ID: 1148052651

View in Genome Browser
Species Human (GRCh38)
Location 17:44776726-44776748
Sequence GGCACTGTGGAGAGAGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 588}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052651_1148052663 25 Left 1148052651 17:44776726-44776748 CCCACCCCTCTCTCCACAGTGCC 0: 1
1: 0
2: 3
3: 58
4: 588
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1148052651_1148052658 -2 Left 1148052651 17:44776726-44776748 CCCACCCCTCTCTCCACAGTGCC 0: 1
1: 0
2: 3
3: 58
4: 588
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052651_1148052661 2 Left 1148052651 17:44776726-44776748 CCCACCCCTCTCTCCACAGTGCC 0: 1
1: 0
2: 3
3: 58
4: 588
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052651 Original CRISPR GGCACTGTGGAGAGAGGGGT GGG (reversed) Exonic
900389149 1:2426609-2426631 GGCACTCTGGAGACAGAGGGAGG - Intronic
900625350 1:3605965-3605987 GGCACTGTCCCGGGAGGGGTTGG - Intronic
901185968 1:7373425-7373447 GGCACTGTGCGCAGATGGGTGGG + Intronic
901302592 1:8210408-8210430 GGCACTGTGCCGAGAGATGTGGG + Intergenic
901873018 1:12149314-12149336 GTAACTGTGGTGAGAGGGTTGGG + Intergenic
902187665 1:14737458-14737480 GGCTCTAAGGGGAGAGGGGTTGG + Intronic
902211486 1:14907860-14907882 GGCTCTGGGGAGAGAAGGGTTGG - Intronic
902379989 1:16048324-16048346 GGCCCTGCAGAGAGAAGGGTGGG - Exonic
902404552 1:16175628-16175650 GGGACTGTGGAGGGTGGGATGGG - Intergenic
902972418 1:20063407-20063429 GAAACTGTGGGGAGAGGGATGGG + Intronic
903054367 1:20625274-20625296 GGCAGTTTGGGGAAAGGGGTGGG + Intergenic
903066308 1:20701627-20701649 GGAACTGAGGAGAGGTGGGTGGG + Intronic
903293986 1:22332182-22332204 AGGACTGGGGAGAGAGGGGTGGG - Intergenic
903858793 1:26353030-26353052 GGCCCTGTGCAGAGAGTGGAGGG - Intronic
903996313 1:27307319-27307341 TGCTCTGAGGGGAGAGGGGTGGG + Exonic
904770993 1:32881394-32881416 GGCACTGTGGAGAAGAGGGCAGG + Intergenic
904826254 1:33275804-33275826 AGCACTGGGGTGATAGGGGTGGG + Intronic
904999073 1:34654034-34654056 GGTATTGTGGGGAGAGGGGCAGG - Intergenic
905201184 1:36318224-36318246 GGGACTGTGGGGAAAGGGGTAGG + Intronic
905519426 1:38586755-38586777 GGCACAGTGGAGCACGGGGTGGG + Intergenic
905695220 1:39968737-39968759 GGCACTGAGGTGAGTGGGGAGGG + Exonic
905796284 1:40818400-40818422 GGGACTGGGGAGGGAGGGGGAGG - Intronic
907045111 1:51295968-51295990 GGCACTGGGGAGGGAGGAGTAGG - Intronic
907523522 1:55040229-55040251 AGCACGGTGGAGAGCGGGGACGG + Intronic
908260567 1:62336847-62336869 GGCACTGTAGAGCGGGTGGTGGG + Intergenic
908745806 1:67375508-67375530 GGCACTTTCTAGAGAGTGGTAGG + Intronic
909151413 1:72010611-72010633 GGGAGAGTGGAGAAAGGGGTTGG - Intronic
909533037 1:76702020-76702042 GGCCCAGCGGAGAGGGGGGTGGG + Intergenic
910333724 1:86105111-86105133 GGCAGTGTTGACACAGGGGTGGG + Intronic
910793039 1:91070739-91070761 GGCACGATGGAGAGAGGGAGGGG + Intergenic
912174439 1:107139964-107139986 GGGACAGAAGAGAGAGGGGTGGG + Intergenic
912192033 1:107352016-107352038 GGCACAGTGGTGCAAGGGGTGGG + Intronic
912449134 1:109758804-109758826 GGCAGGGTGGAGTCAGGGGTGGG - Intronic
913120292 1:115734047-115734069 AGCACAGGTGAGAGAGGGGTTGG + Intronic
913498761 1:119451535-119451557 GGTACTGGCGACAGAGGGGTGGG + Intergenic
914795966 1:150920694-150920716 AGAAGTGTGAAGAGAGGGGTGGG + Intergenic
915087993 1:153401330-153401352 GGTGCTGTGGAGAAAGGGGGCGG + Intergenic
915177401 1:154027561-154027583 GGCACTCTGGATAGAAGAGTTGG + Exonic
915331876 1:155117740-155117762 GAGACAGTGCAGAGAGGGGTGGG - Intergenic
915532490 1:156510800-156510822 GGCACTGTGGAGGAGGGGCTGGG - Intergenic
915629825 1:157144291-157144313 GGCAGTGGGGAGAGGGGAGTGGG + Intergenic
915926428 1:160023850-160023872 GGCAGTGCGGAGAGTGGAGTAGG - Intergenic
915932769 1:160070226-160070248 GGCGCTGCGGAGGGAGGGGGCGG - Exonic
915973779 1:160371657-160371679 GGCCCTGGGGAGGCAGGGGTTGG + Exonic
916016727 1:160756332-160756354 GGTTCTGAGGAGAGAGGGGAAGG - Intergenic
916131800 1:161617371-161617393 GAGACTGTGGGGAGAGGGGGAGG + Intronic
916206373 1:162319660-162319682 GGCACTGAGGACAGTGGGGAGGG - Intronic
916510606 1:165469461-165469483 GGCATTGGGGAGAATGGGGTTGG - Intergenic
916609264 1:166374333-166374355 AGCACTGTGGCCAGAGGGCTGGG - Intergenic
916941397 1:169682308-169682330 AGCTCTGTGGCGGGAGGGGTAGG - Intronic
917371588 1:174299366-174299388 GGGACTGTGTAGACAAGGGTAGG + Intronic
917559885 1:176139378-176139400 GCCACTGTGGAGACCGGAGTTGG + Intronic
918162841 1:181917384-181917406 GGCATTGGGGATGGAGGGGTGGG + Intergenic
918320649 1:183360963-183360985 TTAACTCTGGAGAGAGGGGTTGG - Intronic
920079136 1:203359635-203359657 GGGCCAATGGAGAGAGGGGTAGG - Intergenic
920258606 1:204673912-204673934 GGTCCTGTGGGGAGAGGGGTGGG - Intronic
920857105 1:209671967-209671989 GGCACTGGGTGGAGAGTGGTGGG + Intergenic
921470852 1:215547548-215547570 GGCACTGTTCAGAGATGTGTGGG + Intergenic
924119911 1:240785659-240785681 GACATGGTGGAGAGAGGGATGGG + Intronic
924152836 1:241146063-241146085 AGCTCTGTGGAGAGTGGGGGTGG + Intronic
924875852 1:248103485-248103507 GGCAGTGAGCAGAGAGGAGTAGG + Intergenic
1062834144 10:624887-624909 CGCACTGGGGACAGAGGGGTGGG + Intronic
1062986381 10:1773019-1773041 GTCAGTGTGGATAGAGGAGTAGG - Intergenic
1063311718 10:4958493-4958515 GGCACACTGGTGACAGGGGTAGG - Intronic
1063316076 10:5007977-5007999 GGCACACTGGTGACAGGGGTAGG + Intronic
1063778587 10:9293565-9293587 GGGTCTGTGGGGAGAGGGGCAGG + Intergenic
1063972897 10:11393721-11393743 GGCACGGTGGAGAAAGGAGCGGG + Intergenic
1064102783 10:12477663-12477685 GAGACTGTGGAGGGAGGGGCAGG + Intronic
1064323902 10:14330980-14331002 AGCCCTGTGGAGAGATGGGAGGG - Intronic
1064837826 10:19554544-19554566 GGGCCTGTGGGGAGTGGGGTTGG - Intronic
1065486000 10:26237105-26237127 GGCACGGGGGAGAGAGCAGTGGG + Intronic
1066705720 10:38175598-38175620 GGCATTGTGAAGTGTGGGGTGGG + Intergenic
1066984722 10:42454762-42454784 GGCACTGTGAAGTGTGGGGCGGG - Intergenic
1067370571 10:45678400-45678422 GGCATTGTGAAGTGTGGGGTGGG + Intergenic
1067389210 10:45847756-45847778 GGCATTGTGAAGTGTGGGGTGGG - Intronic
1067445047 10:46336793-46336815 GGCATTGTGAAGTGTGGGGTGGG + Intergenic
1067502263 10:46816085-46816107 GGCATTGTGAAGTGGGGGGTGGG + Intergenic
1067592325 10:47523935-47523957 GGCATTGTGAAGTGTGGGGTGGG - Intronic
1067639441 10:48032008-48032030 GGCATTGTGAAGTGTGGGGTGGG - Intergenic
1067874054 10:49988297-49988319 GGCATTGTGAAGTGTGGGGTGGG + Intronic
1069721366 10:70551580-70551602 GGCTCTGGGGAGTGAGGGGCAGG - Intronic
1069822988 10:71239109-71239131 GGCACTGTGGGGGCAGAGGTTGG - Intronic
1070136428 10:73698158-73698180 GGCATTGTGAAGTGTGGGGTGGG - Exonic
1072114085 10:92352136-92352158 GGCACTGTGCAGAGTGCTGTAGG + Exonic
1072237096 10:93462887-93462909 GGTAATGTGGAGAAAGGGGAGGG - Intronic
1073847466 10:107574159-107574181 GAAACTGTGGAGGGAGGGGAGGG + Intergenic
1074140603 10:110668735-110668757 AGGACTGTGAAGAGAGGGGAGGG + Intronic
1076201633 10:128563608-128563630 TGCACTGTGGTGAATGGGGTGGG - Intergenic
1076790534 10:132774825-132774847 GGCACGGAGGAGAGAGGGGTAGG + Intronic
1076790565 10:132774912-132774934 GGCACGGAGGAGAGAGGGGTAGG + Intronic
1076790621 10:132775056-132775078 GGGACGGAGGAGAGAGGGGCAGG + Intronic
1076790651 10:132775129-132775151 GGCAGGGAGGAGAGAGGGGCAGG + Intronic
1076868061 10:133178954-133178976 GTCCCTGTGGACAGAGAGGTGGG + Intronic
1076992482 11:282656-282678 GGCACTGTGAGGAGCAGGGTGGG + Intronic
1077077746 11:708996-709018 GGTGCTGTGGGGAGGGGGGTGGG - Intronic
1077223385 11:1427120-1427142 GGCTGTGGGGAGAGAGGGGATGG - Intronic
1077251548 11:1563053-1563075 GGCACGGTGGGGTGAGGAGTAGG - Intronic
1077313350 11:1903307-1903329 GGAGCTGTGGAGCGGGGGGTGGG + Intergenic
1077471906 11:2767699-2767721 GGCACTGTGGAGAGAAGCTTTGG - Intronic
1077844587 11:6011769-6011791 GGCACAGAGCAGTGAGGGGTGGG + Intergenic
1077906868 11:6541094-6541116 GGCACTGTGTGGAGAGAGGGAGG + Intronic
1077947754 11:6920815-6920837 GGCACTGTGGAGAGAGGACTTGG + Intergenic
1078096550 11:8300825-8300847 GGCACTGGGGGCAGAGGGGCTGG - Intergenic
1078335081 11:10456811-10456833 GACACTCTGGAGGGACGGGTTGG + Intronic
1078550079 11:12274137-12274159 GACACTGTGGAGAGGGAGGAGGG + Intergenic
1078902061 11:15650801-15650823 GGCACTGTGCAGTGAGGGGGTGG + Intergenic
1079345695 11:19650290-19650312 GGCCCTGTGGAGACAGAGGCAGG + Intronic
1079601507 11:22316646-22316668 GGCACAGGGGAGAGAGAGGCGGG - Intergenic
1081596127 11:44460830-44460852 GGCACTGTGAAGAGAGTGGGAGG - Intergenic
1081677195 11:44977202-44977224 GGCATTGAGCAGAGAGGGGAAGG - Intergenic
1081836916 11:46163344-46163366 GGCCCTGAGGTGGGAGGGGTAGG - Intergenic
1082648416 11:55756713-55756735 GGCCCTGTGGAGATAGAGGTAGG - Intergenic
1083420812 11:62552038-62552060 GGGACTGTGGAGAGAAGGGAGGG - Intronic
1083484525 11:62975099-62975121 GGCAATCTGGAAAGAGAGGTTGG - Intronic
1084066191 11:66705645-66705667 GGCACTGGAGAGGGAGGGGCTGG - Intronic
1084798560 11:71526082-71526104 GGTACACTGGAGTGAGGGGTGGG - Intergenic
1085046568 11:73356954-73356976 GGCACTATGGGCAGGGGGGTGGG + Intronic
1085145508 11:74192142-74192164 GGCACACTGGTGTGAGGGGTGGG - Intronic
1085152604 11:74264235-74264257 GGTACTGTGGAAAGTGAGGTAGG - Intronic
1085255018 11:75167603-75167625 GGCACTGGGGACACAGGGATGGG + Intronic
1085320488 11:75570951-75570973 GGCTGTCTGGAGAGTGGGGTGGG + Intronic
1088511341 11:110578982-110579004 GGGCCTGAGGAGAGAGGGGAAGG - Exonic
1088877248 11:113946167-113946189 GGCACTTAGGAGAGAGAGGAGGG + Exonic
1089301471 11:117501582-117501604 GTCACTGGGGAGAGTGGGGCCGG + Intronic
1089346122 11:117792861-117792883 GGCACTGGGGATATTGGGGTAGG - Intronic
1089787707 11:120920057-120920079 GGCAGTGTGAGGACAGGGGTGGG - Intronic
1089973875 11:122716038-122716060 GGGACTGTGGAGAGAGGACGAGG + Intronic
1090242188 11:125192062-125192084 GGCACTGTGAAGAGATGTGAGGG + Intronic
1090515201 11:127417648-127417670 GGTACTGGGGAGTGAGGTGTGGG - Intergenic
1091397554 12:163235-163257 GGTTCTGTGGAGGGAGGGGAGGG - Intronic
1091397568 12:163267-163289 GGTTCTGTGGAGGGAGGGGAGGG - Intronic
1091397582 12:163299-163321 GGTTCTGTGGAGGGAGGGGAGGG - Intronic
1091669605 12:2443364-2443386 GGCACACTGGTGTGAGGGGTGGG + Intronic
1091775294 12:3181049-3181071 GTCACAGTGGAAAGATGGGTGGG + Intronic
1092280488 12:7094167-7094189 GGCAGAGTGGAGACAGGGCTGGG - Intronic
1092388635 12:8055335-8055357 GGGACTGAGGAGAGAAAGGTTGG - Exonic
1092697465 12:11189622-11189644 GTCTTTGTGGAGAGAGGGGATGG - Intergenic
1092825699 12:12396430-12396452 GGCCCTGCGGAGGGTGGGGTGGG + Intronic
1092828033 12:12415544-12415566 GAGACCGTGGAGAGAGGGGGAGG + Intronic
1094035484 12:26065818-26065840 GGTACTGTGGAGAGGGGAGAAGG - Intronic
1094486554 12:30930025-30930047 GAGACTGTGGAGAGAAGGGTCGG + Intronic
1094777366 12:33745988-33746010 GGCAGTGTGGAGAGAAATGTGGG + Intergenic
1095620774 12:44250837-44250859 GGCAGTGTGGGGCGAGGGGAGGG + Intronic
1096693377 12:53334538-53334560 GGCACTGGGAAGAGAGATGTGGG + Intronic
1096693539 12:53335267-53335289 GGGAGTGAGGAGAGAGGGGTGGG - Intronic
1096775014 12:53958303-53958325 TGCACTAGGGAGAGTGGGGTGGG - Exonic
1099328201 12:81246279-81246301 AGCTCTGTAGAGAGAGGGGTGGG + Intronic
1099635543 12:85206620-85206642 GGCACAGAGGAGAGTGAGGTTGG + Intronic
1100445534 12:94656436-94656458 GGCACTGGGGGGGGGGGGGTAGG + Intergenic
1101565077 12:105897293-105897315 GGCAGTTTGGGGAAAGGGGTGGG + Intergenic
1102426180 12:112846066-112846088 GGCAATGAGGACAGAGGGGCAGG + Intronic
1102933443 12:116879217-116879239 AGAACTGTGGAGAGAGGGCTGGG - Intronic
1102980571 12:117237802-117237824 GGCACTGGTGAGAGAGGGGAAGG + Intronic
1103023469 12:117555107-117555129 GGCACTGCTGGGTGAGGGGTAGG - Intronic
1103409408 12:120700162-120700184 GGCACTGTGCTGACCGGGGTGGG - Exonic
1104050922 12:125193202-125193224 GCAACTGTTGAGTGAGGGGTAGG + Intronic
1104640742 12:130465320-130465342 GGCGCTGTGGAGAGAAGGCGAGG + Intronic
1104849024 12:131862313-131862335 GGCACTCTGGAGGCAGGGGCTGG + Intergenic
1104957725 12:132474621-132474643 GGCACCGCGGAGGGAGGGGAAGG - Intergenic
1104958031 12:132475335-132475357 GGCACCGCGGAGGGAGGGGGAGG - Intergenic
1105646978 13:22331297-22331319 GGCACTATTTAGAAAGGGGTGGG + Intergenic
1106321917 13:28647993-28648015 GGCAGTGTGGAGAGTGTGGGAGG + Intergenic
1106552053 13:30780572-30780594 GGCACACTGGTGAAAGGGGTAGG - Intergenic
1106662170 13:31810982-31811004 GGCACAGTGGTGTGAGGGGTGGG - Intergenic
1106783400 13:33082911-33082933 GGTACTCAGGAGAGTGGGGTGGG + Intergenic
1108772640 13:53723369-53723391 TGTACTGTGGGGTGAGGGGTGGG - Intergenic
1109384332 13:61607776-61607798 GGCACACTGGTGTGAGGGGTAGG + Intergenic
1109606422 13:64703976-64703998 GTCATTGTGTAGAAAGGGGTGGG - Intergenic
1110601385 13:77378219-77378241 GGCTCTGTAGAGAGAGAGTTGGG - Intergenic
1111117807 13:83803844-83803866 GCCACTGAGGAGACTGGGGTGGG + Intergenic
1111141602 13:84127005-84127027 CACAATGTGGTGAGAGGGGTAGG + Intergenic
1111645663 13:91028965-91028987 AGCACTGTGGAGAGAGAAGCAGG + Intergenic
1112609985 13:100946486-100946508 GGCGCTGAGGAGACAGTGGTGGG - Intergenic
1113443986 13:110351648-110351670 GGCACTGTGGACAAAGGGAAGGG - Intronic
1113783087 13:112987669-112987691 TGCACGGTGGTGAGAGGGTTGGG + Intronic
1113903087 13:113807175-113807197 GGCTTTGTGGAGGGAGGGGCTGG + Intronic
1114666122 14:24378070-24378092 AGCTCTTTGGAGAGATGGGTTGG + Exonic
1115466202 14:33717066-33717088 GGCACTGAGTAGAGAGGGAATGG + Intronic
1115990325 14:39143661-39143683 AGCACTTTGGAGGGAGAGGTGGG + Intergenic
1116255368 14:42548056-42548078 GGCACACTGGTGTGAGGGGTGGG + Intergenic
1116362354 14:44015774-44015796 GGCATTGTGGAGAGAGAGGAGGG + Intergenic
1116940815 14:50789140-50789162 GGCAATGTGGAAAGAGGGACTGG - Intronic
1117297767 14:54394724-54394746 GGCAGTGTGGAGAGAGAGGGAGG - Intergenic
1117378995 14:55141244-55141266 GGCTGTGTGGAAAGATGGGTTGG - Intronic
1117440335 14:55753569-55753591 TGCACTGTGGAGGGGGGGGCTGG - Intergenic
1119092627 14:71799030-71799052 GGAAGTGTGGAGAGAGGAGATGG + Intergenic
1119123341 14:72100095-72100117 GGGACGGTGAAGAGAGGGGTAGG + Intronic
1120437112 14:84495408-84495430 GGCACTCTGGTGTGAAGGGTGGG - Intergenic
1120574157 14:86160272-86160294 GGCAATGTTTAGTGAGGGGTAGG - Intergenic
1121011407 14:90522316-90522338 GGCACTGTGCTGAGTGAGGTGGG + Intergenic
1121208890 14:92191596-92191618 GGCACTGTTGTGAGAGGGTCAGG + Intergenic
1121705938 14:95993792-95993814 GGCACTGTGGAGCGGGGTGATGG - Intergenic
1121711600 14:96042825-96042847 GGCACTGTGTGGAGTGGGGCTGG - Intronic
1122031578 14:98916162-98916184 GGCACTGCTGGGAGAGGGCTGGG - Intergenic
1122255148 14:100471045-100471067 GCCACAGTGGAGAGTGTGGTGGG + Intronic
1122436624 14:101705716-101705738 GGCCCTGGGGAGAGAGAGGGCGG + Intergenic
1122800770 14:104228511-104228533 GGCAGTGGTGAGGGAGGGGTGGG - Intergenic
1122922553 14:104886021-104886043 GGCCCTGTGGAGAGGAGGGTGGG - Exonic
1124429260 15:29592226-29592248 GGCACAGATGAGAGATGGGTTGG - Intergenic
1124896933 15:33785986-33786008 GGGACTGGGGAGAAAGGGGTCGG - Intronic
1125306665 15:38325078-38325100 AGCACTGTGGGGAGGTGGGTGGG - Intronic
1126345293 15:47687247-47687269 GGCACTATGGATACAGTGGTGGG + Intronic
1126698913 15:51350335-51350357 GGTCCTGTGGGGTGAGGGGTTGG + Intronic
1127395813 15:58543221-58543243 GGCAGTGTGAAGGGTGGGGTTGG - Intronic
1127503382 15:59575487-59575509 GGCATTGAGGAGAGGAGGGTAGG - Intergenic
1127528317 15:59816217-59816239 GGCCCTGTGGAGACAGGGAGTGG - Intergenic
1127855171 15:62948206-62948228 GGCAGTGAGGATAGAGGGGGAGG - Intergenic
1128087278 15:64894810-64894832 GGCCCTGCAGAGAGAGGGGAGGG + Intronic
1128233909 15:66054166-66054188 GGCACTTAGGAGACAGGGGCTGG - Intronic
1128352067 15:66897686-66897708 GGAACTGTGGAGAGGGAGGCTGG - Intergenic
1128608054 15:69052265-69052287 GGCAGTGAGGAGGGAGAGGTTGG - Intronic
1129263316 15:74381045-74381067 GGGTCTGGGAAGAGAGGGGTGGG - Intergenic
1129382811 15:75178552-75178574 GGCACTGTGGGGGGTGGGGCGGG + Intergenic
1129699963 15:77762180-77762202 GGCACAGTGGACCGAGGCGTGGG + Intronic
1130285482 15:82550958-82550980 GGCACTGAGGAGGAAGGGGAAGG + Intronic
1132481637 16:169201-169223 GGAACTGTGGAGAGAGAGTCAGG - Intergenic
1132616338 16:842784-842806 GGCACCGTGGACAGATGGGCGGG + Intergenic
1133356063 16:5137907-5137929 GGGACTGCGGAGAGTGGGGCTGG + Intergenic
1134132252 16:11657681-11657703 GTCACTGTGCAGAGAGGAGCAGG - Intergenic
1134222107 16:12362975-12362997 GGCACAGAGGAGAGATGGGCTGG - Intronic
1135032490 16:19049655-19049677 GACACTGTGGGGTGATGGGTTGG + Intronic
1135551028 16:23398487-23398509 GCCACTGTGTAGAGAGGTGCTGG + Intronic
1136140002 16:28282317-28282339 GGCTCTGGGGAGAGATGAGTGGG + Intergenic
1136392365 16:29973777-29973799 GGCAGTGAGGAGAGAGGGCGGGG + Exonic
1136719628 16:32310006-32310028 GGGACTGGGGAGAGTGGGGGAGG + Intergenic
1136838002 16:33516286-33516308 GGGACTGGGGAGAGTGGGGGAGG + Intergenic
1137394395 16:48106614-48106636 GGCACTGGGGAGATGGGGGCAGG - Intronic
1137587958 16:49675466-49675488 GGCACCGCTGAGGGAGGGGTGGG - Intronic
1138008931 16:53360348-53360370 CTGACTGTGGAGAGAGGGGGTGG - Intergenic
1138090176 16:54167539-54167561 GTCACAGTGGAGAGAAGGGTTGG + Intergenic
1138421547 16:56902503-56902525 GTCAAGGTGCAGAGAGGGGTGGG + Exonic
1138724090 16:59117053-59117075 GGCACTTTGGAGGAAGGGGTGGG - Intergenic
1138986794 16:62338678-62338700 GGAAGTGTGGTGAGTGGGGTTGG - Intergenic
1139646962 16:68338505-68338527 GTCACTGTGGAGAGTGTGGAGGG + Intronic
1140472855 16:75224881-75224903 GGCTCTGTGGGGAGCAGGGTCGG - Exonic
1140826902 16:78715409-78715431 TTCACTGTGGAAAGAGGGGTAGG + Intronic
1141137405 16:81475075-81475097 GGCCCTCTGGAGAGGAGGGTGGG + Intronic
1141219787 16:82058817-82058839 GGCACTGTGGACAGATGGCGGGG + Intronic
1141432470 16:83977558-83977580 GGCTCTGTGGAGGGATGGGTGGG - Intronic
1141434273 16:83990452-83990474 GGCACTGAGGGGAAAGGGGTGGG - Intronic
1141533224 16:84661093-84661115 AGGACTGTGGGGAGAGGGGAGGG - Intronic
1141583593 16:85017996-85018018 GGAACTGTCGAGACACGGGTGGG + Intergenic
1141988052 16:87592866-87592888 GGCACTGTGGGGGAAGGGGGAGG + Intergenic
1203006803 16_KI270728v1_random:207763-207785 GGGACTGGGGAGAGTGGGGGAGG - Intergenic
1203148182 16_KI270728v1_random:1816570-1816592 GGGACTGGGGAGAGTGGGGGAGG + Intergenic
1142904850 17:3034675-3034697 GGCTCTGTGGAGGGTGGGGGTGG - Exonic
1143460596 17:7101128-7101150 GGCACTGGTGGGAAAGGGGTCGG - Intergenic
1143664228 17:8347152-8347174 GGCGCTGTGGAGCAGGGGGTTGG + Intergenic
1144739127 17:17571472-17571494 GGCCAGGTGGAGGGAGGGGTGGG + Intronic
1144767586 17:17740977-17740999 GGCAGTGTGGGGAGAGGGCAGGG + Intronic
1144807814 17:17979228-17979250 GCCACTGTGGAGAGACAGGTCGG + Intronic
1144836381 17:18158651-18158673 CCCACTGTGGGAAGAGGGGTGGG - Intronic
1145208485 17:20996864-20996886 GACAATGTGGAAAGAGGGGGAGG - Intergenic
1145835418 17:27951063-27951085 GGCAAAGGGGAGAGAGGGCTAGG - Intergenic
1147338111 17:39739006-39739028 GGGCCTGGGGAGAGTGGGGTGGG + Intronic
1147834061 17:43317547-43317569 GGCACAATGGAGTGAGAGGTGGG - Intergenic
1147841529 17:43375232-43375254 GGCACAATGGAATGAGGGGTGGG + Intergenic
1148052651 17:44776726-44776748 GGCACTGTGGAGAGAGGGGTGGG - Exonic
1148382575 17:47210372-47210394 GGAACTGGTGGGAGAGGGGTGGG + Intronic
1148567049 17:48639500-48639522 GGCCCAGTGCAGGGAGGGGTGGG + Intergenic
1148605697 17:48927427-48927449 GGCCCTGTGGAGAGGTGTGTTGG - Exonic
1148933383 17:51145298-51145320 GGCACTGTGCAGACTGGGCTGGG + Intergenic
1149403806 17:56326552-56326574 GTCCCTGTGGAGAGAGAGGATGG + Intronic
1150549501 17:66196107-66196129 TGCACTTTGGGGAGAGGGTTTGG + Intergenic
1150732904 17:67711312-67711334 GGCACAGAGGTGAGGGGGGTGGG + Intergenic
1151677423 17:75605845-75605867 GGACCTGTGGGTAGAGGGGTGGG - Intergenic
1151810518 17:76438015-76438037 AGCAGTGTGGACAGAGGAGTGGG - Intronic
1151952816 17:77364585-77364607 GGCAGTGAGGAGAGGGGGGCAGG + Intronic
1152048338 17:77953602-77953624 GGGACTGTGGAAGGAGGAGTAGG - Intergenic
1152262367 17:79274009-79274031 GGCCTTGTGGAGAGACGGTTAGG + Intronic
1152266551 17:79298244-79298266 GGCACTGTGAAGGCATGGGTGGG + Intronic
1152528906 17:80905652-80905674 GGCAATGTGCAGGGCGGGGTGGG - Intronic
1152633116 17:81419552-81419574 GGCCCTGTGGGGAGCGGGGAAGG + Intronic
1152684971 17:81689442-81689464 GGGATTGTGTAGAGAGAGGTGGG + Intronic
1152860983 17:82697213-82697235 GAGACTGTGGAGCGTGGGGTGGG - Intronic
1153624245 18:7008163-7008185 GGCACTGGGGAGAGAGGAAATGG + Intronic
1153801847 18:8678083-8678105 GGCTCTGTGGAGGCAGGCGTCGG + Intergenic
1154139062 18:11807326-11807348 TGGACTGTGGTGAGAAGGGTGGG + Intronic
1154217098 18:12423350-12423372 AGCCCTGTGGAGAGAGGGCCGGG + Intronic
1154426226 18:14274204-14274226 GGCACAGTGGTGTGAGGGCTGGG - Intergenic
1155062733 18:22242854-22242876 GGCACTCTGGAGTGAGGGCAGGG - Intergenic
1157223084 18:45840867-45840889 GGGACTGTGGAGAGATCGGCAGG - Intronic
1157426478 18:47588693-47588715 GGCAATGTGGAGAGGCTGGTGGG + Intergenic
1157601029 18:48893354-48893376 GGCTCTGTTCCGAGAGGGGTTGG + Intergenic
1158462256 18:57656725-57656747 AGTAGTGGGGAGAGAGGGGTGGG + Intronic
1158938014 18:62383042-62383064 GGCAATGTGTGGAGAGGGGGTGG + Intronic
1159425849 18:68285264-68285286 GGCACTGGGGAGGGTGGGGGAGG + Intergenic
1159887622 18:73924141-73924163 GGCTCTGTGGGAAGCGGGGTGGG + Intergenic
1159923482 18:74246996-74247018 GGGGCTGTGGAGATGGGGGTGGG - Intergenic
1160491074 18:79337018-79337040 GGCTCTGGGGACAGAGGGGGAGG - Intronic
1160491112 18:79337260-79337282 GGCTCTGGGGACAGAGGGGGAGG - Exonic
1160941728 19:1623188-1623210 GGCACTGGGCAGAGGGTGGTTGG + Intronic
1161035504 19:2082252-2082274 GGCTCTGTGGACATCGGGGTTGG + Intronic
1161247256 19:3259867-3259889 GGCACTGTGGACATTGGGGCCGG - Intronic
1161265817 19:3363875-3363897 GGCACTGTGGACACTGGGGCTGG - Intronic
1161281164 19:3446477-3446499 GGCACTGTGGACACTGGGGCTGG - Intronic
1161482163 19:4516675-4516697 GCCACTGTGGGGACAGGGGCCGG + Exonic
1161572623 19:5038782-5038804 GGCACTGTGCAGAGCGTGCTGGG - Intronic
1161657094 19:5523068-5523090 GACAGTGTGGAGGGAGGGATGGG - Intergenic
1161745656 19:6058143-6058165 GGCACTGTGGACATTGGGGACGG + Intronic
1162095310 19:8306613-8306635 GGCAGTGGGGAGTGGGGGGTTGG - Intronic
1162147634 19:8622529-8622551 GGGACTGTGGAAGGGGGGGTGGG - Intergenic
1162281462 19:9701253-9701275 GGAACTGTGGGTAGAGGGTTGGG + Intergenic
1162723367 19:12675504-12675526 CACCCTGTGGAGCGAGGGGTAGG - Exonic
1163413579 19:17172181-17172203 GGCTCTGTGCACAGAGGGGTGGG - Intronic
1164723007 19:30445642-30445664 GTCACCGAGGAGAGCGGGGTCGG + Exonic
1165445795 19:35856290-35856312 GGCCGAGTGGGGAGAGGGGTTGG + Intronic
1165481585 19:36067669-36067691 GCCACTCTGGACAGAGGGGCTGG - Intronic
1165863266 19:38920179-38920201 GGCAGCGGGGAGAGAGGGATGGG + Intronic
1166287197 19:41838476-41838498 GGCACAAGGGAGAGAGGAGTGGG - Intronic
1166295379 19:41886874-41886896 GGAGCTGTGGAAAGAGGGGTGGG - Intronic
1166503805 19:43359282-43359304 GGGAGTGGGGAGAGAAGGGTGGG + Intronic
1166506649 19:43375476-43375498 GGGAGTGGGGAGAGAAGGGTGGG - Intergenic
1166718196 19:44982574-44982596 GGCACAGGGGAGAGAGGCTTTGG - Intronic
1166855397 19:45780657-45780679 GGCAGGATGGAGAGAGGGATGGG + Intronic
1166982384 19:46639009-46639031 GGCGCTGCGGAGAGAGGGACAGG + Intergenic
1167744581 19:51342985-51343007 GGCACTGGGGAGCCAGGGGAGGG - Intergenic
1167752320 19:51388492-51388514 GGCAATGAGGAGAAAGGGGTTGG + Exonic
1167784825 19:51628090-51628112 GGCTTTGGGGAGAGAAGGGTGGG + Exonic
1167867874 19:52343000-52343022 GGAATTCAGGAGAGAGGGGTGGG - Intronic
1168063607 19:53907532-53907554 GGCACTGGGGAGAGTTGGGGTGG - Exonic
1168084591 19:54036159-54036181 GGGACTGTGTAGTGAGGGGAGGG + Intergenic
1168166604 19:54552999-54553021 GGCCCTGTGCAGAGAGCGGGTGG - Intergenic
1168643096 19:58042840-58042862 GGCCCTGGTGGGAGAGGGGTGGG - Intronic
925616742 2:5750980-5751002 GGGACTGAGGGGACAGGGGTGGG - Intergenic
926093687 2:10066431-10066453 GGCAATGTTTAGAGTGGGGTCGG - Intronic
926326020 2:11785649-11785671 GGCAGTGGTGAGAGAGGGGGCGG - Intronic
926705463 2:15834395-15834417 GCCACTGGGGAGAGAGGATTGGG - Intergenic
927140214 2:20125060-20125082 GGCACGGTGTACAGAGAGGTGGG + Intergenic
927430779 2:23024745-23024767 GTCGCTGTGGAAGGAGGGGTGGG - Intergenic
927848836 2:26486216-26486238 GGATCTGTGGATAGATGGGTGGG + Intronic
927874909 2:26648784-26648806 GGGGCTGGGGAGAGAGAGGTGGG - Intergenic
927949557 2:27158526-27158548 GGCACAGTGAAGACAGAGGTGGG + Intergenic
928112493 2:28521994-28522016 GGCACTGTGCATGGAGTGGTGGG - Intronic
928897983 2:36286493-36286515 GTAACTATGGTGAGAGGGGTAGG + Intergenic
929518063 2:42622387-42622409 GAGACCGTGGGGAGAGGGGTAGG + Intronic
929571967 2:43028381-43028403 AGCACTGAGTAGAGAGGGGAGGG - Intergenic
929579696 2:43074080-43074102 GGCACTAAGGGGAGAGGGATGGG - Intergenic
930001867 2:46866995-46867017 GGATCTGAGGAGAGAGAGGTGGG + Intergenic
932128573 2:69167405-69167427 GGCCCTGAGGGGAGTGGGGTGGG + Intronic
932876868 2:75461632-75461654 GGCACTGTGGAAAGAGTGAAGGG + Intergenic
933572916 2:84034892-84034914 GGCACTGTGGAGAAAATGGGGGG + Intergenic
933936585 2:87208959-87208981 GGAAGTGAGGAGAGAGGGGAGGG - Intergenic
934037094 2:88097241-88097263 GGCAGTGTGGAGACAGGGCTAGG + Intronic
934546379 2:95220084-95220106 GGCAATGTGTGGGGAGGGGTGGG + Intronic
934708895 2:96502773-96502795 GGCAGTTTGTAGAGAGGGCTCGG - Intronic
936574893 2:113644752-113644774 GGCAGTGTGGGGAGTGGGGGAGG - Intergenic
938563070 2:132491650-132491672 GGCACTGTGGGGAAGGGGTTAGG + Intronic
939241985 2:139572999-139573021 GGCACACTGGAGTGAAGGGTGGG - Intergenic
939586242 2:144009349-144009371 GTCACTGTGGAGACAGGGAGAGG + Intronic
940704396 2:157085684-157085706 GCAACTGTGGAGAGAGGTGATGG - Intergenic
942311544 2:174661380-174661402 GTGGCTGTGGGGAGAGGGGTGGG - Intronic
942862088 2:180627108-180627130 AGCAAGGTGGGGAGAGGGGTTGG - Intergenic
943068518 2:183114288-183114310 TGCACTGTGGAGAGTGGATTAGG + Intergenic
944087276 2:195863824-195863846 GGAACTGTTCACAGAGGGGTAGG - Intronic
945035771 2:205702842-205702864 GACACTGTGGAGGGAGGGAAAGG - Intronic
945328739 2:208514983-208515005 GGCACTCTGAGGTGAGGGGTGGG + Intronic
946034368 2:216730155-216730177 GGCACAGTGGGGTGAGTGGTTGG - Intergenic
946035133 2:216735935-216735957 AGCAGTGTGGAGAGAGGGGAAGG + Intergenic
946075077 2:217067055-217067077 GGGACAATGGAGAGAGGGTTTGG + Intergenic
946149317 2:217753472-217753494 AGCGCTGTGGAGCAAGGGGTGGG + Intronic
946214388 2:218172931-218172953 GGCAAATTGGAGTGAGGGGTTGG - Intergenic
946428907 2:219614277-219614299 GGCTCTGTGGAAAGAGGATTGGG - Intronic
946625813 2:221611190-221611212 AGTACTGGGGAGAGAGGGCTGGG + Intergenic
947344614 2:229177993-229178015 GACACTCTGGAAAGAGGGGAAGG - Intronic
947518126 2:230824529-230824551 GGGACAGTGGAGAGAGGGCTAGG + Intergenic
947762072 2:232610340-232610362 GCCACTGAGGAGAGAGGGCCTGG + Intronic
948156603 2:235788474-235788496 GGCAGGGTGGGGAGAGGAGTGGG + Intronic
948348405 2:237318596-237318618 GGCACTGGGGATGCAGGGGTGGG - Intergenic
948364347 2:237444903-237444925 GGCACCTGGGAGAGAAGGGTTGG + Intergenic
948677561 2:239607721-239607743 GGCACGGGGCAGCGAGGGGTAGG + Intergenic
948865081 2:240771101-240771123 GTCACTGTGGAGAGAGGGTCAGG + Exonic
1168861290 20:1047823-1047845 GCCACTGTGCAGAGATGAGTTGG + Intergenic
1169060904 20:2659790-2659812 CACCCTGTGGAGAGAGGGGCAGG + Exonic
1169083930 20:2815519-2815541 GGGCCTGTGGAGAGAGAGGGTGG - Exonic
1169784908 20:9349294-9349316 AGCGCTGTGGGGAGAGGGGATGG - Intronic
1170149183 20:13210903-13210925 GGCTCTGTGGTAAGAGGAGTAGG - Intergenic
1170433416 20:16297943-16297965 ATCACTGTGGAGAGAATGGTGGG - Intronic
1172093190 20:32447813-32447835 GGCCCTGTGGAGAGGGAAGTAGG + Exonic
1172106241 20:32518777-32518799 GGCAGGGTGGAGAGTGGGGCAGG + Intronic
1172362613 20:34324568-34324590 GACACTGTGGGGAGGGGTGTTGG + Intergenic
1172385281 20:34529870-34529892 GACACTGTGGAGACAGGAGCAGG + Intronic
1172614183 20:36272786-36272808 GGAACGGAGGAGAGATGGGTGGG + Intergenic
1173071535 20:39773187-39773209 CCACCTGTGGAGAGAGGGGTTGG + Intergenic
1173433982 20:43016243-43016265 GGCACTGTGGAGCCAAGAGTGGG + Intronic
1173859601 20:46274226-46274248 GGCAGCATGGAGGGAGGGGTAGG + Intronic
1174378338 20:50140779-50140801 AGCTCTGGGGAGATAGGGGTAGG + Intronic
1174758282 20:53181549-53181571 GGCTCTGAGGAGTGAGGAGTAGG + Intronic
1175304874 20:57969078-57969100 GGGGATGTGGAGAGAGGAGTGGG + Intergenic
1175618619 20:60424382-60424404 GGAGCTGTGGAGAGTGGGGTGGG + Intergenic
1175832732 20:61975670-61975692 GGCAGAGAGGAGAGCGGGGTGGG + Exonic
1175887131 20:62298618-62298640 TGCCCTGTGGAGAGGGGGCTGGG + Intergenic
1176099335 20:63357838-63357860 TGCAGGGTGGAGAGAGGGGTGGG + Intronic
1176156571 20:63625157-63625179 GGAGCTGTGGAGAGAGGAGGGGG - Intronic
1176267889 20:64220269-64220291 GGCACTGTGGAGGCATGGGGAGG + Intronic
1177107007 21:16969337-16969359 GGCACTGGGGGCAGAGGGGAGGG + Intergenic
1177206645 21:18017917-18017939 GGCACAGTGGTGCAAGGGGTAGG - Intronic
1177835682 21:26184224-26184246 GGCACACTGGAGCAAGGGGTGGG + Intergenic
1178261198 21:31101135-31101157 GGCAGTGAGGGGAGTGGGGTTGG + Intergenic
1178582793 21:33850387-33850409 GGCACAGAGGTGAGAGGGGAAGG - Intronic
1178952925 21:36999759-36999781 GGGTCTGTGGGGAGTGGGGTAGG + Intergenic
1179490228 21:41736483-41736505 GGCACTGCAGAGGGAGGGGCAGG - Intergenic
1179645261 21:42771540-42771562 GGCACTGTGGGGAGCGGGGGTGG - Intronic
1180092634 21:45540838-45540860 GTCACTGTGGACAGTGGGGCCGG - Intronic
1180723959 22:17930843-17930865 CGCAGTGTGGAGAGTGGGGCAGG - Intronic
1181362214 22:22346552-22346574 TGCACTGTGGGCAGAGAGGTTGG - Intergenic
1181570995 22:23767795-23767817 GGCCCTGTGGGGAGGGGGTTAGG - Intronic
1181727388 22:24820914-24820936 TGCAGTGGGGAGAGAGAGGTTGG + Intronic
1182330970 22:29551800-29551822 GAGACCGTGGAGAGAGGGGGAGG - Intronic
1182465628 22:30514534-30514556 GTGACTCTGGAGAGAGGGCTGGG + Intergenic
1182652830 22:31865994-31866016 GGCACAGTGGAGAGCTGGGCTGG + Intronic
1184193758 22:42912499-42912521 GCCACTCTGGAGAGGGGAGTAGG - Intronic
1184404397 22:44291947-44291969 GAGACTGCAGAGAGAGGGGTGGG - Intronic
1184474440 22:44712905-44712927 TGCACTGGGAAGGGAGGGGTTGG + Intronic
1184804970 22:46788890-46788912 TCCTCTGTGGAGTGAGGGGTGGG + Intronic
1184895222 22:47402783-47402805 GTGACTGTGGAGAGAGAGGAAGG + Intergenic
1185163524 22:49243960-49243982 AGGACTGGGGAGCGAGGGGTTGG - Intergenic
1185184645 22:49391699-49391721 GGCACCGTGGAGGGAGGGCTGGG - Intergenic
1185373495 22:50471482-50471504 TGCACTGTGGGGAGTGTGGTGGG - Intronic
949587067 3:5451894-5451916 GGGAGTGTGGAGAGAGGAGCAGG - Intergenic
950014595 3:9746746-9746768 GTCACTGTGGAGGCAGAGGTGGG - Intronic
950569346 3:13790608-13790630 GGCAGTGTGGAGGGCGGGGCTGG - Intergenic
950661069 3:14467263-14467285 GACACAGTTGTGAGAGGGGTTGG + Intronic
950767520 3:15284259-15284281 TGCCCTGTAGAGAGAGGGCTTGG - Intronic
950865880 3:16188742-16188764 GGCACTAAGGAATGAGGGGTGGG - Intronic
951663075 3:25092144-25092166 GGCACTTAGGAGAGAGGAGGCGG + Intergenic
952303496 3:32125163-32125185 GGCAATGTGGTGGGAGGGATTGG - Intronic
953463875 3:43103086-43103108 GGTACTGTGCTGAGAGGGTTAGG + Intronic
953720196 3:45348306-45348328 GGCTCTGTGTGGTGAGGGGTGGG + Intergenic
953930282 3:47002580-47002602 GACAATGTGGAGAAACGGGTAGG + Intronic
954002155 3:47566266-47566288 GGGGGTGGGGAGAGAGGGGTGGG + Intronic
954371023 3:50169651-50169673 GGCAATGTTGAGGGAGGGGCTGG - Intronic
955386870 3:58487426-58487448 GGCACTGGGAAGTGAGGGGGAGG + Intergenic
955699471 3:61669795-61669817 GGCACTGTGGACAGCTGGTTGGG + Intronic
955862979 3:63352146-63352168 TGCACTGAGGGGAGAGGGATAGG + Intronic
956610678 3:71119472-71119494 GTCACTGTGGATATAGGGGTGGG + Intronic
956673656 3:71715026-71715048 TGGACTGTGGAGACAGGGTTTGG - Intronic
958720517 3:97837624-97837646 GTCCCTGTGGACAGAGGGTTGGG + Intronic
959245574 3:103863242-103863264 GGCACACTGGTGTGAGGGGTGGG - Intergenic
959261112 3:104081660-104081682 GTCACTGTGGTGGGGGGGGTGGG + Intergenic
960592196 3:119377330-119377352 GGCACAGTGGAGAGAATGATGGG + Intronic
960601865 3:119467097-119467119 GGAAATCTGGAGAAAGGGGTAGG - Intronic
961102664 3:124214883-124214905 AGCCCTGTGGAGAGAGGTCTGGG - Intronic
961384598 3:126516539-126516561 GGCACTGGGGGGAGGGGGGAGGG - Intronic
961570646 3:127796095-127796117 GGCTCTGTGCAGAGAGTGGTGGG - Intronic
961594589 3:128006545-128006567 GGCACTTGGAAGAGGGGGGTGGG + Intergenic
962198236 3:133380954-133380976 ACCACTGTGGAGAGAGGACTGGG - Exonic
963266724 3:143247105-143247127 CTCTCTGTGGGGAGAGGGGTAGG - Intergenic
963545927 3:146658471-146658493 AGCTCTATGCAGAGAGGGGTGGG - Intergenic
965534293 3:169809149-169809171 GGCACAGTGGAAAGAGGTTTTGG - Intronic
966973382 3:185065451-185065473 GGCACTGACGGGAGAGGGGAGGG + Intergenic
967430137 3:189374239-189374261 GGTTCTGTGGAGGAAGGGGTTGG + Intergenic
967921457 3:194617266-194617288 GGCACTGGGCAGAGAGAGGGAGG + Exonic
968132806 3:196201883-196201905 GGGAATGGGGAGAGGGGGGTTGG - Intronic
968286720 3:197513206-197513228 GGCCCTGGGAACAGAGGGGTTGG + Intronic
968503105 4:960275-960297 GGCTCAGTGGGGAGAGGGATGGG + Exonic
968758430 4:2428528-2428550 GGCGCTGTGGGTGGAGGGGTGGG - Intronic
968898618 4:3419969-3419991 GGGCCTGAGGAGAGAGGGGAAGG - Intronic
969997124 4:11324489-11324511 GGCACAGTGGTGTGAGGGATAGG - Intergenic
970608848 4:17707371-17707393 GGCACTGTGGTGAGCCTGGTGGG + Intronic
972391733 4:38619959-38619981 TGCCCTGTGGGGAGTGGGGTGGG - Intergenic
973626521 4:52778167-52778189 TGCACTGTGTTGACAGGGGTGGG - Intergenic
975288027 4:72643070-72643092 GGCAATTTTGGGAGAGGGGTTGG + Intergenic
976482012 4:85556657-85556679 GGCACTGCCGAGTGAAGGGTAGG + Intronic
976621640 4:87134484-87134506 GGCATTGGGGAAAGAGGGGATGG - Exonic
976739503 4:88344047-88344069 GGATCTGTGGAGAGAAGGGGAGG + Intergenic
977786465 4:101040832-101040854 ATCACTGAGCAGAGAGGGGTAGG + Intronic
979076289 4:116275132-116275154 GGCACTGTGGCCAGTGGGGCTGG - Intergenic
979084700 4:116392159-116392181 GGCACGATGGAGTGAGGGGGTGG + Intergenic
979732815 4:124045271-124045293 GCCAGTGAGGAGAGATGGGTTGG + Intergenic
980883524 4:138738785-138738807 GAGACTGTGGGGAGAGGGGGAGG - Intergenic
982740363 4:159051418-159051440 GGCACTGTGGGGAGAGGCATGGG - Intergenic
983398454 4:167233722-167233744 GGCACAGGGGAGAGCAGGGTGGG + Intronic
984754542 4:183313358-183313380 GGCATTGTGGAGAGTGGGCTGGG + Intronic
985103699 4:186482144-186482166 GGCACGGCGGGGAGAGGGGTAGG + Intronic
985307145 4:188555544-188555566 GGAACTGTGGAGAGAGCCGGCGG + Intergenic
985368177 4:189256200-189256222 GGCACTGTGGAAAGAGATTTGGG + Intergenic
985390477 4:189487314-189487336 CGCACTGTGGAGTGTGGTGTTGG - Intergenic
985426833 4:189839616-189839638 GTCTCTGTGGAGAGGGGGTTTGG - Intergenic
985530977 5:433706-433728 GGCACAGCGCAGTGAGGGGTCGG + Intronic
986662270 5:10069747-10069769 GGCATTCTGGAGAGTGTGGTTGG - Intergenic
986736757 5:10673939-10673961 GGGTCTGCGGAGAGAGGGGGTGG + Intergenic
987663241 5:20904689-20904711 GGCACTCTGGTGCTAGGGGTGGG + Intergenic
988759450 5:34297496-34297518 GGCACTCTGGTGCTAGGGGTGGG - Intergenic
989691215 5:44146731-44146753 GGCAAAGTGAAGACAGGGGTAGG - Intergenic
991388535 5:66116959-66116981 GGCACTCAGGAGAAAGGAGTGGG + Intergenic
991917935 5:71623812-71623834 GGAACTGTGGAGAAATGTGTCGG + Intronic
992778920 5:80110720-80110742 GGCCCGGTGGAGAGAGGGATGGG - Intergenic
993496458 5:88615271-88615293 GAGACTGTGGAGAGAGGGAGAGG - Intergenic
994408653 5:99378591-99378613 GACACTGTGGTGAGAGGGTGTGG - Intergenic
994827433 5:104732712-104732734 GGCACTGATGAGAGAGAAGTAGG + Intergenic
995074098 5:107960971-107960993 GGAACTGAGGAGAGGTGGGTAGG + Intronic
995510796 5:112907203-112907225 AGGCCTGTGGAGAGAGTGGTAGG - Intronic
995898845 5:117046223-117046245 GGGCCTGTGGAGACAGGGGCAGG - Intergenic
997410777 5:133689136-133689158 GCCACTGTGGAGAGACTGGGTGG - Intergenic
997843450 5:137263598-137263620 GACACTGTGCAGAGAGAGTTGGG - Intronic
998003134 5:138640128-138640150 GGCACTGTGGGTGGCGGGGTGGG + Intronic
998151119 5:139758114-139758136 TGCACTGGGGAGACAGGTGTAGG + Intergenic
998364069 5:141617759-141617781 GGCTCCCTGGAGAGAGGCGTTGG + Intronic
998599352 5:143569209-143569231 GGCCCTATGCAGGGAGGGGTGGG + Intergenic
998604233 5:143617195-143617217 GGCACGGTGGAGAGAGTGTTAGG + Intergenic
999201777 5:149821816-149821838 GGGACTGTGGACTGAGTGGTCGG + Intronic
999621543 5:153479812-153479834 GGGAATCTGGGGAGAGGGGTGGG - Intergenic
1000110100 5:158099948-158099970 GGGGCTGAGGAGAGAGGGATGGG + Intergenic
1000262331 5:159599978-159600000 GGCACGCTGGTGTGAGGGGTGGG + Intergenic
1000372261 5:160548299-160548321 AGCATTGTGGAGAGAGGGAAGGG + Intergenic
1001237239 5:170040521-170040543 AGAACTCTGCAGAGAGGGGTAGG + Intronic
1001414489 5:171535323-171535345 GGGAATGTGGTCAGAGGGGTAGG + Intergenic
1001453862 5:171846121-171846143 GGCACTGTGGAGTGAGCGCTGGG + Intergenic
1002319733 5:178367872-178367894 GGCGCTGTGGAGAGTGGAGCAGG + Intronic
1002946440 6:1765832-1765854 GGCACAGTGGAGAAAGGTTTAGG + Intronic
1002987291 6:2202808-2202830 ACCACAGTGGAGAGAGGGGATGG + Intronic
1003636129 6:7833030-7833052 TGCAGTGTGGAGAGAGTGGATGG + Intronic
1004163882 6:13238703-13238725 GGCACTTTGGAGCTAGGTGTCGG - Intronic
1004413006 6:15399254-15399276 GGCACTGGGGAAGAAGGGGTGGG - Intronic
1005007953 6:21309127-21309149 GGCAGTGTGGAAAGGGGAGTGGG - Intergenic
1005345922 6:24890495-24890517 GGGACAGTGGGGAGAGGGGAGGG + Intronic
1006277640 6:33018595-33018617 GGCCCTGAGGAGAGAGGAGGTGG - Intergenic
1006439611 6:34045696-34045718 GGCAGTGAAGAGAAAGGGGTAGG + Intronic
1006515718 6:34544564-34544586 GGCCCTGTGGACAGTGGGCTGGG + Intronic
1007144565 6:39615489-39615511 GGGTCTGGGGAGAGTGGGGTGGG - Intronic
1007716847 6:43861781-43861803 GGGACACTGGAGAGAGGCGTGGG - Intergenic
1007751326 6:44073588-44073610 GGCCCTGGAGATAGAGGGGTGGG + Intergenic
1007781019 6:44254815-44254837 GTCACTGTGGTGGGAGGGCTGGG - Exonic
1010548750 6:77192712-77192734 GGCACTGTGAGCAGAGGGGATGG + Intergenic
1010752392 6:79630603-79630625 GCCATTGTGTAGGGAGGGGTGGG + Intergenic
1011465050 6:87646787-87646809 GGCACTCAGGAGAGAGGTATAGG - Intronic
1011750611 6:90451220-90451242 GGCACTAAGGTGAGAGAGGTTGG + Intergenic
1013178816 6:107700787-107700809 TCCACTGGGGAGAGAGGGGAAGG - Intergenic
1014739049 6:125126182-125126204 GGCGCTGTGGAGCAGGGGGTGGG - Intronic
1015078316 6:129191457-129191479 GGCAGTCTGGAGGGTGGGGTGGG - Intronic
1016292850 6:142542696-142542718 GGTACTCTTGAGAGACGGGTTGG - Intergenic
1016501384 6:144724583-144724605 GGAACTGGGGAGGGAGGGGAGGG - Intronic
1016693507 6:146965843-146965865 GGCACACTGGTGAAAGGGGTGGG - Intergenic
1017084531 6:150701602-150701624 GCCACTGTGGGGTGAGGGGAGGG - Intronic
1017724128 6:157265215-157265237 GGCTCTGTTTAGAGAGGGGGCGG - Intergenic
1017726297 6:157278347-157278369 GGCACTCTGCAGCGAGGGCTGGG - Intergenic
1018074597 6:160200675-160200697 GGCACTGTGGGAAGAGAGGTGGG - Intronic
1018632784 6:165835095-165835117 GACACAGTGCAGAGAGAGGTGGG + Intronic
1018930804 6:168239281-168239303 GGCAGTAAGGAGAGAGGGGCTGG + Intergenic
1019049142 6:169169977-169169999 GGCAGTGTGGACTGTGGGGTAGG - Intergenic
1019460219 7:1154262-1154284 GGCAGTGAGGAGAGTGGGGAGGG + Intronic
1019871449 7:3767190-3767212 GTGACTATGGAGGGAGGGGTGGG + Intronic
1020309832 7:6859317-6859339 GACACTCTGGAGACAGGTGTTGG - Intergenic
1020470405 7:8528108-8528130 GGAAGTGGGGAGAGAGGAGTGGG + Intronic
1021628820 7:22623511-22623533 GGCATTGGGGAGGGAGGGGAGGG - Intronic
1021775462 7:24050436-24050458 GGCCCTGTGCAGAGTGAGGTTGG + Intergenic
1022109452 7:27219563-27219585 GGGGCTGTGGAGGGTGGGGTGGG + Intergenic
1022410031 7:30132342-30132364 GTCACAGTGGAGAGAGGGGAGGG + Intergenic
1027266199 7:76496504-76496526 GGCACTATGGAAAGTGGGGTAGG + Intronic
1027317579 7:76994622-76994644 GGCACTATGGAAAGTGGGGTAGG + Intergenic
1028473846 7:91232684-91232706 GGCAGTGGGGCGAGTGGGGTGGG + Intergenic
1029447255 7:100620710-100620732 GGCTCCGTGGAGAGATGTGTAGG + Exonic
1030348032 7:108455569-108455591 GACACGGAGGACAGAGGGGTGGG - Intronic
1030486246 7:110171966-110171988 GGAACTTTGGAGAGACTGGTGGG - Intergenic
1031118106 7:117690034-117690056 GGCATGATGGAGAGGGGGGTAGG + Intronic
1033156275 7:138959839-138959861 AGCACTGTTTAAAGAGGGGTCGG - Intronic
1033548244 7:142421976-142421998 GGAACAGTGGATAGAGGTGTTGG - Intergenic
1033570286 7:142620928-142620950 GGCACTTAGAAGAGAGGGTTGGG + Intergenic
1034277208 7:149829201-149829223 GGGACTGTGGGAAGAGGGGCAGG - Intergenic
1034501948 7:151456421-151456443 GGCACACTGGTGTGAGGGGTGGG + Intergenic
1034982333 7:155487152-155487174 GGGACTGTGGTGAGAGGGTGGGG + Intronic
1035023145 7:155810322-155810344 GGCACTGCGGAGAGAGCGGCGGG - Intronic
1035064880 7:156097145-156097167 AGCCCTGTGGAAACAGGGGTGGG - Intergenic
1035164112 7:156974140-156974162 GCCACAGTGGGGAGAGGGGGAGG - Intergenic
1035965853 8:4190939-4190961 GGCTCAGTGGAGAGTGGGGGGGG + Intronic
1037470950 8:19210265-19210287 GGCACTGTGGAGACTAGGGCAGG + Intergenic
1037605401 8:20433868-20433890 GGGACAGTGGAGGGAGGGGTGGG + Intergenic
1038577455 8:28717295-28717317 GGCACTGTGTGGAGAGCGGGAGG + Exonic
1039407558 8:37326337-37326359 GGCATAGGGGAGAGAGGAGTGGG - Intergenic
1039793763 8:40895620-40895642 GGCAGTGTGGGGGGAGGGGGCGG - Intronic
1040583358 8:48716007-48716029 GGCACTGTGGAGCAGGGGGCAGG + Intronic
1040978356 8:53219006-53219028 TGCACTGTGGAGAGGTGAGTGGG + Intergenic
1041484821 8:58363718-58363740 GGGCCTGTGGAGTGAGGGGAGGG - Intergenic
1041529013 8:58841305-58841327 GGCACTATGAAGGCAGGGGTTGG + Intronic
1042959157 8:74284356-74284378 GGAATTGTGGAGAGAGTGGCTGG + Intronic
1043480442 8:80647318-80647340 GGCACTGCAGAAAAAGGGGTGGG + Intronic
1044164068 8:88958821-88958843 GGAACTATGTAGAGAGAGGTAGG + Intergenic
1044604842 8:94039594-94039616 GGCTCTTTTGAGTGAGGGGTGGG + Intergenic
1044917409 8:97129844-97129866 GGCCCTGGGGAAAGAGTGGTGGG - Intronic
1046069379 8:109232211-109232233 GGCAGTGTGGACAGATGGTTTGG - Intergenic
1047694776 8:127392726-127392748 GGCACTGTGGTGAGAAGGAGTGG + Intergenic
1048065717 8:130966407-130966429 GTCACTGTTAAGAGTGGGGTGGG + Intronic
1048266413 8:132991242-132991264 GCCACTGTGGAGAGTGCTGTGGG - Intronic
1048492771 8:134909920-134909942 GGCACTGGGGTCAGAGGGGGTGG - Intergenic
1048516225 8:135113991-135114013 GGCACAGTGGTGCAAGGGGTGGG - Intergenic
1048848885 8:138625360-138625382 GGCACAGTGGAGGGCAGGGTTGG + Intronic
1049298606 8:141856897-141856919 GGCCCTGGGGAGAAAGGGGCTGG + Intergenic
1049388528 8:142356344-142356366 GGCAGCGTGCAGAGAGGGGAGGG - Intronic
1052754162 9:32523889-32523911 GGCATTGTGGAGAGAGAGGCAGG - Intronic
1052903751 9:33817039-33817061 GGCACGGTGGGGGGAGGGGAGGG + Intergenic
1054469095 9:65519727-65519749 AGACCGGTGGAGAGAGGGGTGGG + Intergenic
1055343282 9:75308520-75308542 GGCAGTGTGGATGGGGGGGTGGG - Intergenic
1055495570 9:76851143-76851165 GGGACTGTGGGGACAGGGGAAGG + Intronic
1055656269 9:78453041-78453063 GGCACTGTGAGGAAAGGGATGGG - Intergenic
1055856285 9:80691886-80691908 GGCACACTGGTGTGAGGGGTAGG - Intergenic
1056296026 9:85193868-85193890 TGCACTGGGGAGAGAGTGGTGGG - Intergenic
1056382046 9:86064554-86064576 GGCCATGTGGGGAGAGGGCTGGG - Intronic
1057813162 9:98273411-98273433 GACAGGGTGGGGAGAGGGGTTGG - Intergenic
1057893802 9:98890220-98890242 GGCACAGGGGAGAGGGGAGTAGG - Intergenic
1058523503 9:105835079-105835101 AGCAGTGTGGAGAGAAGAGTGGG - Intergenic
1059530306 9:115029534-115029556 GGCACTGTGGAGAGAGCATCAGG + Intronic
1060185625 9:121562388-121562410 GAGGCTGTGTAGAGAGGGGTAGG - Intergenic
1060392430 9:123289323-123289345 GGCAGTGGGGAGAGAGGGATGGG - Intergenic
1060549099 9:124476832-124476854 GGACCTGTGGAGTGAGGGGAGGG - Intronic
1060594184 9:124838766-124838788 GGCGCCGTGGAGCGAGGGGGCGG + Intergenic
1061163612 9:128910087-128910109 GGCAGTGTGGATGGAGGGCTGGG + Intronic
1061385439 9:130286769-130286791 GGCACTGGGCAGGGAGGGGCTGG + Intronic
1061507534 9:131039806-131039828 CGCAGTGTGGGGAGCGGGGTGGG + Intronic
1061714724 9:132511469-132511491 GGCACTGGGGAAGGAGGAGTGGG - Intronic
1061755301 9:132808380-132808402 GGCACTGTGGACAGAGGACTGGG - Intronic
1061779574 9:132987665-132987687 GGCACTGTGGAGTGAGGCTGGGG + Intronic
1061996755 9:134190043-134190065 GGCACTGAGCAGAGTGGGATAGG + Intergenic
1062731312 9:138111730-138111752 GGCAGGGTGGATGGAGGGGTGGG - Intronic
1185978623 X:4749862-4749884 GGCAGTTTGGAGGAAGGGGTGGG - Intergenic
1186920366 X:14271970-14271992 GGCACGGTAGGGAGAAGGGTTGG + Intergenic
1187781906 X:22836747-22836769 GGCATTGTGCAGGGTGGGGTTGG - Intergenic
1187843243 X:23510020-23510042 GGCACACTGGTGTGAGGGGTGGG - Intergenic
1188490303 X:30732234-30732256 GGCATTTGGGAGAAAGGGGTGGG + Intergenic
1188910474 X:35840903-35840925 AAGACTGTGGAGAGAGGGGGAGG - Intergenic
1189142747 X:38623897-38623919 GGCACTGAGGGGTGGGGGGTGGG - Intronic
1189436609 X:40998370-40998392 GGCACTGTCCAGAGAGAGGTTGG - Intergenic
1189824091 X:44899180-44899202 GAAACTGTGGAGGGAGGGGGAGG + Intronic
1189955328 X:46271865-46271887 GGAGCTGGGGAGAGAGGGATGGG - Intergenic
1189985009 X:46545777-46545799 GGCCTTGGGGACAGAGGGGTGGG - Intergenic
1190401863 X:50044923-50044945 GGCACTGGGGATACAGTGGTGGG + Intronic
1190417960 X:50199771-50199793 GGGAGTGGGGAGAGAGGGGAGGG - Intronic
1190703535 X:53006192-53006214 GGCACACTGGTGTGAGGGGTGGG + Intergenic
1190771000 X:53513949-53513971 ACCACTGTGGTGGGAGGGGTGGG - Intergenic
1191151467 X:57224307-57224329 GGTATTGTTGAGAGACGGGTTGG - Intergenic
1191884483 X:65874539-65874561 GCCATTGTAGAGAGAGGGGCAGG + Intergenic
1192201310 X:69068449-69068471 GGAGGGGTGGAGAGAGGGGTGGG + Intergenic
1192451881 X:71249922-71249944 GGCCCTGTGGAAAGGGGAGTGGG - Intronic
1192633102 X:72792028-72792050 GTCGCTGTGGAGAGAGAGTTAGG - Intronic
1192648607 X:72928773-72928795 GTCGCTGTGGAGAGAGAGTTAGG + Intronic
1193424721 X:81328083-81328105 GGCACACTGGTGTGAGGGGTGGG - Intergenic
1193466395 X:81852850-81852872 GGCACTGTAGTGTGAAGGGTAGG + Intergenic
1194331557 X:92590169-92590191 GGCAGTTTGGGGAAAGGGGTGGG - Intronic
1195035164 X:100965583-100965605 GGCACTCTGGTGTGAGGAGTGGG - Intergenic
1195964216 X:110415571-110415593 GGTGCTGTGGGGAGATGGGTGGG + Intronic
1196853457 X:119961064-119961086 GTCACTGTGAAGGGAGGGGGTGG - Intergenic
1196997916 X:121404266-121404288 GGCAGTGGGGATAGAGGGGATGG - Intergenic
1198073259 X:133170240-133170262 GGCAGTTTGGGGAAAGGGGTGGG - Intergenic
1198158914 X:133987673-133987695 GACACTGAGGGGAGAGGGCTTGG + Intergenic
1198184190 X:134237542-134237564 GGCAGTGCGGAAAGAGGAGTGGG + Intronic
1198739978 X:139831910-139831932 GGCTGTGTGTAGAGATGGGTAGG - Intronic
1199607421 X:149587179-149587201 GGCACTCTGGAGTGAGAGCTTGG - Intronic
1199631702 X:149782188-149782210 GGCACTCTGGAGTGAGAGCTTGG + Intronic
1199860788 X:151798917-151798939 TGCACTGTGGAGAGGGGTGGAGG + Intergenic
1200640262 Y:5709225-5709247 GGCATTTTGGGGAAAGGGGTGGG - Intronic