGAGGGG + Intronic
1080649348 11:34209854-34209876 GGGTGAGGGATGGGGGTGAGGGG + Intronic
1080672628 11:34395168-34395190 GCCAGAGGAGTGGGGTTGTGGGG - Intergenic
1081696133 11:45110372-45110394 AAAAGGGGGGTGGGGATGAGAGG + Intronic
1081707794 11:45195379-45195401 TAGGGATGGGTGGGGGTGAGGGG - Intronic
1082807539 11:57460378-57460400 GGGAGGGGGGCGGGGTGGAGGGG + Intergenic
1083199591 11:61112220-61112242 GAGAGGGAGGTGGGAATGAGAGG + Intronic
1083298571 11:61728318-61728340 GAAAGAAGGGTGGTGTGGAGAGG - Intronic
1083343685 11:61975028-61975050 GAGAGAAGCCTGGGGGTGAGTGG - Intergenic
1083592702 11:63904758-63904780 GGAAGAGAAGTGGGGTTGAGGGG - Intronic
1083876003 11:65524915-65524937 GGGAGAGGGGCGGGGATGGGGGG - Intergenic
1083926579 11:65810792-65810814 CAGGCAGGGGTGGGGTTGGGAGG + Intergenic
1084005526 11:66321418-66321440 AAGGGAGGGGTGGGGATGGGAGG + Intergenic
1084325423 11:68397240-68397262 GAGAGAAGGGCAGGGTAGAGGGG - Intronic
1084907428 11:72358818-72358840 GGAAGAGGGGTGGGGTGGGGGGG - Intronic
1084932933 11:72571284-72571306 GAGACAGGGGTGGGACTGAGGGG - Intergenic
1084937618 11:72595508-72595530 GAGAGGGGGGAGGGGAGGAGGGG - Intronic
1084944401 11:72631037-72631059 GAGAAGTGGGTGGGCTTGAGGGG - Intronic
1084966336 11:72746664-72746686 GAGAGGGGGAGGGGGTTGGGGGG - Intronic
1085026572 11:73239955-73239977 GAGTGAGGGGTGTGCTTGTGGGG + Intergenic
1085274818 11:75291708-75291730 GAGAGGGGGTTGGGGAAGAGAGG + Intronic
1085404211 11:76252277-76252299 CAGGGAGGTGTGGGGCTGAGAGG - Intergenic
1085453797 11:76654710-76654732 GCGATAGGGGTGGGGGTGGGGGG + Intergenic
1085464636 11:76715463-76715485 GAGAGAGGGGCGGGTGGGAGAGG + Intergenic
1085817233 11:79752212-79752234 AGGAGAGGGGTGGGGTTGGGGGG - Intergenic
1086500616 11:87449292-87449314 GGGAGAGGGGAGGGAATGAGGGG + Intergenic
1087242636 11:95797148-95797170 GGGAGGGGGGTGGGGTGGGGGGG - Intronic
1087515735 11:99158141-99158163 GAGAGAGAGGTGAGGTGGACAGG - Intronic
1087994986 11:104794530-104794552 GAGAGAGGGGTGTGTGTGTGGGG - Intergenic
1088396815 11:109378301-109378323 GAGATAGGGGTTGGGGTGAGGGG - Intergenic
1088695441 11:112362276-112362298 CAGAGAGTGGTGGGAATGAGGGG + Intergenic
1088809901 11:113385239-113385261 GAGAGAGCTGGGGGGTTGGGAGG - Intergenic
1088849402 11:113693006-113693028 GAGAGAGGGCGGGGGCTGGGTGG - Intronic
1088976172 11:114818157-114818179 GAGAGAGGGGTGGTGGAGAGAGG + Intergenic
1089113857 11:116078339-116078361 GAGACAGGGGTGGGGTCCAAGGG + Intergenic
1089482811 11:118820741-118820763 GGAAGAGGGGAGGGGTGGAGGGG + Intergenic
1089561521 11:119345711-119345733 GATGACGGGGTGGGGTTGAGGGG - Intronic
1089563379 11:119357097-119357119 GGGAGGGGGGTGGGTTTGGGGGG + Intronic
1089584614 11:119502501-119502523 GAGCGCGGGGTGGGGTGGGGCGG - Intergenic
1089695336 11:120212737-120212759 TAGAGGTGGGTGGGGTTGGGGGG + Intronic
1089831369 11:121331174-121331196 GAGAGAGGGAAGGAGTTGAAAGG + Intergenic
1089943259 11:122441222-122441244 GAGAGAGAGGTGGGGCAGCGCGG + Intergenic
1090021953 11:123136440-123136462 GAGAGGAGGGTGGGGTGGGGGGG - Intronic
1090055773 11:123423329-123423351 GAGAGAGGAGGGGAGTGGAGGGG - Intergenic
1090188160 11:124751699-124751721 AAGGGAGGGGTTGGATTGAGGGG - Intronic
1090363726 11:126189939-126189961 GAGGGAGGGGTGGGGGTCAGTGG - Intergenic
1090396888 11:126424957-126424979 GGGAGATGGTCGGGGTTGAGTGG + Exonic
1090664589 11:128906041-128906063 GCTGGAGGGGTGGGGGTGAGGGG - Intronic
1090881917 11:130840610-130840632 GTGAAAGGAGAGGGGTTGAGGGG + Intergenic
1091128110 11:133119905-133119927 GAGAGAGGGGTGATGCTGTGGGG + Intronic
1091162477 11:133437638-133437660 GAGAGGTGAGCGGGGTTGAGAGG - Intronic
1091162484 11:133437662-133437684 GAGAGGTGAGCGGGGTTGAGAGG - Intronic
1091162491 11:133437686-133437708 GAGAGGTGAGCGGGGTTGAGAGG - Intronic
1091162498 11:133437710-133437732 GAGAGGTGAGCGGGGTTGAGAGG - Intronic
1091172597 11:133531722-133531744 GAGAGTGGGGAGAGGTGGAGAGG + Intronic
1091323763 11:134669214-134669236 CAGAAAGGGCTGGTGTTGAGAGG - Intergenic
1091387371 12:103609-103631 GAGGGAGAGGTGGAGTTCAGGGG + Intronic
1091412436 12:252938-252960 GTGAGAGGGGTCGGGGTGGGAGG + Intronic
1091905095 12:4179273-4179295 GAGAGTGGGGTTGGGGTGAAAGG + Intergenic
1091918982 12:4289472-4289494 GAGAGCGGGGAGGGGTCGAGAGG - Intronic
1091922827 12:4319729-4319751 AAGAGAGTGATGGGGGTGAGTGG + Intergenic
1093069770 12:14696558-14696580 GAGAGAAGCGTGGGGAAGAGTGG - Exonic
1094310430 12:29074676-29074698 GAGAGAGGGATGAGCTTGAAAGG + Intergenic
1094480055 12:30874534-30874556 GTGAGTGGGGTGGGGCTGTGGGG - Intergenic
1095180814 12:39144979-39145001 GGGAGGGGGGTGGGGTTCCGCGG + Intergenic
1095486297 12:42688242-42688264 GAGAGAGAAGTGGGGGTCAGGGG + Intergenic
1095687495 12:45051522-45051544 GAGGGCGGGGTGGGGGTGGGGGG + Intergenic
1095739390 12:45590517-45590539 GTGATAGGGGTGAGGGTGAGGGG - Intergenic
1096124808 12:49111246-49111268 GAAAGCGGGGTGGGGATGTGGGG - Intergenic
1096319449 12:50598807-50598829 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096319456 12:50598820-50598842 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096319463 12:50598833-50598855 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096319470 12:50598846-50598868 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096319477 12:50598859-50598881 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096319484 12:50598872-50598894 GGGAGAGGGGAGGGGGAGAGGGG - Intronic
1096514364 12:52148078-52148100 GAGCGAGGGGTGGTGTCGAGGGG - Intergenic
1096638491 12:52976086-52976108 TAGAGAGGTGCGGGGTGGAGAGG - Intergenic
1096777439 12:53972900-53972922 GAGAGAGGGTTGGGGTGGGGTGG - Intergenic
1096784381 12:54008810-54008832 GAGAGATGGCGGGGGTTGAGGGG - Intronic
1096785130 12:54012950-54012972 GAAAGGGGTGAGGGGTTGAGAGG + Intronic
1096786267 12:54018834-54018856 GGGAGAGGGTGGGGGTAGAGGGG - Intronic
1096790097 12:54039158-54039180 GAGAAAGGGGTGGGGAGCAGAGG + Intronic
1096801000 12:54110426-54110448 ATGAGATGGGTGGGGTTGGGGGG - Intergenic
1096840657 12:54377855-54377877 GAGAGAGGAGTGGGATGGAAGGG + Intronic
1096975132 12:55695487-55695509 GAGAGCAGGGTGGGGGTGGGAGG - Intronic
1097020321 12:56016214-56016236 GAGGTAGGGGTGGGGGTGAGGGG - Intronic
1097804518 12:63950882-63950904 GGGGGTGGGGTGGGGTGGAGTGG - Intronic
1098472067 12:70856814-70856836 GAGAGAGGTGAGGAGTGGAGTGG + Intronic
1098953450 12:76665240-76665262 GGGAGAAGGGTTGGGGTGAGAGG - Intergenic
1098957725 12:76704871-76704893 GAGAAGGGGGTGGGGTGGGGAGG - Intergenic
1100417004 12:94388430-94388452 CAGAGAGGGGAGAGGATGAGGGG + Intronic
1100655144 12:96635997-96636019 GTGGGAGGGGTGGGGCTGAAAGG + Intronic
1100754757 12:97738528-97738550 GAGAGAGGCACGGGGTTGAAGGG - Intergenic
1100950069 12:99837921-99837943 GTGGGAGGGTTGGGGTTGGGCGG - Intronic
1101735498 12:107459945-107459967 GGGGCAGGGGTGGGGTTGGGGGG + Intronic
1101851147 12:108403461-108403483 GAGAGAGGGGAGGGGAGGGGAGG - Intergenic
1101859156 12:108468658-108468680 GAGAGAGGAGTGGAGAGGAGGGG + Intergenic
1101952152 12:109185671-109185693 GGGCGAGGGGAGGGTTTGAGGGG - Exonic
1102038182 12:109783798-109783820 GAGGGAGGGGTGGGGGTTGGTGG + Intronic
1102197090 12:111033844-111033866 GTGGGAGGGGAGGGGTTGGGGGG - Intergenic
1102494158 12:113307662-113307684 CAGGGCTGGGTGGGGTTGAGTGG - Intronic
1102517521 12:113459867-113459889 GAGAGAGGGGAGGGGAGGAGGGG - Intergenic
1102717396 12:114986265-114986287 GGGAAAGGGGTGGGGAAGAGGGG - Intergenic
1102764860 12:115423532-115423554 GAGGCAGAGGTGGGGTTGGGAGG - Intergenic
1102796321 12:115691898-115691920 GAGAAAGGGGTGGAGGGGAGAGG - Intergenic
1103072631 12:117957480-117957502 GGGACAGGGGAGGTGTTGAGAGG - Intronic
1103133094 12:118485589-118485611 GAGAAATGGCTGGGGTTGGGAGG + Intergenic
1103231253 12:119332701-119332723 GAGATAGGGCTGGGGATGAGGGG - Intergenic
1103233620 12:119353063-119353085 GAGGGTGGAGTGGGGGTGAGGGG + Intronic
1103288774 12:119826498-119826520 TAGACAGGGGTGGGTATGAGGGG - Intronic
1103519756 12:121530529-121530551 GATACAGGGGTGGGGTAGGGTGG - Intronic
1103740548 12:123088317-123088339 GAGAGAGGTGTGGGGTGGCGGGG - Intronic
1104178795 12:126357902-126357924 AAGAGAGGGGAGGGGAAGAGAGG + Intergenic
1104335353 12:127889383-127889405 CAGACAGGGTTGGGGTGGAGGGG - Intergenic
1104359197 12:128116194-128116216 GAGGGAGGGGTGGGGAGGAAGGG - Intergenic
1104378388 12:128285667-128285689 GAGAGAGAGATGGGGGCGAGGGG - Intronic
1104467832 12:129004951-129004973 GAGAGAGGAGCGGGTTGGAGGGG + Intergenic
1104467839 12:129004980-129005002 GAGAGAGGAGTGGTTTGGAGGGG + Intergenic
1104467905 12:129005241-129005263 GAGAGAGGAGCGGGTTGGAGGGG + Intergenic
1104467912 12:129005270-129005292 GAGAGAGGAGTGGTTTGGAGGGG + Intergenic
1104467986 12:129005583-129005605 GAGAGAGGAGTGGCTTGGAGCGG + Intergenic
1104691110 12:130827071-130827093 GAGGGAGGGGTGGGGAGGGGAGG + Intronic
1104725203 12:131071474-131071496 GTGAGTGGGGTGGAGTTAAGGGG + Intronic
1104805773 12:131588317-131588339 TAGAGTAGGGTGGGGTGGAGTGG + Intergenic
1104805787 12:131588362-131588384 TAGAGTGGGGTGGGGTGGAGTGG + Intergenic
1104805800 12:131588412-131588434 TAGAGTGGGGTGGGGTGGAGTGG + Intergenic
1104805819 12:131588492-131588514 TAGAGTGGGGTGGGGTGGAGTGG + Intergenic
1104805833 12:131588547-131588569 TAGAGTGGGGTGGGGTGGAGTGG + Intergenic
1104805854 12:131588627-131588649 TAGAGTGGGGTGGGGTGGGGTGG + Intergenic
1104897127 12:132169757-132169779 GAGTGGGGCGTGGGCTTGAGGGG + Intergenic
1105215215 13:18280257-18280279 GAGAGAAGGGTGAGGGTGGGAGG - Intergenic
1105332982 13:19435419-19435441 GAGTGGAGAGTGGGGTTGAGGGG + Intronic
1105437691 13:20391509-20391531 GAGAGCGGCGAGGGGTGGAGGGG + Intergenic
1105878717 13:24584375-24584397 GAGTGGAGAGTGGGGTTGAGGGG - Intergenic
1105921127 13:24964687-24964709 GAGTGGAGAGTGGGGTTGAGGGG + Intergenic
1105964890 13:25374635-25374657 GTCAGAGGGGTCGGGTTGTGAGG + Intronic
1106278658 13:28241533-28241555 GTGGCAGGGGTGGGGTTGTGAGG + Intronic
1106415506 13:29543107-29543129 CACAGAGTGGTGGGGTTGCGGGG + Intronic
1106796085 13:33207629-33207651 GGGAAAGGGGTGGAGTTGAGGGG - Intronic
1107382714 13:39874906-39874928 AGCTGAGGGGTGGGGTTGAGTGG - Intergenic
1107416554 13:40206654-40206676 GTGAGAGGGGTGGCTTTGTGTGG - Intergenic
1107602477 13:42028071-42028093 GCTAGAGGGGTGGGGTTGTTTGG - Intergenic
1108113075 13:47098154-47098176 GAGAGGGAGGGGAGGTTGAGAGG - Intergenic
1108184583 13:47875800-47875822 AAAAGAGGGGTGGGGATGGGAGG + Intergenic
1108299673 13:49061496-49061518 GGGAGAGGGGAGGGGAGGAGAGG - Intronic
1108299719 13:49061596-49061618 GGGAGAGGGGAGGGGAGGAGAGG - Intronic
1108316258 13:49240624-49240646 GAGGGAGGGGTAGGGATGAGAGG - Intergenic
1108336572 13:49448150-49448172 CAGTGAGGGGTGGGGATGTGTGG + Intronic
1109523381 13:63542945-63542967 GATCGGGGAGTGGGGTTGAGGGG + Intergenic
1109767231 13:66918216-66918238 GAGAGAGGGGAGAGGAAGAGAGG + Intronic
1110248868 13:73358780-73358802 AGGAGTGGGGTGGAGTTGAGGGG - Intergenic
1110309196 13:74027421-74027443 GGGAGAGGGGTAGGTATGAGTGG + Intronic
1110319792 13:74148487-74148509 GAGTGCGGGGTGGGGTGGGGGGG - Intergenic
1111865346 13:93761447-93761469 GAGATAGGGGTGGGGTAGGAGGG - Intronic
1112158852 13:96848102-96848124 GAGTGAGGGGTGGGAAAGAGTGG - Intergenic
1112341644 13:98557467-98557489 GAGGGAGCTGTGGGGGTGAGCGG - Intronic
1112350151 13:98626362-98626384 GAGAGAGGAGGGGAGATGAGGGG + Intergenic
1112430512 13:99346607-99346629 GTGGGAGGGGTGGGGTGAAGGGG - Intronic
1112468831 13:99669451-99669473 GAGAGAGGGGAGAGGTGGATGGG + Intronic
1113179787 13:107612087-107612109 GAGAGAGGGGAGGGGGAGGGAGG + Intronic
1113251547 13:108458548-108458570 GAGAGAGGGAAGGGGGAGAGAGG - Intergenic
1113257980 13:108528605-108528627 GGGAGAGGGGAGGGGAGGAGAGG - Intergenic
1113508941 13:110836504-110836526 GAGGGAGGGGTGGGGTAGGCTGG + Intergenic
1113776770 13:112952308-112952330 GAGGGAGGGGTGGGGCTGCAAGG - Intronic
1113892526 13:113743920-113743942 CAGACAGGGGTGGGGGTGGGAGG + Intergenic
1113998060 14:16104358-16104380 AAGAGTGGAGTGGAGTTGAGTGG - Intergenic
1114454165 14:22844793-22844815 GAGGGAGGCCTGGGGTTAAGGGG - Intronic
1114559709 14:23580960-23580982 GTGAGGGGGGTGGGGTAGGGGGG - Intergenic
1114883377 14:26814768-26814790 GAGAGAGAGGTGGGAATGAAGGG - Intergenic
1115141121 14:30172634-30172656 GAGGGGGTGGTGGGGTTGGGGGG - Intronic
1115476076 14:33814106-33814128 GGTAGAGGGGTGGATTTGAGAGG + Intergenic
1116430077 14:44836100-44836122 TAGTGATGGGTGGGGTAGAGAGG - Intergenic
1116450890 14:45064071-45064093 GAGCGGGGGGTGGGGGTCAGTGG - Intronic
1116866030 14:50032356-50032378 GAGGGAGGGGTGAGATGGAGAGG + Intergenic
1117009719 14:51458264-51458286 GAGATTGGGGTAGGGGTGAGAGG - Intergenic
1117038273 14:51748575-51748597 GGGGGAGGGGTGGGGTGGAATGG - Intergenic
1117187952 14:53260944-53260966 GGCAGAGGGGTGGGGTTGGGGGG + Intergenic
1117419800 14:55533009-55533031 GGGTGACGGGTGGGGTGGAGAGG + Intergenic
1117445025 14:55795781-55795803 GAGAGAGAGGTGGGGGGCAGGGG + Intergenic
1117830143 14:59741902-59741924 GATAGAGGGTTGGGTGTGAGGGG - Intronic
1118034938 14:61856593-61856615 GGGTGAGGGTTGGGGATGAGTGG + Intergenic
1118130665 14:62959438-62959460 GAGAGAGGGTGGGCATTGAGTGG - Intronic
1118158927 14:63269592-63269614 AAGAGATTGGTGGGGGTGAGGGG + Intronic
1118448003 14:65869198-65869220 GAGTGAGGGGTGATGGTGAGTGG + Intergenic
1118764750 14:68902285-68902307 GAGAGAGGTGTGGGGTGGGACGG + Intronic
1118782480 14:69017923-69017945 GTGGGTGGGGTGGGGTGGAGAGG - Intergenic
1118807195 14:69248459-69248481 TTGAGAGGGTTGGGGATGAGAGG + Intergenic
1118807283 14:69249471-69249493 TTGAGAGGGTTGGGGATGAGAGG - Intergenic
1118899631 14:69975582-69975604 GAGACAGATGTGGGGATGAGAGG + Intronic
1118904168 14:70011451-70011473 GAGATATGGGGGGGGTTGGGAGG - Intronic
1119104414 14:71910677-71910699 GAGAGAGGGGCAGATTTGAGAGG + Intergenic
1119194776 14:72709247-72709269 GAGACAGAGGTGGCCTTGAGAGG + Intronic
1119286284 14:73457991-73458013 GAGAGCGGGGTGGGGGGCAGGGG - Intronic
1119428926 14:74553068-74553090 GAGAGAGGGCTTGGGTCCAGGGG + Intronic
1119487879 14:75003507-75003529 AAGAGAGAGGTGGGGAGGAGTGG - Intronic
1119957396 14:78813807-78813829 GAGAGAAGGGTGATCTTGAGGGG + Intronic
1120045178 14:79797716-79797738 GTGAGAGGGATGGGGGAGAGAGG + Intronic
1120420872 14:84284304-84284326 GAGGGAGGGGAGGGGAGGAGAGG + Intergenic
1120445205 14:84586721-84586743 GAGAGAGAGGTGGGGTATGGGGG - Intergenic
1120953286 14:90061438-90061460 GAGAGAGGGGCTGTGCTGAGCGG - Intergenic
1121407056 14:93725459-93725481 GATGGAGGGGTGGAGTTGGGGGG - Intronic
1121447667 14:93988627-93988649 GAGAGAGGGGATGGGAGGAGGGG + Intergenic
1121485711 14:94312826-94312848 GAGAGAGAGCTGGGGAGGAGGGG + Intronic
1121510584 14:94510020-94510042 GGGAGTGGGGTGGGGTTGGATGG - Intronic
1121641656 14:95488664-95488686 AAAAGAGGGGTGGGGTGGGGAGG + Intergenic
1121661653 14:95639701-95639723 GAGAGAAGTGTAGGGTTGAATGG + Intergenic
1121692713 14:95889444-95889466 GAGGGAGAGGAGGGGGTGAGGGG - Intergenic
1121709169 14:96024587-96024609 GAGGGATGATTGGGGTTGAGAGG - Intergenic
1122138165 14:99646304-99646326 GTGAGAGGCCTGGGGTGGAGAGG + Intronic
1122217387 14:100213195-100213217 GAGAGAGGGGAGGGGAAGGGAGG + Intergenic
1122291974 14:100685713-100685735 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122291982 14:100685730-100685752 GAGAGGGGGCTGTGGTGGAGAGG - Intergenic
1122292044 14:100685899-100685921 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292102 14:100686053-100686075 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292126 14:100686115-100686137 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292189 14:100686282-100686304 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292223 14:100686372-100686394 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292231 14:100686389-100686411 GAGAGGGGGCTGTGGTGGAGAGG - Intergenic
1122292259 14:100686466-100686488 GAGAGGGGGCTGAGGTGGAGGGG - Intergenic
1122292311 14:100686603-100686625 GAGAGGGGGCTGTGGTGGAGAGG - Intergenic
1122292341 14:100686682-100686704 GAGAGGGGGCTGTGGTGGAGGGG - Intergenic
1122292349 14:100686699-100686721 GAGAGGGGGCTGCGGTGGAGAGG - Intergenic
1122415081 14:101545579-101545601 CGGAGTGGGGTGGGGTGGAGGGG - Intergenic
1122563337 14:102632769-102632791 GAGAGAGGAGAGGGGAGGAGAGG - Intronic
1122799947 14:104224509-104224531 CAGAGAGGGGTGTGGGTGGGGGG + Intergenic
1122816226 14:104315514-104315536 GAGATTGGGGAGGGGCTGAGAGG - Intergenic
1122879368 14:104683184-104683206 GGGGGAGGGGAGGGGTGGAGGGG + Intergenic
1123062674 14:105601338-105601360 CAGAGTGGGCAGGGGTTGAGGGG - Intergenic
1123434850 15:20247655-20247677 AGGAGAGGGGAGGGGATGAGGGG + Intergenic
1123434859 15:20247675-20247697 GGGAGAGGGGAGGGGATGAGGGG + Intergenic
1123468104 15:20530959-20530981 GAGAGTAGGGTGGGGCTGGGAGG - Intergenic
1124278852 15:28346950-28346972 GAGAGTAGGGTGGGGCTGGGAGG - Intergenic
1124303848 15:28564658-28564680 GAGAGTAGGGTGGGGCTGGGAGG + Intergenic
1124532731 15:30521135-30521157 GAGAGTAGGGTGGGGCTGGGAGG + Intergenic
1124765923 15:32486509-32486531 GAGAGTAGGGTGGGGCTGGGAGG - Intergenic
1125190973 15:36992794-36992816 GAGAGAAGGGGGGCGATGAGAGG + Intronic
1125289450 15:38129897-38129919 GAGGGATGGGAGGGGTTGGGTGG - Intergenic
1125379117 15:39068488-39068510 AAGAGAAGGGTGGGATGGAGAGG + Intergenic
1125726987 15:41873199-41873221 GTGCCAGGGGTGGGGTAGAGAGG + Intronic
1125816423 15:42588817-42588839 GAGTGGGGGGTGGGGGTGTGTGG + Intronic
1126410378 15:48367646-48367668 GAGTGATGGTTGTGGTTGAGGGG + Intergenic
1126482625 15:49142923-49142945 GGGGGAGGGGTGGGGTGAAGAGG + Intronic
1126487519 15:49198821-49198843 GGGAGAGGGGAGGGGAAGAGGGG - Intronic
1126613041 15:50549095-50549117 GAGAGTGGGGTGGGGGGGAATGG - Intergenic
1127254607 15:57278715-57278737 GAGAGAGGGGAGGGAGGGAGAGG - Intronic
1127657754 15:61071575-61071597 GGGAGAGGGGAGGGGTGGGGAGG + Intronic
1127657788 15:61071639-61071661 GGGAGAGGGGAGGGGTGGGGAGG + Intronic
1127657808 15:61071680-61071702 GGGAGAGGGGAGGGGAAGAGAGG + Intronic
1127882055 15:63166862-63166884 GAGACGGGGGTGGGGGTGGGGGG - Intergenic
1127895946 15:63299004-63299026 TGGAGAGGGGTGGTGCTGAGGGG + Intronic
1128316036 15:66660003-66660025 GAGAGCGGGGTGGGGAAGAAAGG - Intronic
1128526434 15:68415346-68415368 GAGAAAGGGGAGGGGTTCAAGGG + Intronic
1128527388 15:68421702-68421724 GGGTGGGGGGTGGGGGTGAGGGG + Intronic
1128715957 15:69908201-69908223 GATAGATGGGTGGAGATGAGTGG - Intergenic
1128729815 15:70013636-70013658 CAGGTAGGGGTGGGGTGGAGAGG + Intergenic
1128736426 15:70056415-70056437 GAGGCAGGGGTGGGGGTGTGTGG - Intronic
1128824816 15:70703960-70703982 TAAAGAGTGGTGGGGTAGAGTGG - Intronic
1129191618 15:73941081-73941103 GGGGGAGGGGTGAGGATGAGAGG - Intronic
1129250777 15:74307891-74307913 AGGGGATGGGTGGGGTTGAGGGG - Intronic
1129359577 15:75016274-75016296 GAGTGGGTGCTGGGGTTGAGGGG + Intronic
1129376697 15:75138222-75138244 GAGAGAGGGCTGGGCATCAGCGG - Intergenic
1129409678 15:75342597-75342619 GAGAGAGAGGGTGGGTTGTGGGG + Intronic
1129719907 15:77872283-77872305 GAGAGAGGGACGGGGTGGGGTGG + Intergenic
1129777819 15:78248283-78248305 GAATGAGGGGTGGGGTGGGGTGG + Intergenic
1130045994 15:80445305-80445327 GAGAGTGGTGTGGGGGTGTGTGG + Intronic
1130544057 15:84841739-84841761 GCTTGAGGGGTGGGATTGAGAGG + Intronic
1130547329 15:84866770-84866792 AAGAGAGGGATGGGAATGAGAGG - Intronic
1130602431 15:85285475-85285497 AAGAGAAGGTGGGGGTTGAGTGG - Intergenic
1130711249 15:86283465-86283487 GAGACAGGGGTGGGATGGGGAGG + Intronic
1130884390 15:88081269-88081291 GACAGAAGGATGGGGTGGAGTGG + Intronic
1131424090 15:92331125-92331147 GAGAAAGGGTGGGGGTTGTGGGG + Intergenic
1131541586 15:93279574-93279596 GGGTGAGGGGTGGGGGTGAGGGG - Intergenic
1132105240 15:99058640-99058662 GAGGGAGGAGTGGGGAAGAGAGG + Intergenic
1132394121 15:101459704-101459726 GAGGGAGGGGTGTTGGTGAGGGG - Intronic
1132600365 16:770294-770316 CGGAGAGGGGTGGGGCAGAGGGG + Intronic
1132679641 16:1134459-1134481 CAGAGCGGGGTGGGGTGGGGTGG - Intergenic
1132716481 16:1292632-1292654 GAGAGAGGGGAGAGGGGGAGGGG - Intergenic
1132883612 16:2172855-2172877 GAGAGGGAGGTGGGGGTGGGAGG + Intronic
1132933142 16:2468806-2468828 GGGTGAGGGGTGGGGTGGGGAGG + Intergenic
1132989885 16:2787117-2787139 GAGAGAGGGGTGAGGATGAGAGG - Intronic
1133720983 16:8494146-8494168 AAGAAAGGGATGGGGATGAGGGG - Intergenic
1134052299 16:11145488-11145510 GAGACAGGTGTGGTGGTGAGAGG - Intronic
1134129758 16:11641224-11641246 AAGAGAGGGGAGGGGAAGAGGGG + Intergenic
1134148057 16:11783537-11783559 GTGAGTGGGGTTGGGGTGAGGGG - Intronic
1134624281 16:15712837-15712859 GAGTGATGGGTGGGGGCGAGGGG + Intronic
1134801869 16:17091857-17091879 GAAAGAAAGCTGGGGTTGAGTGG + Intergenic
1135430180 16:22375699-22375721 GAGAGAGGGAAGAGGTGGAGAGG + Intronic
1135628170 16:24014267-24014289 GGGAGAGGGGTGGGGAGGGGAGG + Intronic
1135909421 16:26545648-26545670 GAGAGAAGTGTGGGGTGGGGAGG + Intergenic
1135975213 16:27104254-27104276 GAGTGAGGCTTGGGGTGGAGGGG - Intergenic
1136208662 16:28741529-28741551 GAGAGAAGGGTGGGGGGGAACGG + Intergenic
1136238877 16:28932308-28932330 GAGAGAGGTGTGGGCATGGGTGG - Intronic
1136570413 16:31093424-31093446 GGCAGAGGGGTGGGGTGGGGTGG + Intronic
1136716589 16:32287605-32287627 GAGGGAGGGGTGGGGTGGGCTGG + Intergenic
1136834971 16:33493850-33493872 GAGGGAGGGGTGGGGTGGGCTGG + Intergenic
1136906498 16:34098012-34098034 TAGAGTGGGGTGGAGTGGAGTGG - Intergenic
1137003190 16:35249816-35249838 GAGAGAAGGGAGGTGTAGAGGGG + Intergenic
1137016991 16:35387356-35387378 GAGAGAAGGGAGGGGTACAGGGG + Intergenic
1137238558 16:46635306-46635328 GAGAGAGGGGTGGGGGTGGTTGG + Intergenic
1137470167 16:48747188-48747210 GAGATAGAGGTGGGATTGAGAGG + Intergenic
1137671423 16:50281721-50281743 CAGAGAGGGCTGGGCTTGGGGGG + Intronic
1137701826 16:50503068-50503090 GGGGTGGGGGTGGGGTTGAGGGG + Intergenic
1137771563 16:51019930-51019952 GGGAGAGGAGTGTGGGTGAGAGG - Intergenic
1137805184 16:51297869-51297891 GAATGAGGAGTGGGGTGGAGGGG + Intergenic
1138008791 16:53359662-53359684 GAGAGTAGGGTGGGGCTGGGAGG - Intergenic
1138169874 16:54838770-54838792 GGGAGCGGGGAGGGTTTGAGGGG - Intergenic
1138358602 16:56406153-56406175 GAGAGAGGAGAGGGGAGGAGAGG + Intronic
1138443086 16:57046774-57046796 GAAAGAGGCGTGGGTGTGAGGGG + Intronic
1138767693 16:59623986-59624008 GAGAGAGGGGGACGGTAGAGGGG + Intergenic
1138988521 16:62361557-62361579 GAGAGAGAGGTGGGGGAGGGAGG + Intergenic
1139470793 16:67177184-67177206 GAGAGAGAAGTGGGGTTGTAGGG - Intronic
1139579681 16:67865022-67865044 CAGTGAGGGGTGGGGGTCAGTGG + Intronic
1139590196 16:67929021-67929043 GGGAGGTGGGTGGGGTTGGGTGG + Exonic
1139652503 16:68369501-68369523 GAGTGAGGGGTGGGAGTAAGGGG + Intronic
1139987307 16:70909221-70909243 GAGAGAGAGCTGGTGGTGAGGGG - Intronic
1140584276 16:76270294-76270316 GGGAGAGGGGTGGGGGCAAGTGG + Intergenic
1140724355 16:77798870-77798892 GAGAGAGGGGAGGGAGTAAGGGG - Intronic
1140779383 16:78280652-78280674 GAGCGTGGGGTGGGGGTGGGAGG + Intronic
1141028311 16:80568370-80568392 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028378 16:80568574-80568596 GAGGTGGGGGTGCGGTTGAGTGG - Intergenic
1141028402 16:80568642-80568664 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028415 16:80568676-80568698 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028784 16:80570686-80570708 GAGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028798 16:80570719-80570741 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028812 16:80570752-80570774 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028826 16:80570786-80570808 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028871 16:80570921-80570943 GAGAGTGGGGTGGGCTTGAATGG - Intergenic
1141088053 16:81110707-81110729 GGGTGAGGGTTGGGGTGGAGTGG + Intergenic
1141572500 16:84942366-84942388 GGCAGAGGGGTGGGGTGGGGAGG - Intergenic
1141754196 16:85980351-85980373 GAGAGATGGGCTGGCTTGAGAGG + Intergenic
1142161889 16:88562013-88562035 GATAGAGGGGTGGGGGGGTGGGG - Intergenic
1142207535 16:88791234-88791256 AAGAGAGGGGAGGGGAGGAGAGG + Intergenic
1142290943 16:89193343-89193365 TAAGCAGGGGTGGGGTTGAGGGG - Intronic
1142365199 16:89646445-89646467 GAGAGAGGGTTGTGGGTTAGAGG - Intronic
1203009832 16_KI270728v1_random:230182-230204 GAGGGAGGGGTGGGGTGGGCTGG - Intergenic
1203145139 16_KI270728v1_random:1794171-1794193 GAGGGAGGGGTGGGGTGGGCTGG + Intergenic
1142628169 17:1205431-1205453 GAGAGAGGAGTGGGGTCGGGGGG + Intronic
1142667296 17:1470349-1470371 CAGACAGGGTTGGGGGTGAGGGG + Intronic
1142735548 17:1896519-1896541 GGGAGTGGGGTGGGGCTGGGGGG + Intronic
1143091007 17:4449183-4449205 GGGAGAGGGCTGGGGCTGAAGGG - Intronic
1143340844 17:6209744-6209766 CAGTGAGGGGTGGGGGTGGGGGG - Intergenic
1143462349 17:7112040-7112062 GAGAGAGGGGAGGGGAAGCGAGG + Intronic
1143481738 17:7231141-7231163 GGAACAGGGGTGGGGTTGAGAGG - Intronic
1143540188 17:7563801-7563823 GAAAGGGGTGTGGGGTTGCGGGG + Intronic
1143622143 17:8086823-8086845 GAGAGAGGGATGCGGGAGAGGGG + Intronic
1143701628 17:8664950-8664972 GGGAGTGGGGTGGGGGTAAGAGG + Intergenic
1143794825 17:9328043-9328065 GAGAGAGGGGGTGGGGGGAGAGG - Intronic
1143845589 17:9770829-9770851 GAGCTGGGGGTGGGGTTGGGAGG + Intergenic
1143896100 17:10137363-10137385 GGGAGAGGGGTGAGGGTGAGGGG - Intronic
1144036645 17:11371871-11371893 AGGAGAGGGGTGGGGCTGATGGG - Intronic
1144416341 17:15050832-15050854 CTGAGTGGGGTGGGGATGAGGGG + Intergenic
1144418170 17:15071226-15071248 TAGAGAGGGGTGGGCTGGATTGG + Intergenic
1144484570 17:15653990-15654012 GAGAGAGAGATTGGGTGGAGGGG + Intronic
1144572374 17:16407825-16407847 GGGAGGGAGGTGGGGGTGAGGGG + Intergenic
1144590684 17:16521071-16521093 GGCAGAGGGATGGGGTGGAGGGG + Intergenic
1145198763 17:20920383-20920405 GAGTTAGGGGTGGGGTTGGGGGG + Intergenic
1145246969 17:21275763-21275785 GCGAGTGGGGTGGTGTGGAGCGG - Intergenic
1145254742 17:21316411-21316433 GAGACCGGGATGGGGTTGGGGGG - Intergenic
1145321858 17:21771554-21771576 GAGACCGGGATGGGGTTGGGGGG + Intergenic
1145920426 17:28605253-28605275 GGGAGAGGGTTGGGCATGAGAGG + Intronic
1145961478 17:28888798-28888820 GGTGGAGGGGTGGGGTTGGGGGG - Intronic
1146439402 17:32880780-32880802 GAGTGAGGGGTGGGGTGGCGGGG - Intergenic
1146504413 17:33392595-33392617 GAGAGAGGGGAGGAGGTCAGGGG - Intronic
1146565520 17:33909555-33909577 GAGACAGGAGAGGGCTTGAGGGG + Intronic
1146649145 17:34596006-34596028 GAGAGAGGGGTTGGGGTCCGAGG - Intronic
1147141910 17:38464991-38465013 GAGAGTCGGGTGGGGGTGAGGGG + Intronic
1147153793 17:38533201-38533223 GAGAGTAGGGTGGGGTGGGGTGG + Exonic
1147257884 17:39192860-39192882 GAGGAAGGGTTGGGGTGGAGCGG + Intronic
1147311697 17:39599479-39599501 AAGCGAGGGGTGGGGGTGGGGGG - Intergenic
1147564838 17:41529719-41529741 GAGCAAGGGGTGGGGCTGTGTGG - Intergenic
1147668825 17:42165173-42165195 GAGTCTGGGGTGGGGCTGAGGGG + Intronic
1147833855 17:43316032-43316054 GAGAAAACGGTGGGGTTGGGAGG + Intergenic
1148030119 17:44613833-44613855 GAGGGAGGGTGGGGGCTGAGGGG + Intergenic
1148051077 17:44770164-44770186 GAGAGAGGGAAGGTGCTGAGGGG - Intronic
1148052649 17:44776717-44776739 GAGAGAGGGGTGGGGTTGAGCGG - Intronic
1148193516 17:45697070-45697092 GAGGGAGGGGAGGGGGGGAGGGG + Intergenic
1148377062 17:47158184-47158206 GGTAGGTGGGTGGGGTTGAGAGG - Exonic
1148382576 17:47210381-47210403 GGGAGAGGGGTGGGCTGAAGAGG + Intronic
1148638208 17:49165407-49165429 GAGAGAGAGGTGGGGGAGAGAGG - Intronic
1148700624 17:49584557-49584579 GAGTGAGGGGTGGGGGAGTGGGG + Intergenic
1148743021 17:49903505-49903527 GGGAGACAGATGGGGTTGAGGGG - Intergenic
1148899767 17:50866703-50866725 GAGAAAGGGGTGGGGTAGGGCGG + Intronic
1149624362 17:58069564-58069586 GAAAGAGGTTTGGGGGTGAGTGG + Intergenic
1150168544 17:62966826-62966848 GGGAGAGGGGCGGGGGCGAGCGG + Intergenic
1150294826 17:64002080-64002102 GAGAGAGGGGTGAGGGAGAGAGG - Exonic
1150329613 17:64284361-64284383 GAGAGAGTGGTGGTTGTGAGGGG + Intergenic
1150433799 17:65139105-65139127 GAGGGAAAGGTGGGGTGGAGGGG - Intronic
1150578980 17:66454997-66455019 GAGGGAAGGTGGGGGTTGAGGGG + Intronic
1150711148 17:67531892-67531914 GAGAGAGGGGAGGGGGAGAGAGG - Intronic
1150727901 17:67666455-67666477 GAGAGAGGTGTGGCTTTGGGAGG + Intronic
1150947778 17:69765864-69765886 GAGAGAGGGGAGGGGAGGGGAGG - Intergenic
1151066497 17:71156679-71156701 GAGAGAGGCAAGGGATTGAGGGG + Intergenic
1151331877 17:73414773-73414795 GAGAACGGGGTGGGGTGGAGGGG + Intronic
1151498504 17:74473984-74474006 GAGAGAGAGGTGGGGGCCAGGGG + Intronic
1151681569 17:75625361-75625383 GAGCTCGGGGTGGGGTGGAGAGG - Intergenic
1151880090 17:76889505-76889527 GAGAGAGGCGTGTGGTTGGCAGG + Intronic
1151988716 17:77560326-77560348 GACAGAGGGGTTGGATTCAGGGG - Intergenic
1152057686 17:78043711-78043733 GAGTGAGGGGTGGGGAGAAGTGG - Intronic
1152072102 17:78138975-78138997 GCCAGAGGGGAGGGGATGAGGGG + Intronic
1152328751 17:79658305-79658327 GAGAGAGAGATGGGGGAGAGAGG - Intergenic
1152352863 17:79793055-79793077 GAGACGGGGGTGGAGTGGAGGGG + Exonic
1152427277 17:80225171-80225193 GAGAGCGGCGGGGGGTTGGGGGG - Intronic
1152576451 17:81143421-81143443 CAGAGCTGGATGGGGTTGAGGGG - Intronic
1152633218 17:81419991-81420013 GAGAGTGGGGTGGGGCACAGTGG + Intronic
1152696963 17:81802425-81802447 GAGGGAGGGTTTGGGTGGAGAGG + Intergenic
1152720683 17:81922486-81922508 GAGAGAAGGGTGGGGAAGAGAGG + Exonic
1152798408 17:82320012-82320034 GAGACACGGGTGGGGCTGTGGGG + Intergenic
1203211472 17_KI270730v1_random:82701-82723 GGGAGGGGAGTGGAGTTGAGTGG + Intergenic
1203212031 17_KI270730v1_random:86647-86669 GAGAGTAGAGTGGAGTTGAGTGG + Intergenic
1153230982 18:2935805-2935827 GAGAGAGGGGTTGAGGAGAGAGG + Intronic
1153320512 18:3769692-3769714 AAGAAAGTGGTGGGGTTGGGAGG + Intronic
1153514163 18:5890176-5890198 GAGAAAGGGGTGGGTTGGGGAGG - Exonic
1153675722 18:7454498-7454520 GAGGGAGGGGCGAGGCTGAGGGG + Intergenic
1153686109 18:7547237-7547259 GAGGCAGGTGTGGAGTTGAGAGG - Intergenic
1153786131 18:8537143-8537165 GCGAGAGGGCTGGGGTGGGGTGG - Intergenic
1154218335 18:12431745-12431767 GGGAGAGGGCTGGGGTCCAGGGG + Exonic
1155008150 18:21748368-21748390 GAGAGAGGGAGGGGGGAGAGAGG - Intronic
1155008157 18:21748383-21748405 GAGAGAGGGAGGGGGGAGAGAGG - Intronic
1155321872 18:24627244-24627266 GCCAGAGGGGTAGGGTTGGGAGG + Intergenic
1156008679 18:32471386-32471408 GGTAGAGGAGTAGGGTTGAGGGG - Intergenic
1156149505 18:34224929-34224951 GTGGGAGGGGTGGGGGTGAGGGG - Intronic
1156223120 18:35074473-35074495 GAGGGAGGAGTAGGGTGGAGTGG + Intronic
1156496044 18:37525603-37525625 GAGGGAGGGGTGGGGAGGGGCGG + Intronic
1157106799 18:44781502-44781524 GAGACAGAGGTGGGGGTGGGGGG - Intronic
1157113026 18:44838826-44838848 TAGTGTGGGGTGGGGCTGAGGGG - Intronic
1157293034 18:46423466-46423488 GAGAGAGGGATGGGGAGAAGAGG + Intronic
1157304849 18:46509416-46509438 GAGAAAGGGGAGGGGTGGTGTGG - Intronic
1157324217 18:46657389-46657411 GAGAGAGGGCTGGTGGGGAGGGG - Intergenic
1157672127 18:49539603-49539625 GAGAGAGGGGCGGGGTGCAGTGG - Intergenic
1157880787 18:51319372-51319394 GATACAGGGGTGGGGTGCAGTGG + Intergenic
1158967562 18:62636096-62636118 GAGTCAGGGGTGGGCTGGAGCGG + Intergenic
1159509750 18:69380774-69380796 GAGAGAGGTGTGGGTTTGGGAGG + Intergenic
1160255266 18:77243328-77243350 GAGAGTGGGGAGGGGTGCAGCGG + Intergenic
1160409769 18:78667775-78667797 GGGAGAGGGGTAGGGTGGATGGG - Intergenic
1160597159 18:79983994-79984016 GTATGAGGGGTGGTGTTGAGTGG - Intronic
1160721009 19:596891-596913 AGGAGAGGGTTGGGGTGGAGAGG + Intronic
1160905966 19:1451873-1451895 GTGGGAGGGGAGGGGATGAGGGG + Exonic
1160970159 19:1764437-1764459 GGGAGAGGGGTGGGGACAAGAGG + Intronic
1161030734 19:2056718-2056740 GAGGGAGGGGAGGGGAGGAGAGG - Intergenic
1161133011 19:2602749-2602771 AAGGGAGGGGTGGTGGTGAGGGG - Intronic
1161497973 19:4597890-4597912 GAGAGAGGGGAGGGGCTTAGAGG + Intergenic
1161498071 19:4598193-4598215 CTGAGTGGGGCGGGGTTGAGAGG + Intergenic
1161569955 19:5025116-5025138 GAGAGCTGGGTTGGGTTAAGCGG + Intronic
1161595922 19:5150981-5151003 GCGAGAGGCGAGGTGTTGAGGGG + Intronic
1161610477 19:5239199-5239221 GAGACAGGGGTGCGGCAGAGAGG + Intronic
1161693360 19:5750819-5750841 GAGAGAGGGCTGGGGGAGGGAGG - Intronic
1161775975 19:6262386-6262408 GAGGAGGTGGTGGGGTTGAGGGG - Intronic
1161801274 19:6417915-6417937 GAGGGAGGGGCCGGGGTGAGTGG - Intronic
1162034446 19:7931650-7931672 GAGGGAGGGGTGGGCTGCAGGGG + Intronic
1162169065 19:8774576-8774598 GAGTGAGGGGGGGGATGGAGGGG - Intergenic
1162404878 19:10467644-10467666 GAGTGAGGGGAGGAGTGGAGGGG - Exonic
1162435197 19:10654182-10654204 GAGATAAGGGGGGGGCTGAGGGG - Intergenic
1162791316 19:13064453-13064475 GAAACAGGGGTGGGGGAGAGAGG - Intronic
1162976458 19:14209383-14209405 GGGCGAGGGGCGGGGGTGAGGGG - Intergenic
1163463893 19:17455246-17455268 GAGAGCGGGATGGGGGTGGGGGG - Intronic
1163501783 19:17680418-17680440 GACAGGGGGGCGGGGATGAGGGG + Intronic
1163520377 19:17788241-17788263 GGGGGAGGGGTGGGGAGGAGGGG - Intronic
1163729646 19:18941422-18941444 GAGTGGGGGGGGGGGTTGCGTGG + Intergenic
1163755836 19:19105762-19105784 GAGAGAGGGGCGGGCGTGGGCGG - Intronic
1163796654 19:19341933-19341955 GCGACAGGGGTGGGTCTGAGTGG - Intronic
1163844046 19:19628560-19628582 GAGAGCGGGGTGGGGCTGGGAGG - Exonic
1164244505 19:23418635-23418657 GGGAGAGGGATGGGGGGGAGGGG - Intergenic
1164463155 19:28465414-28465436 GAGTCAGAGGTGGGGCTGAGAGG + Intergenic
1164476093 19:28577090-28577112 GTGTGAGGGGTGGGGTGGGGCGG - Intergenic
1164649708 19:29882909-29882931 GGGGGAGGGGTGGGGTTGGAGGG + Intergenic
1164822841 19:31263703-31263725 CTGAGAGGGGTGGGGATGTGAGG - Intergenic
1164824442 19:31274051-31274073 GAAAAAGGGGTGGGGATGAGCGG + Intergenic
1164846846 19:31439683-31439705 GAGAGAGGGTTGGGAGAGAGTGG + Intergenic
1164858748 19:31545812-31545834 AAAAGAGGGCTGGGGGTGAGAGG - Intergenic
1165428442 19:35758112-35758134 CAGAGAGGGGCGGGGCTGATAGG + Intergenic
1165510472 19:36263987-36264009 GAGGGAGGGAAGGGGTTCAGGGG + Intergenic
1165793752 19:38507025-38507047 CAGAGAGGGGTGGAGCCGAGAGG + Intronic
1166215501 19:41331995-41332017 AAGAGAGGGATGGGGTGGGGAGG - Intronic
1166536976 19:43580607-43580629 GAGAGAGGGGTGGCCGTGGGTGG + Intronic
1166686647 19:44800479-44800501 GAGGGTGGAGTGGGGTGGAGTGG - Intronic
1166855400 19:45780666-45780688 GAGAGAGGGATGGGTATGGGAGG + Intronic
1166867950 19:45852442-45852464 GAGAAAGGGGTGTGGTGTAGGGG - Intronic
1166887908 19:45973037-45973059 AGGAGAGGGGTGGGGGGGAGGGG - Intronic
1167011885 19:46813860-46813882 GAGAGAGGGTTGGTGTTTTGGGG - Intergenic
1167326578 19:48830161-48830183 GAAAGGGGGGTTGGGTTAAGGGG - Intronic
1167355159 19:48999170-48999192 GCAAGAGGGGTGGGGGTGACTGG + Intronic
1167435312 19:49475458-49475480 GAGAGAGGGGTGGGGCAGAGGGG + Intronic
1167487204 19:49769599-49769621 GAGAGAGGGCGGGTGTGGAGGGG + Intronic
1167607911 19:50491323-50491345 GAGTCGGGGGTGGGGTTGGGCGG + Intergenic
1167706400 19:51083711-51083733 GAGAGAGGGGTGTGGAGAAGTGG + Intronic
1168099496 19:54133776-54133798 GAGAGAGGGGAGGTGGAGAGAGG - Intergenic
1168099504 19:54133807-54133829 GAGAGAGAGGGGAGGTGGAGAGG - Intergenic
1168099513 19:54133836-54133858 GAGAGAGGGGAGGTGGAGAGAGG - Intergenic
1168099662 19:54134255-54134277 GAGAGAGGGGAGGTGGAGAGAGG - Intergenic
1168252749 19:55149713-55149735 GACAAAGGGGTGGGGGTGGGAGG - Intergenic
1168602035 19:57726116-57726138 GTGGGAGGGGTGGGGTGGGGTGG - Intronic
925075465 2:1013001-1013023 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075473 2:1013038-1013060 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075488 2:1013112-1013134 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075496 2:1013149-1013171 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075518 2:1013260-1013282 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075533 2:1013334-1013356 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075541 2:1013371-1013393 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075549 2:1013408-1013430 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075571 2:1013519-1013541 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075607 2:1013704-1013726 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075622 2:1013778-1013800 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075630 2:1013815-1013837 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075638 2:1013852-1013874 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075660 2:1013963-1013985 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075682 2:1014074-1014096 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075732 2:1014333-1014355 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075758 2:1014481-1014503 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925075780 2:1014592-1014614 GAGAGAAGGGTGGTCTGGAGAGG + Intronic
925146948 2:1588153-1588175 GACAGAGGGATGGGGGAGAGAGG - Intergenic
925188819 2:1867008-1867030 TAGAGAGGGATGGGGGAGAGAGG + Intronic
925188833 2:1867047-1867069 GAGAGAGGGTTGGGGGAGAGAGG + Intronic
925281921 2:2690906-2690928 GTGAGAGGGGAGGGAGTGAGAGG - Intergenic
925281926 2:2690921-2690943 GTGAGAGGGGAGGGTGTGAGAGG - Intergenic
925281931 2:2690936-2690958 GTGAGAGGGGAGGGAGTGAGAGG - Intergenic
925281945 2:2690981-2691003 GTGAGAGGGGAGGGAGTGAGAGG - Intergenic
925281950 2:2690996-2691018 GTGAGAGGGGAGGGAGTGAGAGG - Intergenic
925281969 2:2691071-2691093 GTGAGAGGGGAGGGTGTGAGAGG - Intergenic
925313838 2:2906873-2906895 GAGGGAGGTGTAGGGGTGAGTGG - Intergenic
925313854 2:2906919-2906941 GAGGGAGGTGTAGGGGTGAGTGG - Intergenic
925924832 2:8662466-8662488 GAGAGCGGAGTGGGGGTGGGGGG + Intergenic
925929341 2:8694273-8694295 GGGAGAGGGCTGGGGGAGAGCGG + Intergenic
925943787 2:8842478-8842500 GGGTGAGAGGTGGGGTAGAGAGG - Intergenic
926116655 2:10217800-10217822 GAGAGAGGGGTGGGCTGGGGAGG - Intergenic
926572262 2:14542715-14542737 TAGGGAGGGGTGGGGCAGAGTGG + Intergenic
926846269 2:17143903-17143925 TAGAGAGGGGTGGGAGGGAGGGG - Intergenic
927019956 2:19006253-19006275 GAGGGAGAGGTGGGTGTGAGAGG - Intergenic
927088130 2:19690404-19690426 GAGAGAGGAGAGGGGAGGAGAGG + Intergenic
927094100 2:19734738-19734760 GGGAAAGGAGCGGGGTTGAGAGG - Intergenic
927381031 2:22479250-22479272 GAGAGAAGTGTAGGGTAGAGAGG + Intergenic
927485025 2:23482708-23482730 GAGACAGGGGTGGAGTTGGAGGG - Intronic
927663820 2:25015490-25015512 GAGGGAGGGGAGTGGTGGAGCGG + Intergenic
927742748 2:25587080-25587102 AGGAGAGGGATGGGGTAGAGCGG + Intronic
927949552 2:27158495-27158517 GACAGAGGACTTGGGTTGAGGGG + Intergenic
928314030 2:30232311-30232333 TGGAGAGGGCAGGGGTTGAGAGG - Intronic
928535189 2:32233115-32233137 AAGAGAGGGGTGGGGGAGGGAGG + Intronic
928689416 2:33783714-33783736 GAGTGAGTGCTGGGGTTGACTGG - Intergenic
929128672 2:38544392-38544414 GAGAGAGAAGTGGGGATGTGGGG - Intergenic
929172937 2:38949493-38949515 CAGAGAAGGGTGGGGTGGAGAGG - Intronic
930033774 2:47073305-47073327 GAGAGCGCGGTGAGGTTGAAAGG - Intronic
930185416 2:48407938-48407960 GAATCAGGGTTGGGGTTGAGGGG + Intergenic
930752244 2:54945171-54945193 GAGAGAGGGGAGGGGGAAAGAGG - Intronic
931205380 2:60140947-60140969 GAGAGAGGGGGGAGGAGGAGGGG - Intergenic
931242534 2:60466275-60466297 CAGAGGAGGGTGGAGTTGAGAGG - Intronic
931464415 2:62474036-62474058 GCCAGAGTGGTGGGGTGGAGAGG + Intergenic
931752339 2:65341037-65341059 GAGAAAGGGGCGGGGTGGTGGGG + Intronic
931925492 2:67067907-67067929 GAGGGAGGGGAGGGGAGGAGAGG - Intergenic
932005442 2:67922582-67922604 GAGAGAGAGGTAGGGTTCACTGG - Intergenic
932066081 2:68562229-68562251 GAAGGAGGGGTGGGTTGGAGAGG + Intronic
932305904 2:70704256-70704278 GAGGGTGGGGTGGGGAAGAGAGG - Intronic
932312338 2:70753665-70753687 GAAAGGTGGGTGGGGTGGAGAGG + Intronic
932313939 2:70767517-70767539 GAGGGAGGGGAGGGGAGGAGCGG + Intronic
932336708 2:70935816-70935838 GAGGGAGGGGAGGGGGAGAGGGG + Intergenic
932408348 2:71529041-71529063 CAGAGAGGCCTGGGGTTGAAGGG - Intronic
932409684 2:71538285-71538307 GAGGCAGGAGTGGGGTTCAGAGG + Intronic
932430863 2:71672844-71672866 GACAGAGGGCTGGAGGTGAGGGG + Intronic
932495618 2:72144534-72144556 GAGCGCGGGGTGGGGGTGTGGGG - Intronic
932497756 2:72155045-72155067 AAGAGGGGGGTGTGGTTGGGTGG + Intergenic
932598630 2:73109660-73109682 GAAATAGGGCTGGGCTTGAGAGG - Intronic
932798533 2:74718629-74718651 CAGAGAGGAGTGAGATTGAGAGG + Intergenic
932875446 2:75446518-75446540 GAGAGATGTGGAGGGTTGAGGGG + Intergenic
933253490 2:80054914-80054936 AAGAGAGTGGAGGGGGTGAGTGG + Intronic
933415478 2:81982186-81982208 GAGAGAGGGGGGAGAATGAGGGG - Intergenic
933780233 2:85795993-85796015 GAGAGAGGGCTGGCTCTGAGAGG - Intergenic
933936580 2:87208950-87208972 GAGAGAGGGGAGGGGAGGGGAGG - Intergenic
934077980 2:88443810-88443832 GAGAGGGTGGTGGGGGGGAGGGG + Intergenic
934478345 2:94609233-94609255 GAGAGATGGGTGAGGTTCAGGGG - Intergenic
934554224 2:95278856-95278878 GAGAGAGGACTGGGGTGGCGGGG + Intronic
934650025 2:96085404-96085426 GAGGGAGGGCTGGGACTGAGGGG + Intergenic
934797677 2:97114288-97114310 GGGTGAGGGGTGGGGGTGAATGG + Intronic
934929594 2:98410905-98410927 GAGACTGAGGTGGGGGTGAGAGG - Intergenic
935398707 2:102637915-102637937 GAGAGATGGGAGGGGTTACGGGG + Intronic
935734053 2:106092069-106092091 GAGAGGGAAGTGGAGTTGAGGGG - Intergenic
936233024 2:110720590-110720612 GAGACTGGGGTGGGGGTGGGTGG - Intergenic
936286082 2:111182432-111182454 GAGAGAGTGGTGGGGTTGCCTGG - Intergenic
936851789 2:116908246-116908268 GAGAAAGGGGCGGGGTGGGGGGG - Intergenic
937765261 2:125653713-125653735 GAGAGGGGCTTGGGGTAGAGAGG - Intergenic
937955765 2:127421025-127421047 GAGATCGGGGTGGGGTTCACAGG + Intronic
938127799 2:128686995-128687017 GAGACTGGGGTGGGACTGAGTGG + Intergenic
938344684 2:130558628-130558650 AACAGAGGGGCAGGGTTGAGAGG + Intergenic
938345149 2:130562092-130562114 AACAGAGGGGCAGGGTTGAGAGG - Intergenic
938379809 2:130830204-130830226 GAGAGAGGGCGGTGGTAGAGTGG - Intergenic
938740638 2:134228507-134228529 GAAAAAGGGGTGAAGTTGAGAGG - Intronic
939556824 2:143685168-143685190 GAGAGGGGGGTGGGCTTGTAGGG + Intronic
939589657 2:144048466-144048488 CAGAGAGTGGTGGGGCTGTGTGG + Intronic
939752123 2:146061126-146061148 GAGAGGGTAGTGGTGTTGAGAGG + Intergenic
939794179 2:146620776-146620798 GAGAGACAGGTGGTGTTCAGTGG - Intergenic
939794864 2:146630502-146630524 GAGATGGGGGTGGGGTTTGGTGG - Intergenic
940455580 2:153894560-153894582 GAGAGAGAGATGGGGGTGACAGG + Intronic
940984850 2:160042889-160042911 GAGGGAGAGATGGGGTGGAGGGG + Intronic
941321857 2:164065382-164065404 CAGAGAGGGGTGGAGTTGGGGGG + Intergenic
941722850 2:168830336-168830358 GAGAGTGGAGTGGGGTGGTGGGG - Intronic
941745638 2:169083981-169084003 GAGAGGGTAGTGGGGGTGAGAGG - Intronic
941801316 2:169663055-169663077 GCGATAGTGGTGGGGTTTAGGGG - Intronic
941923016 2:170870577-170870599 GAGAAGGTGGTGGGGTTGTGGGG - Intergenic
942378789 2:175365213-175365235 GTGACTGGGGTGGGGGTGAGAGG - Intergenic
942511716 2:176709621-176709643 GAGAGAGGGATGGGTGTCAGGGG + Intergenic
942787810 2:179720396-179720418 GGGAGAGGGGAGGGGAGGAGGGG + Intronic
942924991 2:181420890-181420912 AACAGAGGGTTGGGGTTGAAAGG - Intergenic
942973194 2:181982120-181982142 AAGAGAGGAGAGGGGTGGAGAGG - Intronic
943704732 2:191022495-191022517 GAGAGAGGGGAGAGGTTGGAAGG - Intergenic
944010531 2:194969205-194969227 GAAAGAGGGGTGGGGAAAAGAGG - Intergenic
944085388 2:195841259-195841281 GAAAGAGGGTTGGGGGTGAGGGG - Intronic
944780844 2:203015076-203015098 GAGTGAGGGGCGGCTTTGAGTGG + Intronic
945147530 2:206753866-206753888 GGGTGGGGTGTGGGGTTGAGGGG - Intronic
945780229 2:214161670-214161692 TGTAGAGGGGTGGGGTTGATGGG + Intronic
945988531 2:216373501-216373523 GAGAGCGGGGTGGGGGAGAGAGG - Intergenic
946192784 2:218016211-218016233 GAGAGGGTGGTTGGGTTGAGAGG + Intergenic
946203778 2:218088953-218088975 GAGAGAGGGGTGGAGAGAAGGGG - Intronic
946808611 2:223497921-223497943 GAGAGAGTGTCGGGGGTGAGAGG - Intergenic
947140536 2:227016062-227016084 GGGTGAGGGGTGGGGTGGGGCGG - Intronic
947746620 2:232511371-232511393 GCAAGAGGGGTGGGGGTGAGGGG - Intergenic
948173242 2:235923513-235923535 GTGAGTGGGGTGGGGTGGGGTGG - Intronic
948551469 2:238775619-238775641 GAGAGAGGGGATGGAGTGAGCGG + Intergenic
948765463 2:240216837-240216859 GAGGGGTGGGTGGGGTTGAGTGG + Intergenic
948807144 2:240457913-240457935 GTCAGAGGGGTGGGGTCAAGGGG - Intronic
948856547 2:240732893-240732915 GAGGGAGGGATGGGGAAGAGAGG + Intronic
948877009 2:240834877-240834899 TTGGGAGGGGTGGGCTTGAGTGG - Intergenic
948912851 2:241013432-241013454 GCCAGCGGGGTGGGGTGGAGTGG - Intronic
949035784 2:241815226-241815248 GAGACAGGGGTGGGGCAGAATGG - Intronic
949047348 2:241877972-241877994 AGGAGAGGGATGGGGTTGGGGGG - Intergenic
949047391 2:241878063-241878085 GAGAGAGGGAAGGGGTGGGGGGG - Intergenic
1168803489 20:659321-659343 GAGAGAGGGGTGGGGTGGAATGG + Intronic
1168803806 20:661548-661570 GAGCAAGGGGTGGGGATGAAGGG - Intronic
1168901381 20:1367921-1367943 AAGGGCGGGGTGGGGTTGACTGG + Intronic
1169134509 20:3189169-3189191 CAGATGGGGGTGGGGTGGAGAGG - Intergenic
1169187671 20:3632387-3632409 GAGAGAAGGGTGAGGGTGAAGGG - Intronic
1169338669 20:4779217-4779239 GAGAGAGAGGTGTGGGTGTGGGG + Intergenic
1169473812 20:5911771-5911793 GGGAGAGAGGGAGGGTTGAGGGG + Intronic
1169720223 20:8667966-8667988 GCGTGTGGGGTGGGGTGGAGGGG + Intronic
1169847063 20:10005388-10005410 GAGGGACAGGTGGGGGTGAGGGG + Intronic
1169998928 20:11593133-11593155 TTGAGTGGGGTGGGGTGGAGGGG - Intergenic
1171086469 20:22242586-22242608 GGCAGTGGGGTGGGGTGGAGGGG + Intergenic
1171795658 20:29564244-29564266 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1171852773 20:30320217-30320239 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1172008073 20:31830939-31830961 GGGACAGGGGTGGGGTGGAGGGG + Intronic
1172147204 20:32764859-32764881 GCAAGGGAGGTGGGGTTGAGAGG + Intronic
1172534153 20:35658430-35658452 GGGATAGGGGTGGGGTAGATGGG - Intronic
1172608932 20:36234961-36234983 GGGAGTGGGGAGGGGTGGAGAGG + Intergenic
1172993397 20:39052245-39052267 CAGTGAGGGGTGGGGGTGGGAGG + Intergenic
1173166286 20:40689121-40689143 GAGCGCGCGGTGGGGCTGAGGGG + Exonic
1173305647 20:41845855-41845877 GAGACTGGGGTGGGGGTGAGGGG - Intergenic
1173348725 20:42224963-42224985 GAGAAAGAGCTGGGGTTGAATGG - Intronic
1173387595 20:42603353-42603375 GGGCTAGGGGTGGGGTGGAGAGG + Intronic
1173686078 20:44924316-44924338 GGTGGAGGGGTGGGGTTGTGGGG - Intronic
1173811838 20:45960585-45960607 GAGCCAGGGCTGGGGCTGAGAGG - Intronic
1173907451 20:46639213-46639235 GGCAGGGGGGTGGGGGTGAGGGG + Intronic
1173985063 20:47254723-47254745 GGGGGTGGGGTGGGGTGGAGGGG + Intronic
1174083088 20:47984563-47984585 GAGCGAGGGGCGGGGTGGAGAGG + Intergenic
1174132861 20:48358413-48358435 GAGCGAGGGGCGGGGCAGAGAGG - Intergenic
1174306576 20:49617751-49617773 GAGAGGGTGGTGGTGTGGAGAGG - Intergenic
1175186342 20:57181747-57181769 CACAGAGGGGTGGAGATGAGTGG - Intronic
1175260350 20:57670190-57670212 GAGGTAGGGGTGGGGTGGGGGGG + Intronic
1175302688 20:57954049-57954071 GAGAGAGAGATGGGGTTGCGGGG - Intergenic
1175443239 20:59005016-59005038 GAGGGTGGGGTGAGGGTGAGGGG - Intronic
1175487348 20:59355622-59355644 GAGAGAGGGGAGAGGGGGAGAGG - Intergenic
1175491731 20:59384525-59384547 GTGAGAGGGGAGGAGGTGAGGGG + Intergenic
1175491909 20:59385120-59385142 GTGAGAGGGGAGGAGCTGAGTGG + Intergenic
1175647389 20:60686127-60686149 GTGAGAGGGTGGGGGGTGAGAGG - Intergenic
1175825886 20:61936391-61936413 GAGAGGGGGGAGGGGGTGTGGGG - Intronic
1175844518 20:62051531-62051553 GTGAGAGGGGTGGGAGTGAACGG - Intronic
1175895456 20:62333833-62333855 GGGAGTGGGGTGGGGTGGGGTGG + Intronic
1175992836 20:62797906-62797928 GAGAGTGGGGTGGGGGTCAGGGG + Intronic
1176144222 20:63558367-63558389 GAGGGTGGGGTGGGGTGGGGTGG + Intronic
1176530358 21:7953248-7953270 CAGAGAGGAGTGGAGTAGAGTGG - Intergenic
1176636295 21:9247489-9247511 GGGAGTGGAGTGGAGTTGAGGGG + Intergenic
1176865258 21:14047159-14047181 GAGAGTGGAGTGGAGTGGAGCGG + Intergenic
1176870343 21:14078841-14078863 GAGAGCGGGGTGGGGGCGGGGGG + Intergenic
1177807304 21:25886805-25886827 GAGAGAGTGGTCAGGTTGAATGG - Intronic
1178261202 21:31101139-31101161 GTGAGGGGAGTGGGGTTGGGGGG + Intergenic
1178342784 21:31800451-31800473 GGGAGAGGGGTGAGGATGGGAGG - Intergenic
1178543810 21:33477289-33477311 AAGTGAGGGGTGGGGTTGGGAGG + Intronic
1179185320 21:39081355-39081377 GAGTGAGGGCTGGTGCTGAGGGG - Intergenic
1179452024 21:41474056-41474078 GAGAGGGGTGAGGGGGTGAGTGG + Intronic
1179473282 21:41626322-41626344 AAGAGAGGAGTGGGGCGGAGGGG - Intergenic
1179647469 21:42784586-42784608 GAGGTAGGGGTGAGGTGGAGTGG - Intergenic
1179800520 21:43809654-43809676 GGGTGAGGGGAGGGGCTGAGAGG + Intergenic
1179907854 21:44433541-44433563 GAGACGGGCTTGGGGTTGAGGGG + Intronic
1180156816 21:45982060-45982082 GAGCGGGGAGTGGGGTTCAGGGG - Intronic
1180230630 21:46424787-46424809 CAGAGCAGGGTGGGGTTGAGGGG - Intronic
1180746217 22:18090780-18090802 GGGAGAGGGGTGGAATGGAGAGG + Exonic
1181236633 22:21451035-21451057 TAGTGATGGGTGGGGTAGAGAGG - Exonic
1181270953 22:21658109-21658131 GGGATGGGGGTGGGGTGGAGAGG + Intronic
1181774240 22:25148206-25148228 GAGAAAGGGCTGGGACTGAGGGG - Intronic
1181931168 22:26402829-26402851 TAAAGAGGGATGGGGTTGAGGGG + Intergenic
1182026737 22:27124902-27124924 GACAGCAGGGTGGGGTGGAGGGG + Intergenic
1182299714 22:29330717-29330739 GTGAGCAGGGTGGGGATGAGAGG + Intronic
1182330962 22:29551791-29551813 GAGAGAGGGGGAGGGGGGAGGGG - Intronic
1182424317 22:30264097-30264119 GAGGCAGGGGTGGGGGTGGGCGG + Exonic
1182617281 22:31595902-31595924 GACAGAGGGGTGAGATGGAGGGG + Intronic
1182743558 22:32587318-32587340 GGGAGGGAGGTGGGATTGAGAGG + Intronic
1182944431 22:34308751-34308773 TAGAGTGGGGTGGAGTGGAGTGG - Intergenic
1183030889 22:35103814-35103836 GAGGGAGGAGAGGGGCTGAGGGG + Intergenic
1183063739 22:35350109-35350131 CATGGAGGGGAGGGGTTGAGTGG + Intergenic
1183247092 22:36702318-36702340 AGGGGAGGGGTGGGGTGGAGAGG + Intronic
1183381276 22:37491668-37491690 GAGAGAGGGGGGAGGGAGAGAGG + Intronic
1183383443 22:37501998-37502020 AAGGGAGGGGTGGGGCAGAGCGG - Intronic
1183503278 22:38194017-38194039 GAGTGAAAGGTGGGGTTCAGGGG + Intronic
1183695372 22:39418916-39418938 TAGAGAGGCGTGTGGTAGAGGGG + Intronic
1183705992 22:39475273-39475295 GAGAGAGAGGTGGAGTGAAGGGG - Intronic
1183771412 22:39929284-39929306 GAGAGAGAGGAGGGAATGAGTGG + Intronic
1184257715 22:43296585-43296607 GAGAGACGGGGGAGGTAGAGTGG + Intronic
1184333441 22:43840114-43840136 AAGGAAGGGGTGGGGTTCAGGGG + Intronic
1184553766 22:45220880-45220902 GAGAAGTGGGTGGGGTTGGGGGG - Intronic
1184697771 22:46149767-46149789 TGGAGAGGGGTGGGGTTGTGGGG + Intergenic
1184852454 22:47128287-47128309 GGGTGATGGGTGGGGTGGAGGGG - Intronic
1184863795 22:47191683-47191705 GAGAGAGAGGTGGGGGAGAGAGG + Intergenic
1184986622 22:48140364-48140386 GAGCCAGGGGTGGGAGTGAGAGG + Intergenic
1185288865 22:50014307-50014329 GAGAGAGGTTTGGGTGTGAGTGG - Intergenic
1185411203 22:50683854-50683876 GAGAGGGGGGTGGTGGAGAGGGG + Intergenic
1185416636 22:50714239-50714261 GAGTGATGGGTGGGGTGCAGTGG + Intergenic
1203291853 22_KI270736v1_random:2352-2374 TAGAGTGGAGTGGAGTTGAGTGG + Intergenic
1203298084 22_KI270736v1_random:57518-57540 TGGAGTGGAGTGGGGTTGAGTGG + Intergenic
1203299581 22_KI270736v1_random:67638-67660 GAGAGCGTGGTGGAGTGGAGTGG + Intergenic
1203301118 22_KI270736v1_random:77800-77822 TGGAGAGGAGTGGAGTTGAGCGG + Intergenic
1203302295 22_KI270736v1_random:85566-85588 TGGAGTGGGGTGGGGTGGAGTGG + Intergenic
1203309172 22_KI270736v1_random:130566-130588 GGGAGTGGAGTGGAGTTGAGTGG + Intergenic
949480009 3:4484872-4484894 AAGAGAGGGATGGGGAGGAGAGG - Intergenic
949487411 3:4553234-4553256 GAGTGAGGGTTGGGATAGAGGGG + Intronic
949576443 3:5343177-5343199 GAGAGAGGGGTGGGCAGCAGAGG + Intergenic
949891078 3:8734126-8734148 GGGGGTGGGGTGGGGTTGGGGGG - Intronic
950112275 3:10426862-10426884 GAGGGTGGGGTGGGGGTGGGGGG + Intronic
950169568 3:10828765-10828787 GAAAGAGTGATGGGGTTGAGAGG - Intronic
950198459 3:11026205-11026227 GAGGGAGGGGTGGGGTGAGGAGG - Intronic
950517505 3:13476853-13476875 GAGATGTGGGTGAGGTTGAGGGG - Intergenic
950633938 3:14302238-14302260 GTGAGAGGGCTGGAGTTGAGAGG - Intergenic
950796676 3:15516024-15516046 CAGAGAGGGGTGGGTGTGAGAGG - Intronic
950853971 3:16088352-16088374 GAGAGAGGGGTGAGGGGGTGGGG + Intergenic
950910223 3:16581770-16581792 GAGTGAGTGTTGGGGTTGGGGGG + Intergenic
951078319 3:18424311-18424333 GCGAGGGGGGTGGGGGTGATTGG - Exonic
951558505 3:23944832-23944854 GAGCGGGGGGTGGGGGTGGGGGG + Intronic
951923896 3:27886427-27886449 GAGAGAGAGGTGGGGAGGAAAGG + Intergenic
952387424 3:32852288-32852310 GAGGGAGGGTGGGGGTTGGGAGG + Intronic
952444136 3:33363959-33363981 GAGACAGGGTTGGTGTTGGGGGG - Intronic
952526536 3:34216377-34216399 GAGAGAGAGGTGAGTTTGTGTGG + Intergenic
952942231 3:38453941-38453963 GGGGGAGGGGTGGGGGGGAGGGG - Exonic
953351320 3:42218440-42218462 GAGGGTGGGGTGGGGTTGGGTGG + Intronic
953449183 3:42991987-42992009 GGCAGAGGGGTGGGGGTGGGGGG - Intronic
953661331 3:44893920-44893942 GAGAGAGCCGTGGGGTGGATGGG - Intronic
953666953 3:44932248-44932270 GAGAGGAGGGTAGGGGTGAGTGG - Intronic
953963345 3:47283185-47283207 GGGAGAGGGGTGGGGAGAAGAGG + Intronic
954021911 3:47749758-47749780 GAGAGAGAGGTGGCGGGGAGAGG + Intronic
954107600 3:48417807-48417829 GAGAGAGGGGGGCAGATGAGCGG + Intronic
954349963 3:50035056-50035078 AAGAGAGGGGAGGGGAGGAGAGG - Intronic
954366706 3:50150279-50150301 GTAAGAGAGGTGGGGTTGAGTGG - Intergenic
954441025 3:50522024-50522046 GAAAGAGGGGAGAGGGTGAGGGG - Intergenic
954687677 3:52379459-52379481 GAGAGAGGGGGCAGGTTCAGAGG + Intronic
954915683 3:54147122-54147144 GAGTGAGAGCTGGGGGTGAGGGG + Intronic
955157754 3:56434104-56434126 GGGAGAGGGGTGGGGTGGGGAGG - Intronic
955335879 3:58085590-58085612 GAGAGAGGGCTGGGGTGAGGTGG + Intronic
955382285 3:58449186-58449208 GAGAGAGAGATGGGGTGGACTGG + Intergenic
955585367 3:60471801-60471823 GTGAGAGGGGTGGGGTGGCAGGG - Intronic
955897824 3:63719376-63719398 GATAGTGGGGTGAGTTTGAGGGG + Intergenic
956035331 3:65084656-65084678 GGGTGGGGGGTGGGGTGGAGTGG - Intergenic
956057716 3:65318211-65318233 GAGAGAGGAGAAGGGTTGAGTGG - Intergenic
956607018 3:71083237-71083259 GAGAGAGATTTGGGGGTGAGGGG - Intronic
956620262 3:71214745-71214767 GAGAGAGGAGCGGGGGAGAGAGG + Intronic
956701102 3:71959136-71959158 CAGAGAGTGGTGGGGTGGAAGGG + Intergenic
956746341 3:72313915-72313937 GAGGAAGCGGTGGGGTGGAGTGG - Intergenic
956820669 3:72950978-72951000 GAGTGAGGGGCGGGGTTAAAAGG - Intronic
957683446 3:83469802-83469824 GAGAGAGGAGAGGAGATGAGAGG + Intergenic
957683453 3:83469831-83469853 GAGAGAGGAGAGGGGAAGAGGGG + Intergenic
958533769 3:95368328-95368350 GAGAGAGAGATGGAGATGAGGGG + Intergenic
958923157 3:100128639-100128661 GGGAGTGGGGTGGGTTTGATTGG - Intronic
959338661 3:105099233-105099255 CAGAGAGAGGTGGGGTAGGGCGG - Intergenic
961165296 3:124759522-124759544 GGCAGTGGGGTTGGGTTGAGAGG + Intergenic
961345490 3:126260799-126260821 GAAAGAAGGGTGGGGAGGAGGGG - Intergenic
961460297 3:127045710-127045732 GAGAGAGAGGGTGGGTAGAGAGG + Intergenic
961551967 3:127674464-127674486 GAGAGAGGGGTGGGGAGGGTGGG + Intronic
961879317 3:130049747-130049769 GAGGGGTGGGGGGGGTTGAGGGG - Intergenic
962131639 3:132684937-132684959 GAGATAGGGGTGGGGAAGAGGGG - Intronic
962583924 3:136822249-136822271 GAGAGAGAGTTGGGGGTGTGGGG - Intronic
962784765 3:138757624-138757646 GAGAGAGGGGAGGGGAAGGGAGG + Intronic
962939786 3:140115436-140115458 GAGCCAGAGGTGGGGGTGAGAGG - Intronic
963168178 3:142225646-142225668 GCGGGAGGGGTGGAGGTGAGCGG + Intergenic
963350205 3:144142094-144142116 GAGAGAGAGGCAGGGATGAGGGG - Intergenic
963543395 3:146623956-146623978 GAGAGCAGGGTGGGGATGGGTGG + Intergenic
963765604 3:149333064-149333086 GAAAGAGGGATGGGGGTGAAGGG - Intronic
963989839 3:151640326-151640348 GAAAGCAGGGTGGGGTGGAGTGG - Intergenic
964368196 3:155971442-155971464 GAGGGAGGGAAGGGGTTGTGGGG - Intergenic
964622739 3:158732686-158732708 GGGAGAGGGTCGGGGTTGGGGGG + Exonic
964858409 3:161172421-161172443 GTGGGAGGGGTGGGGTGGGGTGG - Intronic
965087388 3:164116177-164116199 GAGAGAGAGGTGGTCTGGAGTGG - Intergenic
966179257 3:177172681-177172703 GGGAGAGGGGAGGGGAGGAGAGG + Intronic
966224920 3:177587882-177587904 GAGAGAGAGGTGGGGGTGCGGGG + Intergenic
966821513 3:183928559-183928581 GTGTGGGCGGTGGGGTTGAGAGG + Intronic
966923506 3:184629757-184629779 GAGAGAGGGGCTCGGCTGAGAGG - Intronic
967067742 3:185935530-185935552 CACAGAGGGGTGGGGTTGTCTGG + Intronic
967240326 3:187432536-187432558 TGGAGTGGGGTGGGGTTGGGGGG + Intergenic
967587779 3:191235642-191235664 GAGAGTAGGGTGAGGATGAGGGG - Intronic
967874744 3:194260189-194260211 GAGAGAGTGGGCGGGGTGAGGGG - Intergenic
967956201 3:194879398-194879420 TAGAAAGAGGTGGGGTTGATAGG + Intergenic
968282606 3:197488621-197488643 GAGAGAAGGGTGGATTTGAAGGG + Intergenic
968485390 4:858496-858518 GAGAGCACGGTGGGGTTGCGAGG - Intronic
968530018 4:1086695-1086717 AGGACAGGGGTGGGGGTGAGAGG + Intronic
968530058 4:1086809-1086831 GAGAATGGGGTGGGGGAGAGAGG + Intronic
968530172 4:1087131-1087153 GAGGATGGGGTGGGGGTGAGAGG + Intronic
968530220 4:1087265-1087287 GAGGATGGGGTGGGGGTGAGAGG + Intronic
968530252 4:1087361-1087383 GAGGATGGGGTGGGGGTGAGAGG + Intronic
968642012 4:1719761-1719783 GAGAGATGGATGGGGCTGAGTGG - Intronic
968868380 4:3227892-3227914 GAAAGAGGGGTGGGGGTTAGGGG + Intronic
969328777 4:6460949-6460971 GTGTGTGGGGTGGGGTGGAGTGG - Intronic
969476061 4:7422993-7423015 GAGAGAGGGGTGGGGGGTAGGGG - Intronic
969658377 4:8510793-8510815 GAGGGAGTCGTGGGGTGGAGGGG + Intergenic
969698754 4:8753607-8753629 GAGAGAGGGGTGGAGGGTAGAGG - Intergenic
969701635 4:8770897-8770919 TAGAGCGGGGCGGGGTGGAGGGG + Intergenic
970692071 4:18631120-18631142 GATAGACGGGTGGTCTTGAGAGG - Intergenic
971177082 4:24292493-24292515 CAGGAAGGGGTGGGGGTGAGGGG - Intergenic
971177134 4:24292636-24292658 CAGGAAGGGGTGGGGGTGAGGGG - Intergenic
971177149 4:24292672-24292694 TAGGAAGGGGTGGGGGTGAGGGG - Intergenic
971177199 4:24292813-24292835 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177213 4:24292848-24292870 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177227 4:24292883-24292905 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177241 4:24292918-24292940 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177291 4:24293062-24293084 CAGGCAGGGGTGGGGATGAGGGG - Intergenic
971177352 4:24293238-24293260 CAGGAAGGGGTGGGGGTGAGGGG - Intergenic
971177467 4:24293587-24293609 CAGGAAGGGGTGGGGGTGAGGGG - Intergenic
971379234 4:26081566-26081588 GAGAGAGGGATGGGGTGGTATGG - Intergenic
971412048 4:26384788-26384810 GCGAGAGGGGAGGGGGAGAGGGG - Intronic
971412059 4:26384815-26384837 GTGAGAGGGGAGGGGGAGAGGGG - Intronic
971417384 4:26444613-26444635 CAGAGAAGGGTGGGGTGGGGAGG - Intergenic
971509572 4:27407303-27407325 GAGAGTGGGCAGGGGCTGAGGGG - Intergenic
971581872 4:28351912-28351934 GAGCGAGGGGCGGGGTGGGGTGG + Intergenic
972779790 4:42277049-42277071 GAGAGAGGCATGGGCCTGAGAGG + Intergenic
973051017 4:45596506-45596528 AAGAGAGGGGTGAGGTAGGGAGG - Intergenic
973148813 4:46862144-46862166 GAGAGAGGGAAGGGGTTGATAGG - Intronic
973342032 4:49015281-49015303 GAAAGAGGAGTGGGGAGGAGGGG - Intronic
973345218 4:49047666-49047688 TGGAGAGGGTTGGGGTGGAGTGG + Intronic
973536497 4:51888121-51888143 GAGAGTGAGTTGGGCTTGAGAGG + Intronic
974040097 4:56849876-56849898 GAGGGAAGGGTGGGGTGGTGAGG - Intergenic
974183349 4:58412193-58412215 GAGAGAAGGGAGGGATGGAGGGG - Intergenic
974409242 4:61517536-61517558 GAGAGAGGGCTGGGGGTGGCTGG + Intronic
975199707 4:71572646-71572668 CAGAGAGTGGTGGTGTTGGGTGG + Intergenic
976471442 4:85433823-85433845 GACAGTGGGATGGGGCTGAGAGG + Intergenic
976653700 4:87464368-87464390 GAGATAGGTTTGGGGTTGGGGGG - Intergenic
977470496 4:97436972-97436994 GAGAGAGGTGTTGGGTTATGAGG + Intronic
977922119 4:102657207-102657229 GAGAGAGGAGTGGGGTGGGGGGG + Intronic
978243827 4:106548886-106548908 GGGGGAGGGGAGGGGTGGAGGGG - Intergenic
978315420 4:107430469-107430491 GAGAGAGCCCTGGGGTTCAGGGG + Intergenic
978660770 4:111123653-111123675 GAGAGAGGGGGTGGGGAGAGGGG + Intergenic
978670759 4:111244720-111244742 GGGTGGGGGGTGGGGTGGAGGGG - Intergenic
978896401 4:113893391-113893413 GAAATAGGGATGGGGTGGAGTGG + Intergenic
978923480 4:114215595-114215617 AAGTGACAGGTGGGGTTGAGAGG + Intergenic
978954702 4:114599171-114599193 GAGAAAGGCTAGGGGTTGAGGGG + Intronic
979690755 4:123555855-123555877 GAGAAGGGGCTGGGGTTGACAGG - Intergenic
980246454 4:130250961-130250983 GAGAGAGAGTGGGGGTTGTGGGG - Intergenic
980255162 4:130371075-130371097 GAGAGAGAGGTGAGGTTGGAGGG + Intergenic
981154166 4:141414349-141414371 GTGATAGGGGTGGGGATGAGTGG + Intergenic
981321967 4:143402527-143402549 TAGAGAGGGGATGTGTTGAGTGG + Intronic
982458862 4:155643059-155643081 GAGAGAGATGTGGGGTTGGGGGG - Intergenic
983498749 4:168475894-168475916 GGGGGAGGGGCGGGGTGGAGGGG - Intronic
983525154 4:168753358-168753380 GACAAAGGGGTGGGTTTGGGGGG - Intronic
983922839 4:173365805-173365827 GAGGGTGGGGTGGGGTGGAGTGG + Intergenic
983944048 4:173566732-173566754 GCGGGAGGGCTGGGGTTGGGGGG - Intergenic
983959330 4:173733141-173733163 GAGGGTGGGGTGGGGGGGAGTGG - Intergenic
984919385 4:184750414-184750436 CAGAGAGATGTGGGGTTGAGAGG - Intergenic
985211841 4:187604021-187604043 GGGAGAGGGGAGGGGAGGAGAGG - Intergenic
985583062 5:710125-710147 GAGAGAGTGGTGGGGTTGAGGGG - Intergenic
985719403 5:1481387-1481409 GAGAGAGCGGTGGGCAGGAGAGG - Intronic
985889585 5:2705301-2705323 GAGAGAGGGGCAGGGCTCAGAGG + Intergenic
986008360 5:3687219-3687241 GAGAGAGGAGTGGGGTGGGCAGG + Intergenic
986537711 5:8808863-8808885 GAAAGAAGGGTGGGGGTGTGAGG - Intergenic
986769455 5:10958463-10958485 GAGGGAGAGGTGGGCTTTAGAGG - Intergenic
986780784 5:11063797-11063819 GTGAGGGGGGTGGGGTTGGGGGG + Intronic
987438656 5:17929139-17929161 GAGAGACTGGTGGGTTAGAGTGG + Intergenic
988032468 5:25781349-25781371 TGGAGAGGGGTGGGGTTTAGTGG + Intergenic
988432749 5:31138675-31138697 TAATGAGGGGTGGGGTGGAGGGG - Intergenic
988438158 5:31200708-31200730 GAGAGAGGAGTGAGGGAGAGAGG + Intronic
988588679 5:32530203-32530225 GACGGAGGGGTGGGGGTGGGGGG - Intergenic
988680695 5:33481195-33481217 GATGGAGGGGAGGGGATGAGGGG - Intergenic
989146799 5:38258051-38258073 GCAAGTGGGGTGGGGGTGAGAGG - Intergenic
989467449 5:41773609-41773631 GGCAGAGGGGTGGGGGTGGGCGG - Intronic
989983203 5:50667038-50667060 GCGAGGGGGGTGGGGTGGGGTGG + Exonic
991270700 5:64776043-64776065 AAGAGAGAGGTGGGGAGGAGTGG + Intronic
991400396 5:66245473-66245495 CAGTGAGGGATGGGGCTGAGAGG + Intergenic
991511558 5:67382923-67382945 ATGAGAAGGGTAGGGTTGAGGGG - Intergenic
991634373 5:68689655-68689677 GTGAGAGGGGAGGGGTGCAGAGG + Intergenic
992118363 5:73564870-73564892 GAGAGGGAGGCGGGGGTGAGGGG + Intronic
992369286 5:76126475-76126497 TGGAGTGGGGTGGGGTTGAGAGG - Intronic
992505404 5:77382572-77382594 GAGGGTGGGGTGGGGGTTAGGGG - Intronic
993097348 5:83494852-83494874 GAGAGAAGTGTGGGGGTGGGGGG + Intronic
993456552 5:88133628-88133650 AAGAGAAGGGTGGGGGTGGGGGG + Intergenic
993671515 5:90766248-90766270 GAGAGAGGGGTAGTTTTGATGGG - Intronic
995225193 5:109692783-109692805 CAGACAGGGGTGGGGATGGGGGG + Intronic
995815045 5:116158296-116158318 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815050 5:116158311-116158333 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815055 5:116158326-116158348 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815060 5:116158341-116158363 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815065 5:116158356-116158378 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815070 5:116158371-116158393 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815075 5:116158386-116158408 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815080 5:116158401-116158423 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815085 5:116158416-116158438 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815090 5:116158431-116158453 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815095 5:116158446-116158468 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815100 5:116158461-116158483 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
997292600 5:132748162-132748184 GCGCGAGGGGTGGGGGTGATGGG + Intronic
997824072 5:137090922-137090944 GAGATGGGGGTGGGGAGGAGAGG - Intronic
998057391 5:139090109-139090131 GAGAGTGGAGTGGTGTGGAGTGG - Intronic
998396041 5:141818628-141818650 GAGAGAGGGGAGGGGAGGGGAGG + Intergenic
998429132 5:142055254-142055276 GAGGGAAGGGAGGGGTTGGGGGG + Intergenic
998471983 5:142390516-142390538 GAGAGAGGGAGAGGGTGGAGGGG + Intergenic
998497491 5:142603363-142603385 GAGAATGGGGTGGGGATGAAAGG - Intronic
999087668 5:148907389-148907411 GAGAGTGGGGTGGGGGTGCGGGG + Intergenic
999197523 5:149792456-149792478 GGGACAGGGTTGGGGATGAGAGG + Intronic
999230273 5:150057601-150057623 GAGAGAGGGTTGGGGGGCAGAGG + Intronic
999261549 5:150241732-150241754 AAGAGAGGGGAGGGGAGGAGAGG - Intronic
999575968 5:152977585-152977607 AAGATATGGTTGGGGTTGAGGGG + Intergenic
999702571 5:154241324-154241346 CAGAGAGGGGTGGGGTATAGAGG + Intronic
999725700 5:154435630-154435652 GGGAGGGGGTTGGGGGTGAGTGG - Intergenic
999843806 5:155456706-155456728 CAAAGAGGGGTGGGGGAGAGAGG - Intergenic
1000110101 5:158099957-158099979 GAGAGAGGGATGGGAGTAAGAGG + Intergenic
1000199300 5:158992002-158992024 GAGATGGTGGTAGGGTTGAGGGG + Intronic
1000813759 5:165894204-165894226 GGGATGGGGATGGGGTTGAGGGG - Intergenic
1001313027 5:170624738-170624760 GGGAGAGGGGAGGGGAGGAGAGG + Intronic
1001400623 5:171444269-171444291 AAGTGAGGGGTGGGGTAGACAGG + Intronic
1001425258 5:171618473-171618495 GAGAGCAGGATGGGGTGGAGGGG - Intergenic
1001542052 5:172546444-172546466 CAGAGAGGCGTGGGATTCAGAGG + Intergenic
1001597660 5:172908318-172908340 GAGAGAGGGGAGGGGGGGAGGGG + Intronic
1001718835 5:173840017-173840039 GAGAGTGGGTTGGGGTGGGGTGG + Intergenic
1002067365 5:176658605-176658627 GAGAGTGCGGTGGGGATGGGGGG + Exonic
1002630650 5:180573654-180573676 GAGAAAGGGGTGAGGATGTGAGG - Intronic
1002716957 5:181233943-181233965 GAGGGTGGGGTGGGGTGGAGTGG + Intronic
1002896659 6:1383651-1383673 CGGGGAGGGGTGGGGTTGGGGGG + Intergenic
1002939656 6:1704853-1704875 GAGAGGGGGGCGGGGGTGAGGGG + Intronic
1003208733 6:4039828-4039850 AAGGGAGGGGTGGGGTGGGGAGG - Intronic
1003303364 6:4904869-4904891 GAGGTCGGGGTGGGGATGAGGGG - Intronic
1003321573 6:5057173-5057195 GAAAGGGGGGTTGGGTTGAGAGG - Intergenic
1003613387 6:7632991-7633013 GAGAGAGGGGAAATGTTGAGAGG - Intergenic
1004288236 6:14342668-14342690 GAGAGTGGAATGGGGTGGAGAGG - Intergenic
1004297953 6:14431222-14431244 TATAGAGGGGGGGGGTTGGGGGG - Intergenic
1004344626 6:14837214-14837236 AAGAGAGGGGTGGGATTGAAAGG + Intergenic
1004481180 6:16020824-16020846 GAGAGAGAGGAGGGGTCGGGAGG - Intergenic
1004506741 6:16253085-16253107 GGGAGAGGTGTGAGGTTCAGGGG + Intronic
1005005225 6:21281408-21281430 GAGATGCGGGTGGGGTGGAGAGG - Intergenic
1005478672 6:26234157-26234179 GAGGGGGGAGTGGGGTGGAGAGG - Intergenic
1005507975 6:26486458-26486480 GAGAGAGAGGGAGGGGTGAGAGG + Intergenic
1005826222 6:29633021-29633043 GAGACAGGGGTGGGGTTTGGGGG - Exonic
1005835638 6:29706741-29706763 GAAAGAGGATTGGGGCTGAGAGG + Intergenic
1005967197 6:30735153-30735175 GGGAGCTGAGTGGGGTTGAGGGG + Intronic
1006099759 6:31679342-31679364 GAGGGAGGAGTGGGGCTGAGTGG - Intronic
1006102086 6:31691758-31691780 GTGAGAGGGGAGGGCTTTAGGGG + Intronic
1006296910 6:33173814-33173836 GAGGGAGAGCTGGGGCTGAGTGG + Intronic
1006362513 6:33594731-33594753 GTGAGAGTGGGGGTGTTGAGCGG - Intergenic
1006420664 6:33931809-33931831 TAGAGAGAGGTGGGGGTCAGAGG - Intergenic
1006563932 6:34937985-34938007 GAGGGAGGTGTGGGGTAGGGTGG - Intronic
1006589430 6:35143137-35143159 GAGAGGGGGGTGGGGGAGGGTGG + Intronic
1006644009 6:35503863-35503885 GAGCTTGGGGTGGGGCTGAGGGG + Intronic
1006806834 6:36794210-36794232 GAGAGAAGGGTGGGGATTGGGGG + Intronic
1006826553 6:36940189-36940211 GACAGCGGGATGGTGTTGAGGGG + Intergenic
1007178040 6:39909758-39909780 GAGGGAGGTGTGGAGTTGTGGGG - Intronic
1007223915 6:40299673-40299695 GAGACAGGGGTGGCTTTCAGAGG + Intergenic
1007279828 6:40703227-40703249 GAGAGAGGGGTGGAGGTGCCAGG - Intergenic
1007397349 6:41585365-41585387 GGGACAGGGCTGGGGTTGTGGGG + Intronic
1007751332 6:44073597-44073619 GATAGAGGGGTGGGGGCGAAGGG + Intergenic
1008378883 6:50820887-50820909 GAGGGAGGGGTGGAGTGGAAGGG + Intronic
1008515766 6:52317769-52317791 GAGTTTGGGGTGGGGTTGAAGGG - Intergenic
1008624989 6:53306360-53306382 GAGAGAGGGGAGAGGGAGAGGGG + Intronic
1008708916 6:54199649-54199671 GAGAGATGGTTGGGTTTGAAAGG + Intronic
1008803683 6:55401944-55401966 CAGAGAGGGGAGGGGAGGAGAGG - Exonic
1011110407 6:83831455-83831477 GAGAGAGGGAGGGAGTGGAGAGG + Intergenic
1011412595 6:87081539-87081561 GGAAGAGGGGTGGGCATGAGTGG + Intergenic
1011507517 6:88062788-88062810 GAGAGAGGGGTCGGGGTATGTGG + Intronic
1012422407 6:99079365-99079387 GAGAGAGGGGGAGGGGGGAGAGG - Intergenic
1012531485 6:100243432-100243454 CAGTGAGGAGTGGGGTTTAGGGG + Intergenic
1012548851 6:100449601-100449623 GTGAGAGTGGTAGGGTTGATGGG + Exonic
1012930231 6:105309006-105309028 GGCAGAGGGGAGGGGTGGAGTGG + Intronic
1013092023 6:106908632-106908654 CAGAGCGTGGTGGGGGTGAGTGG + Intergenic
1013225274 6:108116096-108116118 CAGAAAGGGGTGGGGTGGAAGGG + Intronic
1014010442 6:116469422-116469444 CAGACAGGGGTGGGGGTGGGTGG + Intergenic
1014171066 6:118279700-118279722 GAGTGTGGGGTGGGTTTGAGAGG - Intronic
1015167664 6:130216240-130216262 TGGAGAGGGGTGGGGTGGAGGGG + Intronic
1015378058 6:132533107-132533129 GAGAGAGGGCTGGGTTGGGGTGG + Intergenic
1015440744 6:133242814-133242836 GAAAGAGGGGTGGTGGTGAAGGG - Intronic
1015622533 6:135146637-135146659 GAGAGAAGGGAGTGGTAGAGTGG + Intergenic
1016546421 6:145229265-145229287 GGGAGAGGGGAGGGGAGGAGGGG - Intergenic
1016608354 6:145960866-145960888 AGGAGAGGGGTGGAGTGGAGAGG + Intronic
1016859181 6:148699333-148699355 GTGAAAGGGGTGGGTTGGAGAGG + Intergenic
1016899357 6:149086376-149086398 GAGAGAAGGGTGGGAGAGAGAGG - Intergenic
1017637370 6:156456213-156456235 GAGAGGGGGATGGGGAGGAGGGG - Intergenic
1017670779 6:156767447-156767469 GAGAAATGCTTGGGGTTGAGTGG + Intergenic
1018429709 6:163713435-163713457 GAGGGTGGGGTGGGGAGGAGAGG - Intergenic
1018844666 6:167547357-167547379 GGAGGAGGGGTGGGGTTGGGAGG - Intergenic
1018948494 6:168363499-168363521 GAGAGAGGGAGGGAGATGAGAGG + Intergenic
1019265105 7:110867-110889 GAGAAGGGGGTGGGGGTGGGGGG - Intergenic
1019336179 7:484036-484058 GAGGGGGGGTTGGAGTTGAGAGG - Intergenic
1019494727 7:1332438-1332460 GAGCTAGGGGTGGGGGTGGGGGG - Intergenic
1019497443 7:1347053-1347075 GAGAAGAGGGTGGGGCTGAGAGG - Intergenic
1019498532 7:1352702-1352724 TAGGGAGGGGTGGGGTAGGGTGG - Intergenic
1019554014 7:1619728-1619750 GAGTGAGGGGTGGGCCTGACCGG + Intergenic
1019773266 7:2896959-2896981 GAGAGAGAGGAGGGGCCGAGAGG - Intergenic
1019982115 7:4629416-4629438 GGGAAAGGAGGGGGGTTGAGGGG - Intergenic
1020135534 7:5585934-5585956 GGGAGAAGTGTGGGGTGGAGAGG + Intergenic
1020212167 7:6165440-6165462 GAGAGAGGGGAGGCGGTCAGGGG + Intronic
1020418404 7:7970392-7970414 GAGAGAGAGGCGGGGTGGCGGGG - Intronic
1020437991 7:8186396-8186418 GAGAGTGGGCTGGGTTTGTGTGG + Intronic
1020764309 7:12301527-12301549 GGGATAGGGGTGGGGGTGGGTGG + Intergenic
1020904624 7:14049853-14049875 GAGACAGGAGTGTGGTTGTGTGG - Intergenic
1021407116 7:20284736-20284758 AAGAAAGGGGTGGGGGAGAGAGG - Intergenic
1021655281 7:22868372-22868394 GAGAGTGGGGATGGGTTGAGGGG - Intergenic
1022010635 7:26305184-26305206 GAGTGAGGGGTAGGGATGAGAGG - Intronic
1022274622 7:28843039-28843061 GAGAGATAGATGGGGTGGAGGGG - Intergenic
1022502230 7:30889035-30889057 TAGAGAGGGGCGGGGTGAAGGGG + Intronic
1022527739 7:31049406-31049428 TGGAGTGGGGTGGGGTAGAGTGG + Intergenic
1022629506 7:32071498-32071520 GAGAGAGAGATGGGGGTGGGGGG - Intronic
1022761936 7:33364729-33364751 GAGAGAGGAGGGGAGGTGAGAGG - Intronic
1023980763 7:45068734-45068756 CAGAGAGAGGTGGGGCTGGGTGG - Intronic
1024044533 7:45577838-45577860 GAGAAAGGGGTGGGATTCAAGGG - Intronic
1024059872 7:45689854-45689876 GGATGAGGGATGGGGTTGAGGGG + Intronic
1024257886 7:47551892-47551914 GGGGCAGGGGTGGGGTGGAGAGG + Intronic
1024553340 7:50581971-50581993 GAGAGAGGGGAAGGGTAGTGGGG - Intergenic
1025028068 7:55534603-55534625 GAGAAATGGGTGGGGAGGAGTGG - Intronic
1025088592 7:56043651-56043673 GAGACAGGGGTTGGGGTGGGTGG - Intronic
1025697894 7:63789641-63789663 GAGAGAGGGGCGGGGCCGGGAGG - Intergenic
1025872620 7:65449164-65449186 GGGAGAGGGGAGGGGAGGAGGGG - Intergenic
1025916776 7:65872936-65872958 CAGAGAGGGGCGGGGCCGAGCGG - Intergenic
1026430019 7:70336284-70336306 GAAACATGGGTGGGGTGGAGGGG - Intronic
1026554466 7:71394227-71394249 GAGAGAGGGGAGGAGGTGCGAGG + Intronic
1026680847 7:72465510-72465532 CAGTCAGGGGTGGGTTTGAGTGG - Intergenic
1026742960 7:72990375-72990397 GAAGGAGGCGTGGGGCTGAGGGG + Intergenic
1026802816 7:73410764-73410786 GAAGGAGGCGTGGGGCTGAGGGG + Intergenic
1026841433 7:73671545-73671567 GAGAGGGGGCTGGGGGTGGGTGG + Exonic
1026861470 7:73792844-73792866 GGCTGAGGGGTGGGGCTGAGTGG + Intergenic
1027029075 7:74875079-74875101 GAAGGAGGCGTGGGGCTGAGGGG + Intergenic
1027100775 7:75374703-75374725 GAAGGAGGCGTGGGGCTGAGGGG - Intergenic
1027201735 7:76068245-76068267 GAGACCGGGGTGGGGGTGACCGG + Intergenic
1028163787 7:87515023-87515045 GGTAGAGGGGTAGTGTTGAGGGG + Intronic
1028167055 7:87549475-87549497 GAGAGAGGGGCCCAGTTGAGTGG - Exonic
1028239276 7:88399425-88399447 GAGAGAGCTGTGGGTTTGAGGGG + Intergenic
1028311969 7:89349846-89349868 GAAAGAGGGGTGAGGGTCAGAGG - Intergenic
1028480611 7:91300772-91300794 GAGAGAGGTGTGGGATGAAGAGG - Intergenic
1028711383 7:93912956-93912978 GAAAATGGGGTGGGGTGGAGTGG - Intergenic
1029199482 7:98829076-98829098 GAGAAAGGGGAGGGGAGGAGAGG + Intergenic
1029421725 7:100475589-100475611 GAGAGTGGGGGGTGGGTGAGGGG - Intronic
1029444595 7:100605058-100605080 GAGAGAGGAGCGGGGGTGGGGGG - Intronic
1029538635 7:101170351-101170373 GGGAGAGGGGGGAGGTGGAGAGG - Intergenic
1029745149 7:102512409-102512431 GACAGAGGGAGGGGGCTGAGAGG + Intronic
1029763141 7:102611570-102611592 GACAGAGGGAGGGGGCTGAGAGG + Intronic
1030167466 7:106569668-106569690 AAGAGAGTGGCGGGGGTGAGTGG - Intergenic
1030384089 7:108847469-108847491 AAGAGAGGGGAGGGGAGGAGAGG - Intergenic
1030384105 7:108847504-108847526 AAGGGAGGGGAGGGGATGAGTGG - Intergenic
1031955073 7:127934608-127934630 GAGTGGGGGGTGGTGTTGAGTGG + Intronic
1032211588 7:129919562-129919584 CAGAGAGCTGTGGAGTTGAGGGG - Intronic
1032469002 7:132164596-132164618 GAGAGCGGGGTGAGGTGGGGAGG - Intronic
1032675910 7:134129407-134129429 GAGGGAGGGGTGGGGAGGGGAGG - Intronic
1032735877 7:134692263-134692285 GGGTGAGGGGTGGGGTGGGGAGG - Intergenic
1033118237 7:138645165-138645187 GAGAGGGGGAGGGGGTGGAGAGG - Intronic
1033151103 7:138915679-138915701 TAGGGAGGAGTGGGGTGGAGTGG - Intronic
1033157941 7:138972362-138972384 GAGAGAGAGGTGGGGGAGGGCGG - Intronic
1033171230 7:139086389-139086411 GAGGGTGGGGTGGGGTGGGGAGG - Intronic
1033656924 7:143381110-143381132 GTGAGTGGGGTGGGGGCGAGCGG + Exonic
1034062798 7:148108465-148108487 CAGACATGGGTGAGGTTGAGAGG + Intronic
1034104995 7:148482738-148482760 GAGAGAGGAGTGGGTGGGAGGGG - Intergenic
1034298706 7:149996247-149996269 GAGGAAGGGGTAGGCTTGAGAGG + Intergenic
1034422169 7:150995891-150995913 GAGAGGGAGGAGGGGTTTAGGGG - Intronic
1034425609 7:151012522-151012544 GACAGAGGGGTGGGGCTGGAAGG + Exonic
1034427877 7:151024054-151024076 GGGCCAGGGGTGGGGTGGAGTGG + Exonic
1034430769 7:151040232-151040254 GAGAGAGGGGTGGAATAGATGGG - Intronic
1034457274 7:151177599-151177621 GGGAGTGGGGTGGGGCTGGGTGG + Intronic
1034558815 7:151866843-151866865 GTGCGAGGGGTGGGGGTGGGAGG - Intronic
1034683485 7:152949090-152949112 GAGAGAGTGAGGGGGGTGAGGGG - Intergenic
1034807311 7:154100533-154100555 GAGGAAGGGGTAGGCTTGAGAGG - Intronic
1034866477 7:154646699-154646721 GAGAGAGGGGTTGGGTGGGAAGG + Intronic
1035237656 7:157509164-157509186 GAGAGAGGGGAGAGGGAGAGGGG + Intergenic
1035305441 7:157928700-157928722 GGGATAGGGGTGGGGTGGGGAGG + Intronic
1035688986 8:1547502-1547524 GAGGCAGATGTGGGGTTGAGGGG + Intronic
1035692737 8:1570876-1570898 GAGAGAGGGGTGAACTGGAGGGG + Intronic
1035692816 8:1571247-1571269 GAGAGAGGGGTGAACTGGAGGGG + Intronic
1035819347 8:2575485-2575507 GAGAGAGCTGTGGGCTGGAGAGG + Intergenic
1036181319 8:6587967-6587989 GAGAGATGCGTCAGGTTGAGGGG - Intronic
1036756611 8:11475396-11475418 GGGGGTGGGGTGAGGTTGAGAGG - Intergenic
1036938298 8:13026447-13026469 GGGAAAGGGGTGGGGGGGAGGGG + Exonic
1037724548 8:21472547-21472569 GAGAGAGGGGTGGGCTCTAAAGG - Intergenic
1037841126 8:22245722-22245744 TAAAGAGGGGTAGGCTTGAGAGG - Intronic
1037957694 8:23071647-23071669 AAGAGAGGGATGGGGTTGGAAGG - Intergenic
1038023605 8:23570411-23570433 GGGGGTGGGGTGGGGTGGAGAGG + Intronic
1038216598 8:25567387-25567409 AAGAGAGGGGTCAGGATGAGAGG + Intergenic
1038240672 8:25805494-25805516 GAGAGTGGGGTGAGGTGGAGAGG - Intergenic
1038994199 8:32903332-32903354 GAGGTGGGAGTGGGGTTGAGGGG - Intergenic
1039032405 8:33324716-33324738 GGGAGAAGAGTGGGGTTGGGGGG - Intergenic
1039383026 8:37103358-37103380 GAGAGAGGGGACAGGTTGAGGGG - Intergenic
1039467634 8:37795947-37795969 GAGAGTGTGGTGGGGGGGAGGGG - Intronic
1039671615 8:39606794-39606816 GAGATAGGGGTGGGGATTATAGG + Intronic
1039845125 8:41320611-41320633 GAGAGGGAGGTGGGGGAGAGAGG - Intergenic
1040613701 8:49013120-49013142 GAAAGAAAAGTGGGGTTGAGAGG + Intergenic
1040971603 8:53141880-53141902 GGGAGTGGGGTGGGGTAGGGGGG - Intergenic
1041633564 8:60116598-60116620 GAGGGTGGGGTGGGGTGGGGTGG - Intergenic
1041712731 8:60908962-60908984 GAGAGAGGGGCGGGGTGGATCGG - Intergenic
1042147062 8:65740779-65740801 GAGAGATTGGTGGGGTGGGGTGG - Intronic
1042200364 8:66275168-66275190 GAGAAAGGGGTGAGGCTGACAGG - Intergenic
1043053547 8:75409163-75409185 GAGAGGGAGGTGGTGGTGAGTGG + Intronic
1043858547 8:85289103-85289125 CTAAGAGTGGTGGGGTTGAGAGG + Intergenic
1043941474 8:86200586-86200608 GAGAGAGGGAAGAGGTTGTGAGG + Intergenic
1044379117 8:91512552-91512574 GAGATGGGGGTGGGGGTGTGGGG - Intergenic
1044722959 8:95168472-95168494 GAGAGAGGGGTTGAGGTGGGGGG + Intergenic
1045064782 8:98435561-98435583 GGGAGTGGGGTGGGGAGGAGGGG + Intronic
1045358618 8:101411848-101411870 GGGTGTGGGGTGGGGTTGAGGGG - Intergenic
1046871036 8:119206185-119206207 GGCAGAGGAGTGGGGTGGAGTGG + Intronic
1047340373 8:123975086-123975108 GAGAAAGGGGTGGGGCTGCTGGG + Intronic
1047903572 8:129449423-129449445 GGGAGAGGGGAGGGGAGGAGAGG + Intergenic
1048010144 8:130448842-130448864 GGGAGGGGGCTGGGCTTGAGTGG + Intergenic
1048182132 8:132205146-132205168 GAGAGCTGGATGGGGTTGTGTGG + Intronic
1048383128 8:133885878-133885900 GAGAGAGGGTAGGGGGAGAGAGG + Intergenic
1048439406 8:134448862-134448884 CTGAGATGGGTGGGGGTGAGGGG + Intergenic
1048454762 8:134567683-134567705 GAGAGAGGGGTGGGGTGGGTTGG - Intronic
1048788064 8:138073048-138073070 TAGAGAGGGGAGGGAGTGAGGGG + Intergenic
1048821841 8:138387443-138387465 GAGAGGAAGGTGGGGTGGAGAGG - Intronic
1048977786 8:139682584-139682606 GAGAGAGGGACAGGGCTGAGGGG + Intronic
1049422960 8:142524983-142525005 GCGAGAGGGGAGGGGATGTGAGG - Intronic
1049423365 8:142526511-142526533 CAGAGAGTGGTGGGGGTGTGGGG - Intronic
1049529380 8:143146820-143146842 GAGACATGGTGGGGGTTGAGGGG + Intergenic
1049609964 8:143550337-143550359 GGGTTAGGGGTGGGGTGGAGGGG - Intergenic
1049653867 8:143789283-143789305 GAGAGCCGGGTGGGGAGGAGGGG + Intergenic
1049712376 8:144071194-144071216 GGGAGAGGGGAGGGGAGGAGAGG - Intergenic
1049790102 8:144468508-144468530 GTGACAGGGGTGGGGTTGGGCGG + Intronic
1049794278 8:144489348-144489370 GGGAGAGGGGTTGGTCTGAGGGG + Intronic
1049796907 8:144501098-144501120 GAGAGAGGAGAGGGAGTGAGGGG - Intronic
1049866442 8:144941026-144941048 TGGAGAGGGGAGGGGTTGGGGGG + Intronic
1050323419 9:4477362-4477384 TAGAGTGGGGTGGGGGTGGGAGG + Intergenic
1050573799 9:6970801-6970823 GAGACCGGGGTGGGGGTTAGGGG - Intronic
1050670841 9:7995663-7995685 GAGAGAGAGCTGAGGGTGAGTGG - Intergenic
1050788467 9:9435337-9435359 TAGAGATGGGTGGGGTGGGGGGG - Intronic
1051193566 9:14538921-14538943 GTGAAAGAGGTGGGGTTGGGAGG - Intergenic
1051642761 9:19238612-19238634 GAGAGGGGGGAGGGGAGGAGAGG - Intronic
1052996774 9:34555410-34555432 GGGCTAGGAGTGGGGTTGAGAGG - Intronic
1053272930 9:36762608-36762630 GAGATGGGGGTGAGGTTCAGGGG + Intergenic
1053307324 9:36993980-36994002 CAGAGAGGGTGGGGGTTCAGCGG + Intronic
1053344778 9:37370355-37370377 GAGAGTGTGAGGGGGTTGAGGGG - Intergenic
1053375384 9:37601615-37601637 GATAGAGGCGGGAGGTTGAGTGG + Intronic
1053461196 9:38272807-38272829 GAGAGAGGGGTTGGTGTGGGGGG - Intergenic
1053790568 9:41683497-41683519 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1054178913 9:61895196-61895218 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1054474366 9:65562380-65562402 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1054658624 9:67685635-67685657 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1054787002 9:69219841-69219863 AAGTGGGGGGTGGGGTAGAGGGG - Intronic
1054848445 9:69821314-69821336 GAGAGAGGGTTGGAGCAGAGAGG + Intronic
1055372517 9:75615541-75615563 GAGAGAGGGGTGGTGATGGAAGG - Intergenic
1056056287 9:82827111-82827133 AAGTGTGGGGTGGGGTGGAGGGG + Intergenic
1056474864 9:86944292-86944314 GGGTGAGGAGGGGGGTTGAGGGG - Intergenic
1056787863 9:89605560-89605582 GAGACAGGGGCGGGGGTGAATGG + Intronic
1056857245 9:90142532-90142554 GAGAGGGGGGTGGGAATGAGAGG - Intergenic
1057053358 9:91942560-91942582 GTGGGAGGGGTGGGGAAGAGAGG - Intronic
1057146754 9:92764146-92764168 GAGTGTGGGGTGGGGTTGGGAGG - Intronic
1057450550 9:95155238-95155260 GAGAGAGGGGAGGGGAGGGGAGG + Intronic
1057897895 9:98924406-98924428 GAGACAGGGATGGGGGTGAAAGG - Intergenic
1058352892 9:104047455-104047477 GAGAGAGGGGAGGGGAGGATAGG + Intergenic
1058405583 9:104669787-104669809 GAGAGAGGAGGGGGGTGGTGGGG - Intergenic
1058578773 9:106431998-106432020 GAGAGAGGCGGGGGGGTGGGGGG - Intergenic
1058601149 9:106671786-106671808 GAGATTGGGGTGGGGTGGTGGGG + Intergenic
1058784618 9:108374894-108374916 GGTGGAGGGGTGGGGGTGAGGGG - Intergenic
1059111375 9:111561010-111561032 GAGAGAGAGGTGGCAGTGAGTGG + Intronic
1059278136 9:113112203-113112225 GAGAGAGGTGAGAGGCTGAGGGG + Intergenic
1059320045 9:113462299-113462321 GAGAGTGGGGTGGGGTGGGGGGG + Intronic
1059340389 9:113594592-113594614 GACTGAGTGGTAGGGTTGAGGGG + Intronic
1059395375 9:114031228-114031250 GGGAAAGGGGTGGGGGTGGGGGG - Intronic
1059400820 9:114069952-114069974 GCTAGTGGGGTGGGGTGGAGTGG - Intronic
1059423143 9:114205296-114205318 GCGAGAGAGGTGGGGTGGACTGG - Intronic
1060155956 9:121319848-121319870 AAGAGGGGTGTGGGGTTCAGAGG + Intronic
1060234131 9:121850416-121850438 GCTGGAGGGGTGGGGGTGAGGGG + Intronic
1060382689 9:123191424-123191446 GACAGAAAGGTGGGGGTGAGGGG + Intronic
1060936630 9:127519823-127519845 GAGAGGCGGGTGGGGTGGCGGGG - Intronic
1060988548 9:127835374-127835396 GGGAGAGAGGTGCAGTTGAGAGG - Intronic
1061043281 9:128151606-128151628 GAGAGATGGGTGGGTGAGAGGGG - Intronic
1061122793 9:128654476-128654498 GAGTGAGGGGTGGGGAAGAGTGG - Intronic
1061205498 9:129160803-129160825 TGGGGAGGGGTGGGGATGAGTGG + Intergenic
1061276126 9:129570175-129570197 GAGAGAGGGGTGGGGACTGGAGG + Intergenic
1061285786 9:129621759-129621781 GGGAGTGGGGTGTGGTTGGGAGG - Intronic
1061306501 9:129735953-129735975 AAGGGAGGGGTGGGGTGGGGTGG - Intergenic
1061404071 9:130383958-130383980 CAGAGAGGAGTGGGATTGGGGGG + Intronic
1061959615 9:133981375-133981397 GCGAGAGGGGAGGGGAAGAGAGG + Intronic
1061960166 9:133983793-133983815 GAGCGTGGGGTGGGGTGGGGTGG - Intronic
1062087690 9:134657267-134657289 AATACAGGGGTGGGGTAGAGGGG + Intronic
1062194102 9:135263807-135263829 GAGAGAAGGGAGGGGGTGAGGGG - Intergenic
1062194226 9:135264106-135264128 GAGAGAAGGGAGGGGGTGAGGGG - Intergenic
1062407244 9:136402954-136402976 GAGAAAGGGGAGGGGTTGGTAGG + Intronic
1062424580 9:136500196-136500218 GAGGGAGGGGCGGGGCTGCGAGG + Intronic
1062542643 9:137048453-137048475 AAGACAGTGGTGGGGTGGAGCGG + Exonic
1062605810 9:137348483-137348505 CAGAGAGGGGTGGGGATCACGGG + Intronic
1062605851 9:137348623-137348645 CAGAGAGGGGTGGGGATCATGGG + Intronic
1062605864 9:137348658-137348680 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062605887 9:137348727-137348749 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062605910 9:137348788-137348810 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606214 9:137349990-137350012 CAGAGAGGGGTGGGGATCACGGG + Intronic
1062606224 9:137350025-137350047 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606244 9:137350094-137350116 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606255 9:137350129-137350151 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606274 9:137350199-137350221 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606293 9:137350269-137350291 TAGAGAGGGGTGGGGATTACGGG + Intronic
1062606302 9:137350304-137350326 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606321 9:137350374-137350396 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606333 9:137350408-137350430 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606343 9:137350443-137350465 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606356 9:137350478-137350500 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606366 9:137350513-137350535 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606376 9:137350548-137350570 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606386 9:137350583-137350605 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606397 9:137350618-137350640 TAGAGAGGGGTGGGGATCACGGG + Intronic
1062606419 9:137350688-137350710 TAGAGAGGGGTGGGGATCACGGG + Intronic
1203343492 Un_KI270442v1:14840-14862 CAGAGAGGAGTGGAGTGGAGTGG + Intergenic
1203673284 Un_KI270756v1:434-456 CAGAGAGGAGTGGAGTGGAGTGG - Intergenic
1185598886 X:1325452-1325474 GAGAGGGAGGTGGGGAGGAGAGG + Intergenic
1185772010 X:2771968-2771990 GATTGAGGGGTGGGGGTTAGAGG + Intronic
1186193278 X:7086893-7086915 GAGAAAGGAATTGGGTTGAGGGG + Intronic
1186327845 X:8498901-8498923 GAGAGAGGGGGGAGGGAGAGAGG + Intergenic
1187416410 X:19097075-19097097 CAGAGAGGGGCTGGGTGGAGTGG - Intronic
1188002932 X:24999045-24999067 GAGAAAGGGGTGATGGTGAGGGG - Intergenic
1188340769 X:28998464-28998486 GAGAGGGAGGTGGGGTGGAGAGG + Intronic
1189046416 X:37596981-37597003 GAGTGTGGGATGGGGTTGAGAGG - Intronic
1189137404 X:38562918-38562940 GGGTGAGGGGCGGGGGTGAGGGG - Intronic
1189207829 X:39257023-39257045 GGGGGAGGGGTGGGGGGGAGGGG - Intergenic
1189373975 X:40451980-40452002 GAAAGAGAGGTGGGGTGGGGTGG + Intergenic
1189497273 X:41520615-41520637 GAGGTAGGGGTGGGCATGAGAGG + Intronic
1189654961 X:43235408-43235430 TGGAGGTGGGTGGGGTTGAGAGG + Intergenic
1189717526 X:43881648-43881670 AGGAGTGGGGTGGGGTGGAGTGG + Intronic
1190179239 X:48177531-48177553 GGGAGAGGGGAGGGGGTGAAGGG + Intergenic
1190213622 X:48466597-48466619 GACTGAGGGGTGGGGGTTAGAGG + Intronic
1190221319 X:48514212-48514234 GAGAAAGGGGCAGGGGTGAGAGG - Intronic
1190259106 X:48786828-48786850 CAGAAAGAGGTGGGGTTTAGGGG - Intronic
1190829258 X:54045224-54045246 GGGAGAGGAGGGGGGATGAGAGG + Exonic
1190888570 X:54550285-54550307 GAGAGAGGGAGGGGGGAGAGAGG + Intronic
1192261660 X:69509259-69509281 GAGAGTGGGGTGGGGGTTGGAGG - Intronic
1192361609 X:70444541-70444563 GGAAGTGGGGTGGGGTGGAGTGG + Intergenic
1193057153 X:77165276-77165298 GTTAGTGGGGTGGGGTTGATGGG - Intergenic
1194131158 X:90084043-90084065 GAGAAAGGGGTGGGGTGGATAGG + Intergenic
1194225117 X:91246823-91246845 GGGGTGGGGGTGGGGTTGAGAGG - Intergenic
1194348531 X:92796057-92796079 GGGAGAGGGGAGGGGGGGAGGGG + Intergenic
1194654844 X:96560335-96560357 GATACAGGGGTGGGGTGGCGGGG - Intergenic
1194810664 X:98383252-98383274 GGGATAGGGATGGGGTTGAAGGG + Intergenic
1195237861 X:102919342-102919364 GGGAGAGGGGAGGGGAGGAGAGG - Intergenic
1195283224 X:103357235-103357257 GGGAAAGGGGTGGGGTGGAAGGG - Intronic
1195285224 X:103376869-103376891 GAGGGTGGGGTGGGGGTGGGGGG + Intronic
1195285302 X:103377174-103377196 GAGTGGGGGATGGGGTGGAGGGG - Intronic
1195491216 X:105472055-105472077 AAGTGAGGGGTGGGATGGAGGGG + Intronic
1195858456 X:109355788-109355810 GCGACAGGGGTGGGGTGGAGTGG + Intergenic
1195898534 X:109773127-109773149 GAGGTAGGGGTGGGGGTGGGAGG + Intergenic
1196026940 X:111051079-111051101 GAGAGAGGAGTGGGTTTGGGTGG + Intronic
1196883869 X:120224309-120224331 GAGAGACTGATGGGGTTCAGGGG + Intergenic
1196950330 X:120870316-120870338 AAGAGAGGGGTGTGGTTGGGGGG + Intergenic
1197891917 X:131277409-131277431 TAGTGAGGGGTGGGGTTGAAGGG - Intronic
1199614535 X:149646508-149646530 AAGAGAGGGGTGAGGGTGTGGGG - Intergenic
1199635802 X:149810421-149810443 AAGAGAGGGGTGAGGGTGTGGGG + Intergenic
1199977459 X:152902780-152902802 GAGGTAAGGGTGGGGTTGAGGGG + Intergenic
1200018696 X:153184053-153184075 GAGAGAGGGGTGAGGGTGTGGGG + Intergenic
1200284454 X:154806439-154806461 GAGGGGGGGGTGGGGTGGGGGGG + Intronic
1200561583 Y:4710130-4710152 GGGGTGGGGGTGGGGTTGAGAGG - Intergenic
1201097038 Y:10629267-10629289 TAGAGTGGAGTGGAGTTGAGGGG - Intergenic
1201097888 Y:10647709-10647731 TAGAGTGGAGTGGAGTTGAGGGG - Intergenic
1201098643 Y:10654543-10654565 TAGAGAGGAGTGGAGTGGAGTGG - Intergenic
1201112486 Y:10810505-10810527 AAGAGTGGGGTGGGGTGGATTGG - Intergenic
1201113073 Y:10814728-10814750 AAGAGAGGAGTGGAGTTGAATGG - Intergenic
1201113543 Y:10818690-10818712 GGGAGTGGAGTGGAGTTGAGTGG - Intergenic
1201121670 Y:10878154-10878176 TAGAGTGGGGTGGAATTGAGTGG - Intergenic
1201124628 Y:10901716-10901738 AAGAGAGGAGTGGAGTGGAGTGG - Intergenic
1201126945 Y:10924227-10924249 TGGAGTGGAGTGGGGTTGAGTGG - Intergenic
1201129143 Y:10939506-10939528 GGGAGAGGAGTGGAGTAGAGTGG - Intergenic
1201133533 Y:10973299-10973321 TAGAGTGGAGTGGAGTTGAGTGG - Intergenic
1201140146 Y:11021331-11021353 TAGAGAGGAGTGGAGTGGAGTGG - Intergenic
1201140596 Y:11025082-11025104 TGGAGTGGAGTGGGGTTGAGTGG - Intergenic
1201141283 Y:11030801-11030823 TAGAGTGGAGTGGAGTTGAGTGG - Intergenic
1202606232 Y:26641919-26641941 TAGAGAGGAGTGGAGTGGAGTGG + Intergenic