ID: 1148052650

View in Genome Browser
Species Human (GRCh38)
Location 17:44776725-44776747
Sequence GCACTGTGGAGAGAGGGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 654}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052650_1148052663 26 Left 1148052650 17:44776725-44776747 CCCCACCCCTCTCTCCACAGTGC 0: 1
1: 0
2: 2
3: 55
4: 654
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1148052650_1148052661 3 Left 1148052650 17:44776725-44776747 CCCCACCCCTCTCTCCACAGTGC 0: 1
1: 0
2: 2
3: 55
4: 654
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052650_1148052658 -1 Left 1148052650 17:44776725-44776747 CCCCACCCCTCTCTCCACAGTGC 0: 1
1: 0
2: 2
3: 55
4: 654
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052650 Original CRISPR GCACTGTGGAGAGAGGGGTG GGG (reversed) Exonic
900387445 1:2417006-2417028 GGTCTGTGGAGAGAGGGGCATGG + Intergenic
900562857 1:3316261-3316283 ACACTGTGGGGGTAGGGGTGGGG + Intronic
900763531 1:4488529-4488551 GCCCTTTGGAGAGAAGGGTTTGG + Intergenic
901815421 1:11790864-11790886 GCCCTGTGGATTGAGCGGTGGGG - Exonic
902511391 1:16968832-16968854 GCAGAGAGGAGAGAGGAGTGAGG + Intronic
902696742 1:18145430-18145452 GCACTGGGGAGAGAGTGAGGTGG - Intronic
902804292 1:18851193-18851215 GAAATGTGGAGAGAGCTGTGTGG + Intronic
902972419 1:20063408-20063430 AAACTGTGGGGAGAGGGATGGGG + Intronic
903054368 1:20625275-20625297 GCAGTTTGGGGAAAGGGGTGGGG + Intergenic
903066309 1:20701628-20701650 GAACTGAGGAGAGGTGGGTGGGG + Intronic
903216797 1:21847838-21847860 GCACTGGGGACAGACGGGTGTGG + Exonic
903595398 1:24490179-24490201 GCCCTGTGGAGAGGTGGCTGAGG - Intergenic
904239661 1:29135496-29135518 GCTCTGTGTAGAGAGGGCTCTGG - Intergenic
904556370 1:31367492-31367514 GGACTGTGGAAAGAGGGTAGAGG + Exonic
904947770 1:34212180-34212202 TCACAGAGAAGAGAGGGGTGAGG - Intronic
905265064 1:36746685-36746707 GGACTGTGGGGAGAGGGGTGAGG + Intergenic
905408777 1:37754172-37754194 GCACTGCGGAGGGTGGGGGGTGG - Intronic
905449494 1:38047282-38047304 GTACTGAGGAGGGAGGGGCGCGG - Intergenic
905695221 1:39968738-39968760 GCACTGAGGTGAGTGGGGAGGGG + Exonic
906036304 1:42752228-42752250 AGAGTGTGGAGAAAGGGGTGGGG - Intronic
906285037 1:44581632-44581654 GGACTCTGGAGAGAGAGCTGAGG + Intronic
907045110 1:51295967-51295989 GCACTGGGGAGGGAGGAGTAGGG - Intronic
907229822 1:52986003-52986025 GTTATGTGGGGAGAGGGGTGAGG - Intronic
907394318 1:54178706-54178728 GCACTGAAGAGAGAGTGCTGAGG + Intronic
907487363 1:54787113-54787135 GCAGGGTGGAGAGAGGGAAGGGG + Intronic
908651136 1:66334454-66334476 GCACTCTGTAGACACGGGTGAGG + Intronic
909100665 1:71343957-71343979 GCAGTTTGGGGAAAGGGGTGGGG - Intergenic
909394497 1:75154688-75154710 GAACTGTGGAGTTTGGGGTGTGG + Intronic
909533038 1:76702021-76702043 GCCCAGCGGAGAGGGGGGTGGGG + Intergenic
909984148 1:82140017-82140039 GAACTGTGGGAAGAGGGCTGGGG + Intergenic
910201564 1:84705664-84705686 GGACTGTTCAGAGAGGAGTGTGG - Intergenic
910333725 1:86105112-86105134 GCAGTGTTGACACAGGGGTGGGG + Intronic
910936351 1:92486452-92486474 TGACTGGCGAGAGAGGGGTGGGG + Intronic
911063126 1:93764667-93764689 GCACTGAGGAGAGAGGCAGGAGG - Intronic
911999141 1:104808447-104808469 GGAAGGTTGAGAGAGGGGTGAGG - Intergenic
913050088 1:115109850-115109872 GCACTGCAGGCAGAGGGGTGCGG - Intergenic
914322217 1:146576239-146576261 GCACTCAGGAGAGAGGTGGGAGG - Intergenic
914825874 1:151137863-151137885 GCAATGGGGAGAGCGGTGTGGGG - Intronic
915238941 1:154506019-154506041 CCACTGTGCAGAGTGGTGTGTGG + Intronic
915265340 1:154712695-154712717 GCAATGAGGAGAGGGGGCTGAGG + Intronic
915331875 1:155117739-155117761 AGACAGTGCAGAGAGGGGTGGGG - Intergenic
915430209 1:155860295-155860317 CCTCTGGGGAAAGAGGGGTGCGG + Intronic
915472683 1:156135324-156135346 GGCCCCTGGAGAGAGGGGTGAGG - Intronic
915524519 1:156467721-156467743 GCCCTATGGGGAGAGGGGAGTGG - Intronic
915557630 1:156669281-156669303 GCACTGGGGACTTAGGGGTGCGG - Exonic
915720664 1:157983040-157983062 GCAGTGTGGACAGAGGGCAGCGG - Intergenic
916609263 1:166374332-166374354 GCACTGTGGCCAGAGGGCTGGGG - Intergenic
916941396 1:169682307-169682329 GCTCTGTGGCGGGAGGGGTAGGG - Intronic
917460018 1:175221671-175221693 GTTCTCTAGAGAGAGGGGTGAGG - Intergenic
919822959 1:201484426-201484448 GCTCTGTGGGGCGAGGTGTGGGG + Exonic
920179094 1:204121716-204121738 GCAGTGTGGAGTGAGGGGATAGG + Intronic
920313877 1:205064480-205064502 GAACTGTGCAGGGTGGGGTGTGG - Intronic
920498413 1:206471270-206471292 GCCCTGAGGAGGGAGGGGAGGGG + Intronic
920747559 1:208643412-208643434 GCTCTGAGGAGAGATGGGGGAGG + Intergenic
920916849 1:210264625-210264647 TCAGTGTGGGGATAGGGGTGAGG - Intergenic
921470853 1:215547549-215547571 GCACTGTTCAGAGATGTGTGGGG + Intergenic
922808628 1:228403519-228403541 GCAGTGAGGAGAGAGGCCTGGGG - Intronic
923273718 1:232379282-232379304 GCACTGGGGAGAGGGGGTAGCGG + Intergenic
923457335 1:234175875-234175897 GCACAGTGCAGCAAGGGGTGCGG - Intronic
923713543 1:236406048-236406070 GGAGTGTGGAGCCAGGGGTGGGG - Intronic
924119912 1:240785660-240785682 ACATGGTGGAGAGAGGGATGGGG + Intronic
924382253 1:243475374-243475396 GGCCTGTGGTGTGAGGGGTGAGG + Intronic
924472049 1:244351010-244351032 GCAAAGGGGAGATAGGGGTGAGG - Intergenic
1062816812 10:506877-506899 ACACTGTGCACAGAGGTGTGAGG + Intronic
1063123944 10:3124010-3124032 GCACGGTGGATAGGAGGGTGGGG - Intronic
1063848669 10:10160885-10160907 GAGGTGTGGAGAGAGAGGTGCGG + Intergenic
1063975675 10:11413646-11413668 GCCCTGTGGAGAGTGGGGAGTGG + Intergenic
1066705721 10:38175599-38175621 GCATTGTGAAGTGTGGGGTGGGG + Intergenic
1066757093 10:38722143-38722165 GCACTGTGCAGAGATTGGAGTGG + Intergenic
1066984721 10:42454761-42454783 GCACTGTGAAGTGTGGGGCGGGG - Intergenic
1067370572 10:45678401-45678423 GCATTGTGAAGTGTGGGGTGGGG + Intergenic
1067389209 10:45847755-45847777 GCATTGTGAAGTGTGGGGTGGGG - Intronic
1067445048 10:46336794-46336816 GCATTGTGAAGTGTGGGGTGGGG + Intergenic
1067502264 10:46816086-46816108 GCATTGTGAAGTGGGGGGTGGGG + Intergenic
1067592324 10:47523934-47523956 GCATTGTGAAGTGTGGGGTGGGG - Intronic
1067639440 10:48032007-48032029 GCATTGTGAAGTGTGGGGTGGGG - Intergenic
1067717323 10:48699453-48699475 CCACAGTGGAGAGTGGGGAGAGG + Intronic
1067874055 10:49988298-49988320 GCATTGTGAAGTGTGGGGTGGGG + Intronic
1068017574 10:51536792-51536814 GCAGGGTGGGGGGAGGGGTGAGG - Intronic
1069896694 10:71684468-71684490 TGGCTGTGGAAAGAGGGGTGTGG + Intronic
1070136427 10:73698157-73698179 GCATTGTGAAGTGTGGGGTGGGG - Exonic
1070329853 10:75409211-75409233 GCACTGGGGGGAGAGAGGGGCGG - Intergenic
1070547808 10:77466154-77466176 GCACTGAGGATCGAGGAGTGAGG - Intronic
1073847467 10:107574160-107574182 AAACTGTGGAGGGAGGGGAGGGG + Intergenic
1074562088 10:114543895-114543917 GCATTTGGGAGAGAAGGGTGTGG - Intronic
1075016416 10:118912943-118912965 GCCCTGTGTAGACAGGGGTCTGG - Intergenic
1075979562 10:126724885-126724907 CCACTGGGGTGAGAGGGGAGTGG - Intergenic
1076513263 10:131027265-131027287 GAAAGGTGGAGGGAGGGGTGAGG - Intergenic
1076667505 10:132101638-132101660 GCACTGCACAGAGAGTGGTGCGG + Intergenic
1076691438 10:132225614-132225636 GTCCTGTGCAGAGAGGGGTCAGG + Exonic
1076790535 10:132774826-132774848 GCACGGAGGAGAGAGGGGTAGGG + Intronic
1076790566 10:132774913-132774935 GCACGGAGGAGAGAGGGGTAGGG + Intronic
1076990895 11:272969-272991 GCATCGAGGAGAGAGGTGTGGGG + Intergenic
1077192498 11:1261266-1261288 CCACTGTGGACAGAAGGGGGCGG + Intronic
1077313351 11:1903308-1903330 GAGCTGTGGAGCGGGGGGTGGGG + Intergenic
1077471905 11:2767698-2767720 GCACTGTGGAGAGAAGCTTTGGG - Intronic
1077474709 11:2780808-2780830 CCACATTGGAGAGAGGGGTCTGG + Intronic
1077586772 11:3459748-3459770 GCACTGGGTAGAGGAGGGTGTGG - Intergenic
1077906785 11:6540283-6540305 GCATTGAGTAGAGATGGGTGAGG - Intronic
1078456365 11:11478836-11478858 GCACTGAAGAGAGATGGGGGCGG + Intronic
1079336868 11:19577701-19577723 GCACTGTGTGGATGGGGGTGTGG + Intronic
1079601506 11:22316645-22316667 GCACAGGGGAGAGAGAGGCGGGG - Intergenic
1080749347 11:35138638-35138660 ACAGTGGGGAGTGAGGGGTGGGG - Intergenic
1081567830 11:44270681-44270703 GCACAGTGGAGACAGGCCTGCGG - Intronic
1081596126 11:44460829-44460851 GCACTGTGAAGAGAGTGGGAGGG - Intergenic
1081644965 11:44783910-44783932 GCCCTGAGACGAGAGGGGTGAGG - Intronic
1081865332 11:46356565-46356587 TCACTGAGTAGAGAGGGGAGTGG + Intronic
1083321200 11:61848137-61848159 CCTGTGGGGAGAGAGGGGTGGGG - Exonic
1083420811 11:62552037-62552059 GGACTGTGGAGAGAAGGGAGGGG - Intronic
1083955937 11:65982736-65982758 GGACAGTGGAGAGCAGGGTGGGG + Intergenic
1084502429 11:69542749-69542771 GGACTGTGGAGTGAGGAGTGCGG - Intergenic
1084762039 11:71280090-71280112 GAAGTGTGGAGTGAGGTGTGGGG + Intergenic
1084952988 11:72676952-72676974 GCACCCTGGAGAGAGGCCTGTGG - Intergenic
1085150425 11:74248352-74248374 GATCTCAGGAGAGAGGGGTGAGG - Intronic
1085255019 11:75167604-75167626 GCACTGGGGACACAGGGATGGGG + Intronic
1085320489 11:75570952-75570974 GCTGTCTGGAGAGTGGGGTGGGG + Intronic
1086590564 11:88509502-88509524 GAACTGAGGAGAGAAGGGAGAGG + Exonic
1087066973 11:94036412-94036434 GCCCTATGCTGAGAGGGGTGAGG + Intronic
1087439884 11:98170017-98170039 GCAGTGGGGTGAGAGGGATGGGG + Intergenic
1087841715 11:102927483-102927505 GGACTGTGAGGAGAGGGCTGTGG + Intergenic
1088116453 11:106318273-106318295 ACACCGTGGGGAGAGGGGAGAGG + Intergenic
1088510743 11:110571630-110571652 GAATTGTTGAGAGAGGAGTGTGG + Intergenic
1088877249 11:113946168-113946190 GCACTTAGGAGAGAGAGGAGGGG + Exonic
1088881313 11:113975470-113975492 GGGCTGTGGAGAGGAGGGTGGGG + Intronic
1089418486 11:118313687-118313709 ACACTGTGGGGGGTGGGGTGGGG - Exonic
1089566897 11:119376424-119376446 GCACTGGGCAGGGAGGGGTATGG - Intronic
1090242189 11:125192063-125192085 GCACTGTGAAGAGATGTGAGGGG + Intronic
1090431105 11:126647436-126647458 GGACCCTGGTGAGAGGGGTGGGG - Intronic
1090515200 11:127417647-127417669 GTACTGGGGAGTGAGGTGTGGGG - Intergenic
1091036374 11:132237615-132237637 ACACTGTGGAGACGGAGGTGGGG + Intronic
1091397553 12:163234-163256 GTTCTGTGGAGGGAGGGGAGGGG - Intronic
1091397567 12:163266-163288 GTTCTGTGGAGGGAGGGGAGGGG - Intronic
1091397581 12:163298-163320 GTTCTGTGGAGGGAGGGGAGGGG - Intronic
1091775295 12:3181050-3181072 TCACAGTGGAAAGATGGGTGGGG + Intronic
1092111286 12:5966595-5966617 GCACAGTGGCCAGAGGGGAGGGG - Intronic
1094486555 12:30930026-30930048 AGACTGTGGAGAGAAGGGTCGGG + Intronic
1094641958 12:32284228-32284250 GAAAGCTGGAGAGAGGGGTGTGG - Intronic
1094777367 12:33745989-33746011 GCAGTGTGGAGAGAAATGTGGGG + Intergenic
1095824813 12:46519960-46519982 GCATTCTGGACATAGGGGTGGGG - Intergenic
1096459403 12:51814104-51814126 GCACTGTGGCGAGCGGGCCGGGG + Intergenic
1096789805 12:54037615-54037637 GCAGGGTGGAGAGGGGGGAGAGG - Intronic
1097070534 12:56351188-56351210 GCTCTGAGGAGAGAGAGGTGTGG + Exonic
1097158036 12:57026905-57026927 GCACAGTGAGGACAGGGGTGAGG + Intronic
1097232969 12:57523173-57523195 GCACTGAGGGGAGGGCGGTGAGG - Intronic
1097347096 12:58505690-58505712 ACAGTGTGGTGAGAGGGATGTGG - Intergenic
1101079257 12:101165490-101165512 GTGCTGTGGAGAGAGGGGCAAGG - Intronic
1101271804 12:103155014-103155036 CCACTGTGAAAAGAGGAGTGGGG - Intronic
1101365227 12:104064529-104064551 GCATTGTGGGCAGAGGGGCGGGG + Exonic
1101565078 12:105897294-105897316 GCAGTTTGGGGAAAGGGGTGGGG + Intergenic
1101751698 12:107587299-107587321 GCAGTGTGGACAGTGGGCTGAGG + Intronic
1101968173 12:109294846-109294868 GCACTGATGAGGGAGAGGTGTGG - Intronic
1104547657 12:129726653-129726675 GGACGGTAGACAGAGGGGTGAGG + Intronic
1104658278 12:130590509-130590531 CCACTGATGAGAGAGGGCTGCGG - Intronic
1105213413 13:18271124-18271146 GCCCTGCAGAAAGAGGGGTGTGG - Intergenic
1106076533 13:26465572-26465594 GCAGGGAGGTGAGAGGGGTGAGG + Intergenic
1106977744 13:35241834-35241856 GCACTGTGTTGAGGAGGGTGTGG - Intronic
1108522419 13:51258426-51258448 GAGCTGGGGATAGAGGGGTGAGG + Intronic
1108742201 13:53349770-53349792 CCACAGGGGAGAGAGGGCTGTGG + Intergenic
1108772639 13:53723368-53723390 GTACTGTGGGGTGAGGGGTGGGG - Intergenic
1108818468 13:54317876-54317898 GAGGTGTGGAGAGAGAGGTGTGG + Intergenic
1110187201 13:72689155-72689177 GCAGTGTGGAAGAAGGGGTGTGG - Intergenic
1111141603 13:84127006-84127028 ACAATGTGGTGAGAGGGGTAGGG + Intergenic
1111858566 13:93671664-93671686 GAAGTGAGGAGAGAGGGCTGTGG - Intronic
1112058861 13:95716955-95716977 GTGCTGGGTAGAGAGGGGTGGGG - Intronic
1112492164 13:99876964-99876986 GCACTGAGCAGGGAGGCGTGTGG - Intronic
1113443985 13:110351647-110351669 GCACTGTGGACAAAGGGAAGGGG - Intronic
1113602233 13:111578105-111578127 GCACTGGGGACAGAGTGGTCAGG + Intergenic
1113607290 13:111618734-111618756 GCAGGGTGGAGAGAGGTGAGAGG + Intronic
1114191147 14:20440347-20440369 CCAGTGTGGAGGGTGGGGTGGGG - Intergenic
1114252308 14:20971697-20971719 GGGCTGAGTAGAGAGGGGTGAGG + Intergenic
1114666123 14:24378071-24378093 GCTCTTTGGAGAGATGGGTTGGG + Exonic
1116638185 14:47424953-47424975 GAAGTGTGGAGAGAAAGGTGGGG + Intronic
1119438798 14:74614373-74614395 GCAGTGGTGAGAGTGGGGTGTGG + Intergenic
1119516085 14:75249557-75249579 GAATAGTGGAGAGAGGTGTGTGG + Intronic
1120684471 14:87522408-87522430 GCACTGTTTAGAGAGCTGTGGGG - Intergenic
1121031033 14:90658973-90658995 GGACTGGGGTGAGTGGGGTGAGG + Intronic
1121434525 14:93910429-93910451 TCTCAGTGGAGACAGGGGTGTGG + Intergenic
1121617045 14:95320070-95320092 GCCCTGAGGAGCGAGGGGCGAGG + Intergenic
1121868860 14:97388716-97388738 CCACAGTGGAGAGAGGGATCAGG - Intergenic
1122028729 14:98896976-98896998 GGACTGGGGACAGAGGGGAGTGG - Intergenic
1122031577 14:98916161-98916183 GCACTGCTGGGAGAGGGCTGGGG - Intergenic
1122093939 14:99357640-99357662 GCCCTATAGAGGGAGGGGTGTGG - Intergenic
1122834722 14:104425131-104425153 GCACTGTTGGGTGGGGGGTGGGG - Intergenic
1123007442 14:105330624-105330646 GCTCCGTGGAGACAGGGGCGAGG - Intronic
1123450713 15:20357615-20357637 TCACAGTGGAGTGAGGGGCGGGG + Intergenic
1123893463 15:24804327-24804349 GCACTGTGAAGACAGGGTGGTGG - Intergenic
1124418166 15:29491244-29491266 GAGGTGTGGAGGGAGGGGTGCGG - Intronic
1125132828 15:36304072-36304094 GGACTGAGTGGAGAGGGGTGCGG + Intergenic
1125163081 15:36670023-36670045 GCCTTCTGGAGAGAGGAGTGTGG + Intronic
1125514101 15:40308288-40308310 GCACCGTAGAGGCAGGGGTGGGG + Intergenic
1126613045 15:50549103-50549125 GGAGGGTGGAGAGTGGGGTGGGG - Intergenic
1127807336 15:62533416-62533438 TCACTGTTGAGGGAGGGGTTAGG - Intronic
1127997130 15:64159787-64159809 GGATTGGGGAGAGAGGCGTGTGG - Intronic
1128356425 15:66930701-66930723 GGGCTGTGGAGAGAAGGGTGAGG - Intergenic
1128421395 15:67494848-67494870 CCACGGTGGAGAAACGGGTGGGG - Intronic
1128525047 15:68406680-68406702 GCACTGAGGATAGAGCAGTGAGG - Intronic
1128534751 15:68482035-68482057 ACACTGTGGAGAAATGGCTGTGG + Intergenic
1128768497 15:70265414-70265436 ACACTGGGGAGAGGGGGCTGAGG - Intergenic
1128813021 15:70585775-70585797 GCTCTGGAGAGGGAGGGGTGAGG - Intergenic
1129107364 15:73319194-73319216 ACCCTCTGGAGACAGGGGTGGGG + Intergenic
1129263315 15:74381044-74381066 GGTCTGGGAAGAGAGGGGTGGGG - Intergenic
1129369117 15:75076898-75076920 GCTCTGTGGAGCCAGAGGTGAGG + Intronic
1129382812 15:75178553-75178575 GCACTGTGGGGGGTGGGGCGGGG + Intergenic
1129387720 15:75204990-75205012 GGAGTGGGGCGAGAGGGGTGTGG + Intronic
1129683621 15:77672141-77672163 GCACTGTGGGGGTCGGGGTGGGG - Intronic
1129803970 15:78438603-78438625 CCACCGGAGAGAGAGGGGTGCGG - Intronic
1131389293 15:92034107-92034129 GCTCTGTGGAGAGTGGACTGTGG + Intronic
1131422391 15:92318151-92318173 GCTCTGTGAAGGGAGGAGTGGGG + Intergenic
1132083212 15:98884942-98884964 GCACTGGAGACAGAGGGGAGGGG - Intronic
1132219190 15:100092621-100092643 GCTCTGTGTAGTGTGGGGTGTGG - Intronic
1132463497 16:67055-67077 ACCCTGTGGAGGGAGGGCTGGGG - Intronic
1132643892 16:990032-990054 GCCCTCAGGGGAGAGGGGTGGGG + Intergenic
1132648556 16:1010202-1010224 CCACTGTGGATGGAGGGGTCCGG + Intergenic
1132726481 16:1341109-1341131 GGCCTGTGGACAGAGGGGCGTGG - Exonic
1132863348 16:2082152-2082174 GCACGGTGCCGAGTGGGGTGGGG - Intronic
1132864354 16:2086173-2086195 GCTCTGTGGGGAGAGGGGAGAGG - Exonic
1132919300 16:2376632-2376654 GCTCTCTGGAGAGAGGGATGAGG - Intergenic
1132976668 16:2714429-2714451 ACATTGTGCAGAGAGAGGTGTGG - Intronic
1133021089 16:2967300-2967322 GCCCTGCGGAGAGGGGCGTGAGG - Exonic
1134059812 16:11192337-11192359 GGACTGGGGGGAGAGGGCTGTGG + Intergenic
1134226826 16:12397833-12397855 ACACTGTGGAGGTGGGGGTGAGG - Intronic
1134570225 16:15284367-15284389 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1134732150 16:16471686-16471708 GCATTGGGCAGAGAGGGGAGTGG - Intergenic
1134935287 16:18240277-18240299 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1135113349 16:19707635-19707657 GCACTGTGTAGGGAGGTGGGGGG - Intronic
1135317043 16:21456741-21456763 ACACTTTGGGGAGTGGGGTGGGG - Intergenic
1135369966 16:21888982-21889004 ACACTTTGGGGAGTGGGGTGGGG - Intergenic
1135441848 16:22482140-22482162 ACACTTTGGGGAGTGGGGTGGGG + Intronic
1135791707 16:25402444-25402466 GCCCAGTGGAGATAGGAGTGTGG + Intergenic
1136720429 16:32315590-32315612 GCACTGTGCAGAGATTGGAGTGG - Intergenic
1136838806 16:33521864-33521886 GCACTGTGCAGAGATTGGAGTGG - Intergenic
1137587957 16:49675465-49675487 GCACCGCTGAGGGAGGGGTGGGG - Intronic
1138203510 16:55107430-55107452 CCGCTGAGGAGAGAGGGGAGGGG - Intergenic
1138421548 16:56902504-56902526 TCAAGGTGCAGAGAGGGGTGGGG + Exonic
1138724089 16:59117052-59117074 GCACTTTGGAGGAAGGGGTGGGG - Intergenic
1139354544 16:66359821-66359843 GCAGTGTGCACTGAGGGGTGTGG + Intergenic
1139523260 16:67497435-67497457 AGACTCTGGAGAGAGGAGTGAGG - Intergenic
1139650743 16:68361014-68361036 TCACTGTGGACAGAGGAGTCAGG - Exonic
1139888793 16:70232394-70232416 ACACTTTGGGGAGTGGGGTGGGG - Intergenic
1140011409 16:71134929-71134951 GCACTCAGGAGAGAGGTGGGAGG + Intronic
1140942212 16:79732829-79732851 GCAATGTTGGTAGAGGGGTGAGG - Intergenic
1140998885 16:80289268-80289290 GCAGTGAGGAGACAGGAGTGGGG - Intergenic
1141159481 16:81619574-81619596 TCACTTTGGAGAGAGGGTTGTGG + Intronic
1141275175 16:82581004-82581026 CCAGTTTGAAGAGAGGGGTGTGG + Intergenic
1141657240 16:85422750-85422772 GGAGTGAGGAGAGAGGGGTTTGG + Intergenic
1141712969 16:85710628-85710650 GCGCTGTGGAGAGTGGGGGCTGG - Intronic
1141788861 16:86219454-86219476 GCACTGGGAATAAAGGGGTGAGG - Intergenic
1141954355 16:87360466-87360488 GCACTCTGGAGATGGGGCTGAGG - Intronic
1142076516 16:88121040-88121062 GTACTGTGCACAGTGGGGTGGGG + Intergenic
1203006003 16_KI270728v1_random:202179-202201 GCACTGTGCAGAGATTGGAGTGG + Intergenic
1203148971 16_KI270728v1_random:1822152-1822174 GCACTGTGCAGAGATTGGAGTGG - Intergenic
1142715526 17:1745155-1745177 GAACTGTGGAGAAAGGGATGAGG - Exonic
1142851898 17:2708348-2708370 ACCCTCCGGAGAGAGGGGTGGGG + Intronic
1142889414 17:2933225-2933247 CCACTGTGGAGTGAGGGAGGGGG + Intronic
1142892223 17:2951292-2951314 TCACTGGATAGAGAGGGGTGAGG - Intronic
1144120718 17:12150257-12150279 GAACTGAGGAAAGAAGGGTGAGG + Intergenic
1144307110 17:13978708-13978730 GCAATGGAGAGAGAGGGGAGAGG - Intergenic
1144389936 17:14784223-14784245 GCAAAGTAGAGAGAGGGCTGCGG + Intergenic
1144698234 17:17320369-17320391 GGTCTGTGGAGAGAGGTGGGTGG + Intronic
1144713212 17:17416526-17416548 GCTCTGTGGGGAGATGGGAGTGG + Intergenic
1144767587 17:17740978-17741000 GCAGTGTGGGGAGAGGGCAGGGG + Intronic
1144807816 17:17979229-17979251 CCACTGTGGAGAGACAGGTCGGG + Intronic
1144836379 17:18158650-18158672 CCACTGTGGGAAGAGGGGTGGGG - Intronic
1145216274 17:21054854-21054876 ACACTGTGAAGGGAGGTGTGAGG + Intergenic
1146170004 17:30625514-30625536 CCAGTGTGGATGGAGGGGTGGGG - Intergenic
1146269743 17:31477021-31477043 GCCCTGTGGAGAAGGTGGTGGGG - Intronic
1146501753 17:33370576-33370598 GCAGGGTGGAGGGAGGGGTGAGG + Intronic
1147156845 17:38548374-38548396 CCACTGTGAAATGAGGGGTGGGG - Intronic
1147167650 17:38602003-38602025 GCACAGAGGAGAGATGGGGGAGG + Intronic
1147338112 17:39739007-39739029 GGCCTGGGGAGAGTGGGGTGGGG + Intronic
1147834060 17:43317546-43317568 GCACAATGGAGTGAGAGGTGGGG - Intergenic
1147841530 17:43375233-43375255 GCACAATGGAATGAGGGGTGGGG + Intergenic
1147993627 17:44349910-44349932 GCACTGGGGATAGGAGGGTGCGG + Intronic
1148052650 17:44776725-44776747 GCACTGTGGAGAGAGGGGTGGGG - Exonic
1148469713 17:47885425-47885447 ACAGTGTGGAGAGAGGACTGAGG + Intergenic
1148567050 17:48639501-48639523 GCCCAGTGCAGGGAGGGGTGGGG + Intergenic
1148736771 17:49869497-49869519 GCTCTGTGGAGGGAGGTTTGTGG - Intergenic
1149609691 17:57951047-57951069 GCACAGTGGAGGCGGGGGTGGGG - Intronic
1149623114 17:58060802-58060824 GCACTGCGGATGGAGGGGGGCGG + Intergenic
1149655492 17:58307760-58307782 GGACTGTGGAGACAGTGGAGAGG + Exonic
1150549502 17:66196108-66196130 GCACTTTGGGGAGAGGGTTTGGG + Intergenic
1150970730 17:70024437-70024459 GAACATTGGAGAAAGGGGTGAGG + Intergenic
1151155947 17:72123105-72123127 GCTCTGGGTAGAGAGGGGAGCGG - Intronic
1151454241 17:74216589-74216611 TCACTGGGGGGAGAGGGGTGAGG - Intronic
1151524192 17:74652695-74652717 GTAATGTGGAGAGAGAGGAGAGG - Intergenic
1151652963 17:75481375-75481397 CCACTGTGGAGAGCGGGATTAGG + Intronic
1151715318 17:75828084-75828106 CCCCTGCGGAGAGAGGGGTTTGG + Exonic
1151810517 17:76438014-76438036 GCAGTGTGGACAGAGGAGTGGGG - Intronic
1151968419 17:77444448-77444470 GGACTTTGGTGAGAGGGCTGGGG + Intronic
1152266552 17:79298245-79298267 GCACTGTGAAGGCATGGGTGGGG + Intronic
1152279842 17:79378866-79378888 GCACAGTGGGTACAGGGGTGGGG + Intronic
1152297173 17:79474841-79474863 CCTCTGGGGAGAGAGGGATGTGG - Intronic
1152337723 17:79707721-79707743 TCACAGTGGAGTGAGGGGCGGGG - Intergenic
1152432900 17:80259766-80259788 GCACCGTGGGGAGTGGGGTAAGG + Intergenic
1152528905 17:80905651-80905673 GCAATGTGCAGGGCGGGGTGGGG - Intronic
1152684972 17:81689443-81689465 GGATTGTGTAGAGAGAGGTGGGG + Intronic
1152800871 17:82330118-82330140 GCATCGTGGAGCGTGGGGTGAGG - Intronic
1153643483 18:7174939-7174961 GCTCTTTGGAGAGGGAGGTGGGG - Intergenic
1153850094 18:9085846-9085868 GCACTTTGGAGGCAGAGGTGGGG - Intergenic
1154217099 18:12423351-12423373 GCCCTGTGGAGAGAGGGCCGGGG + Intronic
1156243080 18:35271997-35272019 GAGCTGTGGAGAGAGAGGCGTGG - Intronic
1156496778 18:37530985-37531007 GCACAGGTGAGGGAGGGGTGGGG + Intronic
1157790151 18:50524285-50524307 ACACGGTGGCGAGAGGGGTCTGG - Intergenic
1158462257 18:57656726-57656748 GTAGTGGGGAGAGAGGGGTGGGG + Intronic
1159109771 18:64042975-64042997 GAGGTGTGGAGGGAGGGGTGCGG + Intergenic
1159252824 18:65903535-65903557 GCAAGGTTGAGAGAGGAGTGAGG + Intergenic
1159887623 18:73924142-73924164 GCTCTGTGGGAAGCGGGGTGGGG + Intergenic
1159890769 18:73951191-73951213 TCCCTGTGGAGAGAGAGGAGCGG + Intergenic
1159923481 18:74246995-74247017 GGGCTGTGGAGATGGGGGTGGGG - Intergenic
1160148781 18:76384329-76384351 GAGCCGTGGAGGGAGGGGTGGGG - Intronic
1160148810 18:76384411-76384433 GAACCGTGGAGGGAGTGGTGGGG - Intronic
1160339163 18:78071746-78071768 GCAAAGTGGAAAGAGGGCTGAGG - Intergenic
1160507853 18:79437226-79437248 GGATAGTGGAGAGAGGGGTCTGG + Intronic
1160526260 18:79540208-79540230 CCACTGTGGACAGCGGGATGAGG + Intergenic
1161572622 19:5038781-5038803 GCACTGTGCAGAGCGTGCTGGGG - Intronic
1161657093 19:5523067-5523089 ACAGTGTGGAGGGAGGGATGGGG - Intergenic
1161708287 19:5832584-5832606 GAAGTGGGGAGAGAGGAGTGAGG + Intronic
1161995195 19:7707515-7707537 GCCCTCTGGAGGGAAGGGTGTGG - Intergenic
1162281463 19:9701254-9701276 GAACTGTGGGTAGAGGGTTGGGG + Intergenic
1162302753 19:9853551-9853573 GCCCTTTGGGGAGATGGGTGAGG - Intergenic
1162311809 19:9912591-9912613 GTCCTGAGGAGAGAGGGGAGGGG - Intronic
1162723366 19:12675503-12675525 ACCCTGTGGAGCGAGGGGTAGGG - Exonic
1164114860 19:22209938-22209960 GCCTTGTCCAGAGAGGGGTGTGG + Intergenic
1164155760 19:22596076-22596098 CCACTCTGGGGAGAGGGGCGGGG - Intergenic
1164503831 19:28841679-28841701 TCACTGTGGTGAGGGGTGTGGGG - Intergenic
1164580668 19:29433100-29433122 TCTCTTTGGAGAGAGGGATGGGG - Intergenic
1164773020 19:30826977-30826999 GCACTTTGCAGAGAAGGGTATGG + Intergenic
1165767624 19:38361058-38361080 GCACTGTGGCAAGAAGGGTGAGG + Intronic
1165863267 19:38920180-38920202 GCAGCGGGGAGAGAGGGATGGGG + Intronic
1166287196 19:41838475-41838497 GCACAAGGGAGAGAGGAGTGGGG - Intronic
1166295378 19:41886873-41886895 GAGCTGTGGAAAGAGGGGTGGGG - Intronic
1166543851 19:43622841-43622863 GCACGGTGGGGGGATGGGTGGGG - Exonic
1167119748 19:47509708-47509730 GCATTGTGCAGTAAGGGGTGGGG - Intronic
1167307351 19:48716741-48716763 GGACTGTGGAGGGAGGAGGGAGG + Exonic
1167358342 19:49017247-49017269 CCACTGAGGGGAGAGGGCTGGGG - Intergenic
1167372234 19:49090133-49090155 ACACAGTGGAGGGAGGGGAGTGG - Intronic
1167566465 19:50260621-50260643 GCAATGAGCAGGGAGGGGTGGGG - Intronic
1167573714 19:50307031-50307053 GCTCTCTGAAGAGAGGGATGAGG - Exonic
1167784826 19:51628091-51628113 GCTTTGGGGAGAGAAGGGTGGGG + Exonic
1168084592 19:54036160-54036182 GGACTGTGTAGTGAGGGGAGGGG + Intergenic
1168104064 19:54155938-54155960 GGCCTGTGGGGAGAGGAGTGAGG + Exonic
925065331 2:925488-925510 GAGCTGGGAAGAGAGGGGTGTGG + Intergenic
925098167 2:1224064-1224086 TCCCTGTGGAGGAAGGGGTGAGG + Intronic
925616741 2:5750979-5751001 GGACTGAGGGGACAGGGGTGGGG - Intergenic
925835829 2:7946089-7946111 CCACTGTAGAGAGTGGGGAGTGG - Intergenic
926075002 2:9935423-9935445 GCACTGTGGATAAAGGGGAGAGG + Intergenic
926224331 2:10956367-10956389 CCCCAGTGGAGAGAGGGGTCTGG - Intergenic
926354206 2:12024768-12024790 GCATTTGGGGGAGAGGGGTGGGG - Intergenic
926850137 2:17187492-17187514 CCTATGTGGAGATAGGGGTGTGG + Intergenic
927140215 2:20125061-20125083 GCACGGTGTACAGAGAGGTGGGG + Intergenic
927211553 2:20642094-20642116 GCACAGAGGAGCGAGGAGTGAGG - Intronic
927295321 2:21446538-21446560 GGACTGTGGAGACAGAGGGGAGG - Intergenic
927430778 2:23024744-23024766 TCGCTGTGGAAGGAGGGGTGGGG - Intergenic
927887009 2:26724883-26724905 GCACTGTGGAGAGGAGGGGCCGG + Intronic
927949558 2:27158527-27158549 GCACAGTGAAGACAGAGGTGGGG + Intergenic
928225866 2:29447584-29447606 TGACTGTGGAGAGAAGGATGGGG - Intronic
928593214 2:32838087-32838109 GAACTGTGCAGAGAGGACTGAGG + Intergenic
929120589 2:38480933-38480955 AAACTGTGGAGAGAAGGGGGTGG - Intergenic
929398338 2:41550169-41550191 GCACTCTGGGGACAGTGGTGGGG - Intergenic
929571966 2:43028380-43028402 GCACTGAGTAGAGAGGGGAGGGG - Intergenic
929579695 2:43074079-43074101 GCACTAAGGGGAGAGGGATGGGG - Intergenic
930001868 2:46866996-46867018 GATCTGAGGAGAGAGAGGTGGGG + Intergenic
931217926 2:60263689-60263711 TCAAAGTGGAGAGAAGGGTGAGG - Intergenic
931692955 2:64850829-64850851 ACTCAGAGGAGAGAGGGGTGGGG + Intergenic
931704952 2:64939560-64939582 GCAATGTTGAGAGCGGAGTGAGG - Intergenic
931889463 2:66655201-66655223 GAAAGGTGGAGAGAGGCGTGGGG + Intergenic
932593678 2:73081343-73081365 GCACTGGGGAGAGAGGGAGCAGG + Intronic
933936584 2:87208958-87208980 GAAGTGAGGAGAGAGGGGAGGGG - Intergenic
933949288 2:87314219-87314241 GAAAAGAGGAGAGAGGGGTGGGG + Intergenic
934300910 2:91775620-91775642 GCCCTGCAGAAAGAGGGGTGTGG + Intergenic
934320402 2:91966583-91966605 GCACTGTGCAGAGATTGGAGTGG + Intergenic
934559703 2:95306783-95306805 GCACTGTGGGGTGAGGGGCCAGG + Intronic
934901461 2:98163112-98163134 GCTGTGTGGGGTGAGGGGTGGGG + Intronic
936330907 2:111547378-111547400 GAAAGGAGGAGAGAGGGGTGGGG - Intergenic
938235932 2:129707571-129707593 GCACTGGGGGGTGGGGGGTGGGG - Intergenic
939054700 2:137350639-137350661 GCAATGTGGAGAATGAGGTGGGG + Intronic
939993785 2:148901354-148901376 GAACTCTGGAGAGAGTGGTGAGG + Intronic
940637125 2:156311198-156311220 CCAATGTGGAGAGAGGAGGGGGG - Intergenic
940896602 2:159087120-159087142 GCACTGTGGGGTGAAGGATGTGG + Intronic
941939404 2:171018177-171018199 GCTCCTTGGAGGGAGGGGTGGGG - Intronic
942059163 2:172212044-172212066 GCACTGTGAAGGAAGGGGCGGGG + Intergenic
942222523 2:173784361-173784383 GGCCTGTGGAGAGAGGCCTGGGG + Intergenic
942311543 2:174661379-174661401 TGGCTGTGGGGAGAGGGGTGGGG - Intronic
943068519 2:183114289-183114311 GCACTGTGGAGAGTGGATTAGGG + Intergenic
943444506 2:187967392-187967414 GTGGTGTTGAGAGAGGGGTGGGG + Intergenic
944318374 2:198307509-198307531 GCACTGGGGAGAAGGGTGTGGGG + Intronic
945023438 2:205596840-205596862 GCACTATTGAGAGAAGGATGAGG + Intronic
945077628 2:206056280-206056302 GAAGTGTGGAGAGAAGGCTGTGG + Exonic
947106614 2:226674452-226674474 GGACTGGGGAGAGAGGGGAGAGG + Intergenic
947518127 2:230824530-230824552 GGACAGTGGAGAGAGGGCTAGGG + Intergenic
948074811 2:235157700-235157722 GCAGAGTTGAGATAGGGGTGTGG - Intergenic
948179280 2:235966810-235966832 CGACTGTGCAGAGAGGGGCGAGG + Intronic
948187649 2:236034396-236034418 CTGCTGTGGAAAGAGGGGTGGGG - Intronic
948256195 2:236569725-236569747 GCACGGGGGAGAGAGAGATGTGG + Exonic
948348404 2:237318595-237318617 GCACTGGGGATGCAGGGGTGGGG - Intergenic
948378913 2:237540000-237540022 GGGATGAGGAGAGAGGGGTGTGG - Intronic
948570969 2:238916888-238916910 CCACTGTGGAAACAGGAGTGGGG + Intergenic
948600115 2:239102894-239102916 GCACTGTGGGGACAGGCGAGAGG + Exonic
948831296 2:240599396-240599418 AGACTGGGGAGTGAGGGGTGGGG + Intronic
948865082 2:240771102-240771124 TCACTGTGGAGAGAGGGTCAGGG + Exonic
1169552833 20:6718808-6718830 GTACTGAGGAGAGGGGGATGGGG - Intergenic
1169784907 20:9349293-9349315 GCGCTGTGGGGAGAGGGGATGGG - Intronic
1169813805 20:9635460-9635482 GCATGATGGGGAGAGGGGTGGGG - Intronic
1170760363 20:19243810-19243832 GCTCTGGGGAGAGAGGAGCGTGG - Intronic
1171122336 20:22578130-22578152 GAACAGTGGAGGGTGGGGTGTGG - Intergenic
1171190544 20:23156200-23156222 GCACTCTGGGTTGAGGGGTGAGG + Intergenic
1171234499 20:23513027-23513049 GCCCAGTGGAGAGAGGTGAGAGG - Intergenic
1172137542 20:32697407-32697429 GCTTTGTAGAGAGCGGGGTGGGG - Intergenic
1172468663 20:35175246-35175268 GGACTGTGAGGCGAGGGGTGAGG - Intronic
1172763693 20:37339511-37339533 TCAGGGTGGAAAGAGGGGTGGGG - Intergenic
1172888051 20:38245105-38245127 TCACTGTGGCCAGAGGAGTGGGG - Intronic
1173071536 20:39773188-39773210 CACCTGTGGAGAGAGGGGTTGGG + Intergenic
1173698994 20:45049911-45049933 GAACAGTGTAGAGAGGGGAGGGG - Intronic
1173837565 20:46135960-46135982 GGGCTGGGGAGAGTGGGGTGTGG - Intergenic
1174093506 20:48068710-48068732 GCACTGTGGAGATCGCTGTGTGG - Intergenic
1174378339 20:50140780-50140802 GCTCTGGGGAGATAGGGGTAGGG + Intronic
1175598283 20:60252998-60253020 GCACTGTCCTGAGAGAGGTGTGG + Intergenic
1175887132 20:62298619-62298641 GCCCTGTGGAGAGGGGGCTGGGG + Intergenic
1177785761 21:25669523-25669545 GCAATGTGAAGTGAGGGGAGAGG + Intronic
1177972489 21:27807879-27807901 ATACTGAGGAGAGAGGAGTGAGG + Intergenic
1178599452 21:33983499-33983521 GGAGTGTGGAGAGAGGTGTCTGG - Intergenic
1178669824 21:34580610-34580632 GCTGGGTGGAGAGATGGGTGTGG + Intronic
1179401113 21:41084776-41084798 GCCTTGTGGGGAGAGTGGTGAGG - Intergenic
1179560148 21:42210709-42210731 GCAGGGTGGAGGGAGGGGGGCGG - Intronic
1179874759 21:44262145-44262167 TCAGGGTGGAGTGAGGGGTGGGG + Exonic
1180107588 21:45630178-45630200 AAACGGTGGAGATAGGGGTGGGG - Intergenic
1180308646 22:11150639-11150661 GCACTGTGCAGAGATTGGAGTGG + Intergenic
1180547123 22:16512450-16512472 GCACTGTGCAGAGATTGGAGTGG + Intergenic
1180816245 22:18791524-18791546 GCCCTGCAGAAAGAGGGGTGTGG - Intergenic
1180916671 22:19493685-19493707 GCACTTTGGAGACAGGCGGGCGG - Intronic
1181136277 22:20768777-20768799 GCACTTTGGAGAGGGCTGTGTGG + Intronic
1181202434 22:21225856-21225878 GCCCTGCAGAAAGAGGGGTGTGG - Intronic
1181493102 22:23273061-23273083 GAGCTGTGGAGAGAGAGGGGAGG - Exonic
1181699272 22:24610758-24610780 GCCCTGCAGAAAGAGGGGTGTGG + Intronic
1181712792 22:24701340-24701362 GCCCTGTGGAGTGAGTAGTGTGG - Intergenic
1181727389 22:24820915-24820937 GCAGTGGGGAGAGAGAGGTTGGG + Intronic
1182212051 22:28684891-28684913 GCACTGTGCAGAGACTGGAGTGG - Intergenic
1182298090 22:29321835-29321857 ACACTTTGGAAAGCGGGGTGGGG - Intergenic
1182511449 22:30822909-30822931 GCATTTTGGAGAGGGGGCTGCGG + Intronic
1183366912 22:37411675-37411697 CCAGTGTGGAGACAGGGATGGGG + Intronic
1183465793 22:37979900-37979922 TCACTGGGGTGTGAGGGGTGGGG - Intronic
1183668022 22:39256325-39256347 GGAGTGTGGGGAGAGGGCTGTGG - Intergenic
1184090153 22:42288902-42288924 GCAGTGTGGAGGGAGGAGTGTGG - Intronic
1184115074 22:42417549-42417571 GCCCTGTGGAGAGCGGGGCCTGG + Intronic
1184404396 22:44291946-44291968 AGACTGCAGAGAGAGGGGTGGGG - Intronic
1184433180 22:44453616-44453638 GCACTGTGGCGATGGCGGTGAGG + Intergenic
1184474441 22:44712906-44712928 GCACTGGGAAGGGAGGGGTTGGG + Intronic
1184534527 22:45077567-45077589 AGACGGTGGACAGAGGGGTGGGG + Intergenic
1184548498 22:45190266-45190288 GCACGCTGGGGAGAGGTGTGTGG - Intergenic
1184746562 22:46459558-46459580 GCACTGTGGAGGGTGGGGTCAGG - Intronic
1185142863 22:49113002-49113024 GCACTGATGAGAGTGTGGTGTGG + Intergenic
1185373494 22:50471481-50471503 GCACTGTGGGGAGTGTGGTGGGG - Intronic
1203224479 22_KI270731v1_random:69557-69579 GCCCTGCAGAAAGAGGGGTGTGG + Intergenic
1203266348 22_KI270734v1_random:17235-17257 GCCCTGCAGAAAGAGGGGTGTGG - Intergenic
949511561 3:4771194-4771216 GCTCTGTGAAGGAAGGGGTGAGG - Intronic
950034965 3:9878703-9878725 ACCCGGTGGGGAGAGGGGTGGGG - Intronic
950041184 3:9920471-9920493 GCCCTGTGAGGAGAGGGGTGAGG - Exonic
950258824 3:11529053-11529075 GCACTGTGGAAAAAAGGGGGCGG + Intronic
950552585 3:13675637-13675659 GCGCTGAGGACACAGGGGTGGGG - Intergenic
950708218 3:14796961-14796983 GCACTGTGGGGGAGGGGGTGGGG - Intergenic
950950623 3:16994799-16994821 GCACTGTGGAGAGCAGGTAGTGG - Intronic
951482440 3:23175803-23175825 GAACTGAGAAGAGAGGAGTGAGG - Intergenic
951691024 3:25396712-25396734 GCGCTGTGGAGATGGGGGTGTGG + Intronic
952744675 3:36765184-36765206 GCCCTGTGGAGAGAAGGGTATGG - Intergenic
953188979 3:40665762-40665784 GCACTATAGAGGGTGGGGTGGGG + Intergenic
953776830 3:45826096-45826118 GCACTCAGTAGAGAGGTGTGTGG + Exonic
954002156 3:47566267-47566289 GGGGTGGGGAGAGAGGGGTGGGG + Intronic
954106573 3:48412784-48412806 CCACTGTGGAGCAAGGGCTGGGG - Exonic
954224454 3:49173131-49173153 CAACTGTGGAGAGAGGTGAGTGG + Exonic
954541744 3:51397612-51397634 GTAATGTGGAGAGAGAGGTCAGG - Exonic
954763799 3:52896899-52896921 GCACTGGGGATTGAGGGATGTGG + Intronic
955413084 3:58668331-58668353 TCACAAGGGAGAGAGGGGTGGGG + Intergenic
956122058 3:65976380-65976402 GCACTGTGGGGAGACGGAGGAGG + Intronic
956366602 3:68510108-68510130 GCACTGCAGGGAGAGGGATGAGG - Intronic
956427885 3:69155458-69155480 CCTCTGTGGAGACAGGAGTGGGG + Intergenic
956632564 3:71331123-71331145 GAGGTGTGGAGAGAGAGGTGTGG + Intronic
956642169 3:71425481-71425503 GCAGTGTGGAGGGTGGGGAGGGG + Intronic
956746708 3:72316506-72316528 CCACTGAGAAGAAAGGGGTGTGG - Intergenic
957724998 3:84052801-84052823 GGAATGCGGGGAGAGGGGTGAGG - Intergenic
958720518 3:97837625-97837647 TCCCTGTGGACAGAGGGTTGGGG + Intronic
959261113 3:104081661-104081683 TCACTGTGGTGGGGGGGGTGGGG + Intergenic
960592197 3:119377331-119377353 GCACAGTGGAGAGAATGATGGGG + Intronic
961102663 3:124214882-124214904 GCCCTGTGGAGAGAGGTCTGGGG - Intronic
961426180 3:126850283-126850305 GAACTGTGTGGAGAGGGATGAGG - Intronic
961570645 3:127796094-127796116 GCTCTGTGCAGAGAGTGGTGGGG - Intronic
961597366 3:128029112-128029134 GAACTGTGGAGAGGGTGGAGAGG - Intergenic
962041492 3:131711959-131711981 TCCCTGTGGACAAAGGGGTGGGG + Intronic
963545926 3:146658470-146658492 GCTCTATGCAGAGAGGGGTGGGG - Intergenic
964477098 3:157107019-157107041 GGGCTGTGGGGAGAGGGCTGTGG + Intergenic
965402636 3:168231199-168231221 ACACTTTGGGGAAAGGGGTGAGG + Intergenic
966182188 3:177197509-177197531 ACACTGGGGAGAGAGGAATGGGG + Intergenic
966567773 3:181402479-181402501 ACTCTGTGGGGAGATGGGTGTGG + Intergenic
966948735 3:184796774-184796796 GAAGTGTGGAGAGAAGTGTGAGG - Intergenic
967289495 3:187905221-187905243 GCATTGTGGATGGAGGGGAGGGG - Intergenic
967342381 3:188413548-188413570 GCACTGTGCAGTGATGGATGAGG - Intronic
967911823 3:194548758-194548780 GCACTGGGGAGGGAGGAGGGAGG + Intergenic
968513371 4:1004875-1004897 GCACGGTGGAGGGTGGGATGGGG + Intergenic
968515830 4:1015291-1015313 GGCCTCTGGGGAGAGGGGTGTGG - Intronic
968544491 4:1191800-1191822 TCAGTGTGGAGAGAGGGTGGAGG + Intronic
968673074 4:1862697-1862719 GGACTGGGGAGTGGGGGGTGGGG + Intergenic
968758429 4:2428527-2428549 GCGCTGTGGGTGGAGGGGTGGGG - Intronic
969238004 4:5880203-5880225 GCACTGAGGGGAGAATGGTGGGG + Intronic
969326227 4:6445856-6445878 ACACTGTGGGCAGAGGGCTGAGG - Intronic
969476066 4:7423001-7423023 GAGAAGTGGAGAGAGGGGTGGGG - Intronic
969536391 4:7758581-7758603 CTACCGGGGAGAGAGGGGTGAGG - Intergenic
969619515 4:8272095-8272117 CCACGGTGGGGAGCGGGGTGGGG - Intronic
970348919 4:15181354-15181376 ACACTGTGGAAGGAGGGGAGTGG + Intergenic
970502698 4:16694345-16694367 GAAGTGTGGAGAGAAGGGGGAGG - Intronic
970538586 4:17055212-17055234 TCAGTGTTGAGAGAGGGCTGGGG - Intergenic
970607836 4:17697146-17697168 CCACTGAGGAGAGAGGGAAGTGG + Intronic
970608849 4:17707372-17707394 GCACTGTGGTGAGCCTGGTGGGG + Intronic
971703708 4:30012870-30012892 GAAGTGGGGAGGGAGGGGTGAGG - Intergenic
972381995 4:38527728-38527750 TCACTGTGGGGTGGGGGGTGCGG - Intergenic
973758170 4:54095053-54095075 GCAGCGGGGAGAGGGGGGTGGGG - Intronic
974409239 4:61517528-61517550 GCGGTGGGGAGAGAGGGCTGGGG + Intronic
974743228 4:66035000-66035022 TCAATGTGGAGAGAGTGGAGGGG + Intergenic
975073771 4:70178470-70178492 GCACTGGAGAGAAAGGGGAGGGG - Intergenic
975971449 4:80043061-80043083 GCATGGGGGAGAGAGGGGAGTGG + Intronic
977047687 4:92088325-92088347 GCAGTTTGGGGAAAGGGGTGGGG - Intergenic
979425700 4:120562793-120562815 GCACTAGAGAGAGAGGGGAGAGG - Intergenic
979987682 4:127335261-127335283 GAACTGTGGAGTGAGGAGTGTGG - Intergenic
980076171 4:128295450-128295472 GGCCTGTGGAGTGAGGGGAGGGG + Intergenic
980456830 4:133055006-133055028 ACACTGTGGGGGGAGGGGGGAGG + Intergenic
980998765 4:139808096-139808118 GCAGTGTGTGGAGAGGGATGAGG + Intronic
981229494 4:142336331-142336353 GCACAGTGAACAGAGGTGTGTGG - Intronic
981677291 4:147357218-147357240 AGACTGTGGAAAGAGGGGAGAGG - Intergenic
981777457 4:148386211-148386233 GAGCTGTGGAGAGAGGGGAGAGG - Intronic
982714330 4:158791058-158791080 GGAATGGAGAGAGAGGGGTGAGG + Intronic
983398455 4:167233723-167233745 GCACAGGGGAGAGCAGGGTGGGG + Intronic
983994061 4:174159645-174159667 ACACTGTGGGAAGAGGTGTGAGG + Intergenic
984427136 4:179601811-179601833 CCACCGTGGAAAGAAGGGTGTGG - Intergenic
984754543 4:183313359-183313381 GCATTGTGGAGAGTGGGCTGGGG + Intronic
985027677 4:185754683-185754705 GCTCAGTGGAGTGTGGGGTGGGG + Intronic
985103700 4:186482145-186482167 GCACGGCGGGGAGAGGGGTAGGG + Intronic
985226210 4:187764321-187764343 GCCCTGTGGCTAGAGGGATGAGG + Intergenic
985226221 4:187764396-187764418 GCCCTGTGGCTAGAGGGATGAGG + Intergenic
986231026 5:5864913-5864935 GTACTGGGTAGAGAAGGGTGGGG - Intergenic
986912248 5:12572623-12572645 GCAATGTGAAGGTAGGGGTGTGG + Intergenic
992135043 5:73736212-73736234 TCACTGTGGAGTTAGGTGTGAGG + Intronic
992778919 5:80110719-80110741 GCCCGGTGGAGAGAGGGATGGGG - Intergenic
993168524 5:84385458-84385480 GGGCTGGGGAGAGAGGGTTGTGG + Intergenic
993211744 5:84961348-84961370 GCAAAGTGGAGAGGGGTGTGTGG + Intergenic
995379100 5:111512439-111512461 GTACTGTTGAGAGCGGTGTGAGG - Exonic
997165984 5:131660563-131660585 GCAGTTTGGGGAAAGGGGTGCGG - Intronic
997416994 5:133736646-133736668 GCACAGTGGAGAGAGAAGTGAGG + Intergenic
997581210 5:135018578-135018600 GTGCTGTGGGGTGAGGGGTGGGG + Intergenic
998003135 5:138640129-138640151 GCACTGTGGGTGGCGGGGTGGGG + Intronic
998011203 5:138696947-138696969 GGCCTCTGGAGAGAGGGGTCTGG + Intronic
998087940 5:139341998-139342020 GCAGAGTGGCGACAGGGGTGCGG + Intronic
998430321 5:142064777-142064799 GCACTGTGGAAGGAGAGGGGAGG - Intergenic
999177658 5:149642677-149642699 ACACTATGGAGAGTGGGTTGTGG - Intergenic
999621542 5:153479811-153479833 GGAATCTGGGGAGAGGGGTGGGG - Intergenic
999918476 5:156290120-156290142 GTACTGTGGTGAGAGTGCTGTGG + Intronic
1000414202 5:160966325-160966347 GGACTGTGGAGAGATGAGTATGG + Intergenic
1000988689 5:167889304-167889326 CCACTGTGGACGGAGGGCTGTGG + Intronic
1001101486 5:168818129-168818151 GCACTGTGGAGAGATGGCTATGG - Intronic
1001300587 5:170530819-170530841 GCTCTGTGGAGGCAGAGGTGGGG + Intronic
1001854080 5:174995622-174995644 CCAGGGAGGAGAGAGGGGTGAGG + Intergenic
1002836910 6:872721-872743 GCACTGTTGAGAGTAGGGTCAGG + Intergenic
1002977016 6:2089903-2089925 GCCATGTGGAGAGAGGGTTTAGG + Intronic
1003476355 6:6487496-6487518 GCAGTGTGGAGAGAGGTTGGTGG - Intergenic
1003503153 6:6718849-6718871 GGACAGTGGAGAAAGGGCTGAGG - Intergenic
1003746507 6:9008027-9008049 GGGGTGGGGAGAGAGGGGTGAGG - Intergenic
1004413005 6:15399253-15399275 GCACTGGGGAAGAAGGGGTGGGG - Intronic
1004905399 6:20233208-20233230 GACGTGTGGAGAGAGAGGTGCGG + Intergenic
1005007952 6:21309126-21309148 GCAGTGTGGAAAGGGGAGTGGGG - Intergenic
1005345923 6:24890496-24890518 GGACAGTGGGGAGAGGGGAGGGG + Intronic
1005437692 6:25832540-25832562 GTACTGTTTAGAGAGGAGTGTGG - Intergenic
1006435473 6:34023810-34023832 GAACTGAGGCCAGAGGGGTGAGG + Intronic
1006791512 6:36704204-36704226 GCCCTGGGGACAGAGGAGTGAGG - Exonic
1007084116 6:39131050-39131072 GCACTGGGTAGAGTGGGGTGTGG - Intergenic
1007088288 6:39166164-39166186 GCCCTGGGCAGAGAGGGGTGAGG - Intergenic
1007309092 6:40930922-40930944 CCCCTGTGGGGAGAGTGGTGAGG + Intergenic
1007751327 6:44073589-44073611 GCCCTGGAGATAGAGGGGTGGGG + Intergenic
1007752208 6:44077285-44077307 GTTCTGTGGGGTGAGGGGTGTGG - Intergenic
1007768893 6:44177793-44177815 GCCCTGGGGAGAAAGGAGTGAGG - Intronic
1007781018 6:44254814-44254836 TCACTGTGGTGGGAGGGCTGGGG - Exonic
1008035260 6:46738451-46738473 GTAAGGTGGAGAGAAGGGTGGGG + Intergenic
1008216304 6:48793961-48793983 TCACTGTGGAGGGAAAGGTGTGG - Intergenic
1010565016 6:77400367-77400389 GCACGGTGCAGAGAGGTGTTTGG - Intergenic
1010752394 6:79630604-79630626 CCATTGTGTAGGGAGGGGTGGGG + Intergenic
1012291525 6:97461209-97461231 GCCCTGTGGAGTGAGAGGTTTGG + Intergenic
1013078330 6:106790572-106790594 GCAGTGTGGAGAGAGGACAGTGG + Intergenic
1013178814 6:107700786-107700808 CCACTGGGGAGAGAGGGGAAGGG - Intergenic
1013442315 6:110182851-110182873 GCACTGTGGAGAAAAGAATGGGG - Intronic
1014051745 6:116963072-116963094 GCAGTGTGGAGAAAAGGCTGTGG - Intergenic
1014739048 6:125126181-125126203 GCGCTGTGGAGCAGGGGGTGGGG - Intronic
1016278629 6:142386050-142386072 GCATTGTGGGGAGAGGAGAGGGG + Intronic
1017084529 6:150701601-150701623 CCACTGTGGGGTGAGGGGAGGGG - Intronic
1017224681 6:152007227-152007249 GCAGAGTGGAGAGAGGGCTCAGG + Intronic
1017685150 6:156906067-156906089 GCACTGTGGAAAGGGGGAGGTGG + Intronic
1017813876 6:158003005-158003027 GCTCAGTGCAGGGAGGGGTGTGG + Intronic
1018074596 6:160200674-160200696 GCACTGTGGGAAGAGAGGTGGGG - Intronic
1018099158 6:160420951-160420973 GCTCTGCGGAGGAAGGGGTGCGG - Intronic
1018236451 6:161728695-161728717 GCCCTCAGGAGCGAGGGGTGAGG + Intronic
1018632785 6:165835096-165835118 ACACAGTGCAGAGAGAGGTGGGG + Intronic
1018690226 6:166338665-166338687 GCACTGGGGAGAGGGTGGGGAGG + Intronic
1018935896 6:168273998-168274020 CCGCTGTGGAGAGAAGGGAGTGG - Intergenic
1018971417 6:168531937-168531959 GGGCTCTGGAGAGTGGGGTGAGG + Intronic
1018972910 6:168540885-168540907 GCACAGACGTGAGAGGGGTGAGG - Intronic
1019132508 6:169887642-169887664 GCACTGCTTAGAGAGCGGTGTGG + Intergenic
1020470406 7:8528109-8528131 GAAGTGGGGAGAGAGGAGTGGGG + Intronic
1021704660 7:23354864-23354886 GCACTGTGGTTTGAGGGGTTAGG - Intronic
1021730032 7:23587009-23587031 GCACTGAGAAGGGAGGGGGGTGG - Intergenic
1021801018 7:24306475-24306497 GCACTGAGGAGACTTGGGTGGGG - Intergenic
1022109453 7:27219564-27219586 GGGCTGTGGAGGGTGGGGTGGGG + Intergenic
1022711884 7:32858737-32858759 AGACAGTGGAGAGAGAGGTGTGG - Intergenic
1023558036 7:41443628-41443650 GGGCTGTGGAGAGAGCAGTGAGG + Intergenic
1023865029 7:44234459-44234481 GGGCTGTGGAGAGAGGGAAGAGG + Exonic
1024009086 7:45252544-45252566 GCACTGTGGGGTGACTGGTGGGG + Intergenic
1024526659 7:50355083-50355105 CCACTGGGGAGAGAGGCATGAGG - Intronic
1025829570 7:65038053-65038075 GCCCGGGGGAGAAAGGGGTGGGG - Intergenic
1025916807 7:65873002-65873024 GCCCGGGGGAGAAAGGGGTGGGG - Intergenic
1026313860 7:69211327-69211349 GTGCTGGGTAGAGAGGGGTGGGG + Intergenic
1027190989 7:75995287-75995309 GCTCTGTGGAGGGATGGGGGTGG - Intergenic
1027880726 7:83832065-83832087 TAAATGTGGAGAGAGGTGTGGGG + Intergenic
1028197123 7:87920228-87920250 CCACTGTGGGGATGGGGGTGTGG - Intergenic
1028407061 7:90486601-90486623 GCAGTGTGGGGAGAGGGGTGAGG + Intronic
1029129321 7:98318110-98318132 GCAATGTGAACTGAGGGGTGAGG - Intronic
1029432462 7:100539778-100539800 GCTCTGCGGAGAGAAGGGTACGG + Intronic
1029532687 7:101135884-101135906 GCTCTGTGCCGAGAGGGCTGCGG - Intronic
1030348031 7:108455568-108455590 ACACGGAGGACAGAGGGGTGGGG - Intronic
1030486245 7:110171965-110171987 GAACTTTGGAGAGACTGGTGGGG - Intergenic
1031383207 7:121113635-121113657 GGACTGAGGTGAGAGGGATGGGG + Intronic
1031872869 7:127106526-127106548 GAACTATGGTGAGAGCGGTGTGG - Exonic
1032129972 7:129220005-129220027 GCAGCGGGGAGAGTGGGGTGGGG - Intergenic
1032311587 7:130792422-130792444 GGTCTGTGGGGAGAGGGTTGAGG - Intergenic
1033156274 7:138959838-138959860 GCACTGTTTAAAGAGGGGTCGGG - Intronic
1034339960 7:150346561-150346583 GCAGTGAGGAGAGAAGTGTGAGG + Intergenic
1034489727 7:151386827-151386849 GCAGTGTGGACACAGGTGTGTGG - Intronic
1034969080 7:155408267-155408289 GGAGTGTGGAGTGTGGGGTGTGG + Intergenic
1034972364 7:155427274-155427296 GTGCTGTGGAGACTGGGGTGTGG + Intergenic
1035011533 7:155721281-155721303 GCCCTGTGCAGAGAGGCGGGAGG + Intronic
1035023144 7:155810321-155810343 GCACTGCGGAGAGAGCGGCGGGG - Intronic
1035064879 7:156097144-156097166 GCCCTGTGGAAACAGGGGTGGGG - Intergenic
1035474376 7:159131547-159131569 GTCCTGTGGGGAGAGGGGCGAGG - Intronic
1035593374 8:835475-835497 GGAGGATGGAGAGAGGGGTGGGG - Intergenic
1036001348 8:4608298-4608320 GCAAAGTGGGGAGATGGGTGAGG + Intronic
1036585553 8:10120052-10120074 AAACTGTGGAAAGAGGGCTGGGG + Intronic
1037609348 8:20463385-20463407 TCACTGGGGAGAGTGGGGTGAGG + Intergenic
1039375752 8:37031530-37031552 GAACTGTTGGGAGTGGGGTGAGG - Intergenic
1039599260 8:38820461-38820483 GCCCTCAGAAGAGAGGGGTGGGG - Exonic
1039794182 8:40898045-40898067 GGCCAGTGGAGAGAGGGGAGAGG + Intergenic
1040937529 8:52796769-52796791 AGACTGTGGAGGCAGGGGTGGGG - Intergenic
1040978357 8:53219007-53219029 GCACTGTGGAGAGGTGAGTGGGG + Intergenic
1041395917 8:57391076-57391098 GCAAAGGGGAGATAGGGGTGGGG - Intergenic
1042220068 8:66464636-66464658 GGACAGATGAGAGAGGGGTGAGG - Intronic
1044604843 8:94039595-94039617 GCTCTTTTGAGTGAGGGGTGGGG + Intergenic
1045685130 8:104703700-104703722 GCACTTTGGAGAGAAAGATGTGG - Intronic
1047081952 8:121472223-121472245 GCACAGTGGAGAGTGCTGTGTGG + Intergenic
1048266411 8:132991241-132991263 CCACTGTGGAGAGTGCTGTGGGG - Intronic
1048358976 8:133678989-133679011 GCAGTGTGGAGAGAAGGGGCAGG - Intergenic
1048692927 8:136988723-136988745 GCAGAGTGGAGAGGGGTGTGTGG + Intergenic
1049256841 8:141618738-141618760 CCGCAGAGGAGAGAGGGGTGAGG - Intergenic
1049302342 8:141878288-141878310 CCACTGTGCAGAGAAGGCTGAGG - Intergenic
1049466737 8:142754494-142754516 GAACTGAGGAGGGAAGGGTGTGG - Intergenic
1049714516 8:144083536-144083558 GCACCTTGGAGGGAGGGGTCTGG + Intronic
1049853238 8:144845650-144845672 GGACTGTGGAGACAGGGTTGAGG - Intronic
1050152802 9:2633845-2633867 GCAATGAGGGGAGAGGGGAGAGG + Intronic
1051371800 9:16365205-16365227 GCACTGTGGGGAAAGCTGTGAGG - Intergenic
1052790368 9:32869871-32869893 GAAATGAGGAGACAGGGGTGGGG + Intergenic
1052842711 9:33306788-33306810 GCACCGTGGGGAAAGGGGGGAGG - Intronic
1053167649 9:35855821-35855843 GCACTGAGCAGAGAATGGTGTGG + Intergenic
1055343281 9:75308519-75308541 GCAGTGTGGATGGGGGGGTGGGG - Intergenic
1055656268 9:78453040-78453062 GCACTGTGAGGAAAGGGATGGGG - Intergenic
1057379179 9:94553660-94553682 GCACTGTGGGTGGAGGCGTGAGG - Intergenic
1059354685 9:113689296-113689318 GCTCTGAGGAGGGAGGGGTCAGG + Intergenic
1060011294 9:120044929-120044951 GGAATGTAGAGAGAGGTGTGTGG - Intergenic
1060392429 9:123289322-123289344 GCAGTGGGGAGAGAGGGATGGGG - Intergenic
1060740664 9:126095738-126095760 GCAAAGTGGGGTGAGGGGTGGGG + Intergenic
1060880382 9:127113865-127113887 CCACAGTGGTGAGAGGGATGCGG - Intronic
1061145940 9:128798503-128798525 GCACTGTGGAGATACAGGAGTGG + Intronic
1061601742 9:131674910-131674932 CAAGTCTGGAGAGAGGGGTGGGG + Intronic
1061719518 9:132543065-132543087 GCAAGGTGCAGGGAGGGGTGTGG - Intronic
1061755300 9:132808379-132808401 GCACTGTGGACAGAGGACTGGGG - Intronic
1061779575 9:132987666-132987688 GCACTGTGGAGTGAGGCTGGGGG + Intronic
1062538056 9:137029458-137029480 GGACGGTGGAGAGTGGGGCGAGG - Intronic
1062543327 9:137051127-137051149 GTACTGTGGAGAGGGGAGTGTGG + Exonic
1062707543 9:137953738-137953760 GCACAGTGGACAGAAGGTTGTGG + Intronic
1185614552 X:1412950-1412972 GGACAGAGAAGAGAGGGGTGTGG + Intronic
1185627348 X:1492158-1492180 TCACTGAGGATAGGGGGGTGTGG + Intronic
1185978622 X:4749861-4749883 GCAGTTTGGAGGAAGGGGTGGGG - Intergenic
1186636322 X:11409042-11409064 GAGCTTTGGAGAGATGGGTGCGG - Intronic
1187308670 X:18120333-18120355 GCACTGGAGAGTGATGGGTGAGG - Intergenic
1187500094 X:19832527-19832549 GGAATGAGGAGAGAGGGGTAAGG + Intronic
1188617187 X:32172490-32172512 TCACTGTTGAGAGAAGGGAGAGG - Intronic
1189142746 X:38623896-38623918 GCACTGAGGGGTGGGGGGTGGGG - Intronic
1189170432 X:38904027-38904049 CCACTTTGGAGAGGGGGGAGAGG + Intergenic
1189813273 X:44800411-44800433 ACCCAGTGGTGAGAGGGGTGGGG + Intergenic
1190176693 X:48156460-48156482 GCACTGTGGGGGGGTGGGTGGGG - Intergenic
1190417959 X:50199770-50199792 GGAGTGGGGAGAGAGGGGAGGGG - Intronic
1190770998 X:53513948-53513970 CCACTGTGGTGGGAGGGGTGGGG - Intergenic
1192428141 X:71095444-71095466 GCACGTTGGAGAGTTGGGTGGGG - Intergenic
1192451880 X:71249921-71249943 GCCCTGTGGAAAGGGGAGTGGGG - Intronic
1194278213 X:91913521-91913543 CCACTGTGGAGCATGGGGTGAGG - Intronic
1194331556 X:92590168-92590190 GCAGTTTGGGGAAAGGGGTGGGG - Intronic
1195466298 X:105183053-105183075 GCACTGTGGCGAGTGGAGGGTGG + Intronic
1195997406 X:110745094-110745116 GCACTATGGAGATAGGGCAGAGG - Intronic
1196491322 X:116270834-116270856 GCCCTGTGGAGAGTGTGGCGGGG + Intergenic
1196663698 X:118294675-118294697 GAAGTGTGAAGAGAGAGGTGTGG - Intergenic
1196717311 X:118824027-118824049 GCCCGGCGGGGAGAGGGGTGGGG + Intronic
1197079000 X:122389231-122389253 GAAGTGTGAAGAGAGAGGTGTGG - Intergenic
1197926062 X:131647697-131647719 GCACTGTGCAGAGAGGGAAAAGG - Intergenic
1198184191 X:134237543-134237565 GCAGTGCGGAAAGAGGAGTGGGG + Intronic
1198233439 X:134715002-134715024 GGATTGTGGAGAGAGGGGGATGG - Intronic
1199437486 X:147828849-147828871 GAAGTGTGAAGAGAGAGGTGTGG - Intergenic
1199860789 X:151798918-151798940 GCACTGTGGAGAGGGGTGGAGGG + Intergenic
1200595550 Y:5135596-5135618 CCACTGTGGAGCATGGGGTGAGG - Intronic
1200640261 Y:5709224-5709246 GCATTTTGGGGAAAGGGGTGGGG - Intronic
1201187906 Y:11421685-11421707 GCACTGTGCAGAGATTGGAGTGG + Intergenic
1202378726 Y:24259209-24259231 GCTCCGTGGAGGGAGGGCTGAGG - Intergenic
1202492056 Y:25410912-25410934 GCTCCGTGGAGGGAGGGCTGAGG + Intergenic