ID: 1148052652

View in Genome Browser
Species Human (GRCh38)
Location 17:44776727-44776749
Sequence GGGCACTGTGGAGAGAGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1168
Summary {0: 1, 1: 0, 2: 5, 3: 101, 4: 1061}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052652_1148052658 -3 Left 1148052652 17:44776727-44776749 CCACCCCTCTCTCCACAGTGCCC 0: 1
1: 0
2: 5
3: 101
4: 1061
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052652_1148052663 24 Left 1148052652 17:44776727-44776749 CCACCCCTCTCTCCACAGTGCCC 0: 1
1: 0
2: 5
3: 101
4: 1061
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1148052652_1148052661 1 Left 1148052652 17:44776727-44776749 CCACCCCTCTCTCCACAGTGCCC 0: 1
1: 0
2: 5
3: 101
4: 1061
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052652 Original CRISPR GGGCACTGTGGAGAGAGGGG TGG (reversed) Exonic
900460491 1:2800257-2800279 GGGCACTGAGCAGCGCGGGGAGG + Intronic
900717902 1:4156926-4156948 GGTCACTGGGGAGAAAGGGCTGG - Intergenic
900740407 1:4327565-4327587 GGGCAGTGTGGGGAGAAGGGTGG - Intergenic
900751722 1:4401841-4401863 CGGCACTGTGGGGAGAGCTGAGG + Intergenic
900991366 1:6099821-6099843 GGGCAGAGGGGAGAGAGGGCAGG + Exonic
901302591 1:8210407-8210429 GGGCACTGTGCCGAGAGATGTGG + Intergenic
902290070 1:15429544-15429566 GGGCTCTGGAGAGAGTGGGGCGG + Exonic
902378164 1:16039923-16039945 GGGCACAGGGGAGAGAGGGGTGG + Intergenic
902379990 1:16048325-16048347 GGGCCCTGCAGAGAGAAGGGTGG - Exonic
902384440 1:16068397-16068419 AGACACTGAGGGGAGAGGGGTGG - Intronic
902404553 1:16175629-16175651 GGGGACTGTGGAGGGTGGGATGG - Intergenic
902566368 1:17314253-17314275 GGGCACTGTGGTCAGAGGATGGG - Intronic
902601215 1:17540862-17540884 GGGTTCTGGGGAGAGAGGGCAGG + Intronic
902972417 1:20063406-20063428 GGAAACTGTGGGGAGAGGGATGG + Intronic
903066307 1:20701626-20701648 GGGAACTGAGGAGAGGTGGGTGG + Intronic
903268433 1:22172713-22172735 GGGCACTTCGGAGACAGGGCTGG + Intergenic
903293987 1:22332183-22332205 CAGGACTGGGGAGAGAGGGGTGG - Intergenic
903624649 1:24721809-24721831 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
903662686 1:24988088-24988110 GAGCACTGTGGAGAGCTGAGAGG - Intergenic
903789132 1:25880884-25880906 GGGCACAGAGGTGGGAGGGGAGG + Intergenic
903858794 1:26353031-26353053 TGGCCCTGTGCAGAGAGTGGAGG - Intronic
904006222 1:27364627-27364649 GGGCACTTTTGAGTGAGAGGTGG + Intronic
904614224 1:31741447-31741469 GGGCACTGAGGAGACAGCGGCGG + Exonic
904716564 1:32472240-32472262 GGGCAGTTTGGAGACATGGGAGG + Intronic
905174575 1:36127497-36127519 GGGCACTGCCCAGAGAAGGGAGG + Intergenic
905375681 1:37518579-37518601 GGGCACCGTGGAGTAGGGGGTGG - Intergenic
905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG + Intergenic
905665896 1:39763029-39763051 GGGCCCTGTGGAGAGGGGTCTGG - Intronic
905695219 1:39968736-39968758 AGGCACTGAGGTGAGTGGGGAGG + Exonic
905925935 1:41749810-41749832 GGGCACAGGGGAGAGTGGTGTGG + Intronic
905961422 1:42045633-42045655 GTGGAGGGTGGAGAGAGGGGAGG + Intergenic
906055934 1:42917031-42917053 GGGCACTGCGGAGCAGGGGGCGG + Intergenic
906264866 1:44420996-44421018 TGGCAATGTGGAAAGAGGGAGGG + Intronic
907238483 1:53067427-53067449 GGGCACTGGGGACACAGGTGAGG - Intronic
907303497 1:53502053-53502075 GGGAAATGTGGAGACAGAGGAGG + Intergenic
907462742 1:54614962-54614984 GTGCACAGTGGAGTCAGGGGAGG + Intronic
907664839 1:56425663-56425685 GAGCACTGAGGAAGGAGGGGAGG - Intergenic
907902483 1:58753601-58753623 AGGCACTGGGGAGAGAGCAGTGG + Intergenic
908260566 1:62336846-62336868 GGGCACTGTAGAGCGGGTGGTGG + Intergenic
908291392 1:62670217-62670239 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
908301544 1:62765738-62765760 GTGAACTGTGGGGAGAGGGCAGG - Intergenic
909059127 1:70859125-70859147 GGGCACTGCAGAGAAAGTGGGGG - Intronic
909317979 1:74247933-74247955 GGGCACCGTGGAGCAGGGGGTGG + Intronic
909734188 1:78935402-78935424 GGGGAGTGGGGAAAGAGGGGAGG + Intronic
910793038 1:91070738-91070760 AGGCACGATGGAGAGAGGGAGGG + Intergenic
911150115 1:94590345-94590367 GGGCCCTGGGGAGAGAGGGAGGG - Intergenic
911771414 1:101747314-101747336 AGCCACTGTGGAGAGAGGTATGG + Intergenic
912174438 1:107139963-107139985 GGGGACAGAAGAGAGAGGGGTGG + Intergenic
912192032 1:107352015-107352037 GGGCACAGTGGTGCAAGGGGTGG + Intronic
912312827 1:108640902-108640924 GGGCACCGTGGAGTAGGGGGTGG + Intronic
912315981 1:108667803-108667825 GGGCGCCGTGGAGCAAGGGGCGG - Intergenic
912419495 1:109533388-109533410 GTGCACTCAGGAGAAAGGGGAGG - Intergenic
912752627 1:112298483-112298505 GGGGTCTGTGGAGAGAAGGCTGG - Intergenic
913335172 1:117703216-117703238 GGCCACAGTGGAGGGCGGGGAGG + Intergenic
914986719 1:152464327-152464349 GGGGACTGTGGTGGGGGGGGAGG - Intergenic
915026871 1:152839055-152839077 GGGGACTGTGGTGGGGGGGGAGG - Intergenic
915331877 1:155117741-155117763 GGAGACAGTGCAGAGAGGGGTGG - Intergenic
915849849 1:159309771-159309793 GAGCACTGGGGAGAAAGGTGTGG - Intergenic
916052953 1:161048938-161048960 GGCCAGTGAGGATAGAGGGGAGG - Exonic
916127796 1:161586993-161587015 GGGCAATGTGGAGAAAGTGTTGG - Intronic
916206374 1:162319661-162319683 GGGCACTGAGGACAGTGGGGAGG - Intronic
916652370 1:166843991-166844013 GGCCTCTGTGGAGCGAGGGGAGG + Intronic
916789824 1:168115583-168115605 GGGTATTGTGGAGATGGGGGAGG - Intronic
916939075 1:169661500-169661522 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
917975503 1:180235163-180235185 GCGCACCGGGGAGAGAGAGGCGG - Intronic
918081795 1:181213554-181213576 GGGCACTGGAGAGACAGTGGTGG + Intergenic
919077415 1:192830397-192830419 GGGCAGTGGGGAGCTAGGGGAGG + Intergenic
919204545 1:194405148-194405170 GGGCAATGTGAAGAGATGGTGGG - Intergenic
919237067 1:194859327-194859349 GGGCGCTGTGGAGCTGGGGGCGG - Intergenic
919430580 1:197486858-197486880 GGCCACTGTGGGGATGGGGGTGG - Intergenic
919895582 1:202007961-202007983 AAGCTCTGTGGGGAGAGGGGAGG + Exonic
919915060 1:202133996-202134018 GGGCAGTCTGGAGAGAAGGAGGG - Exonic
920057397 1:203202515-203202537 GGGCAGTGTGGAGAAACTGGAGG - Intergenic
920231195 1:204470972-204470994 GGACAGAGTGGAAAGAGGGGTGG + Intronic
920258607 1:204673913-204673935 TGGTCCTGTGGGGAGAGGGGTGG - Intronic
920498411 1:206471268-206471290 GAGCCCTGAGGAGGGAGGGGAGG + Intronic
920536093 1:206737410-206737432 GGGCAGAGTGGGGACAGGGGAGG + Intergenic
920564640 1:206963717-206963739 GGGCAGAGTGGGGAGAGGAGAGG + Intronic
920665441 1:207959635-207959657 GGGCAGTGCGGTGGGAGGGGGGG - Intergenic
920689701 1:208136535-208136557 GGCATCTGTGGAGAGAAGGGAGG - Intronic
920857104 1:209671966-209671988 GGGCACTGGGTGGAGAGTGGTGG + Intergenic
921217063 1:212946844-212946866 GGGAAATGTGGAGAAAAGGGTGG + Intergenic
921287648 1:213623296-213623318 GGGCACTGTGGGGAGATTTGCGG + Intergenic
921451811 1:215317529-215317551 GTGGAGTGGGGAGAGAGGGGAGG - Intergenic
921793639 1:219318372-219318394 GGGGACTGTGGGGAGGGGTGGGG - Intergenic
921844091 1:219860651-219860673 GGGGGCTGTGGAAAGAGGGAAGG - Intronic
922504009 1:226115929-226115951 GGAGACAGTGGAAAGAGGGGAGG + Intergenic
922542600 1:226430292-226430314 GGGCAGTGTGGTGAGAGAGCTGG + Intergenic
922784471 1:228276209-228276231 GGGCACTGAGGGGAGGAGGGAGG + Intronic
923193409 1:231641982-231642004 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
923219514 1:231880660-231880682 GGGCACCAAGTAGAGAGGGGAGG + Intronic
923424830 1:233858668-233858690 GGGCAGTGTCGGGAGAGGGAAGG - Intergenic
923459251 1:234194433-234194455 GGGGACTCAGGAGAGAGGGTGGG + Intronic
924767657 1:247048570-247048592 TGGTACTGTAGAGAGTGGGGTGG - Intronic
924793046 1:247270490-247270512 GGGGTCTGTGGGGTGAGGGGAGG - Intergenic
924848952 1:247804590-247804612 GGGCAGTGTGGGGCAAGGGGAGG - Intergenic
1062834143 10:624886-624908 CCGCACTGGGGACAGAGGGGTGG + Intronic
1062959417 10:1561622-1561644 GGACCAGGTGGAGAGAGGGGTGG - Intronic
1063300025 10:4842854-4842876 GTGCACTCAGGAGAAAGGGGAGG + Intronic
1063505920 10:6599711-6599733 GGGAACTGAGGAGAGTGAGGAGG + Intergenic
1063611239 10:7563538-7563560 GGGCAGGGTGGAGAGAGCTGAGG + Intronic
1063972896 10:11393720-11393742 GGGCACGGTGGAGAAAGGAGCGG + Intergenic
1064197841 10:13259933-13259955 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1064323903 10:14330981-14331003 CAGCCCTGTGGAGAGATGGGAGG - Intronic
1065110814 10:22437828-22437850 GGGAGGCGTGGAGAGAGGGGAGG + Intronic
1065293241 10:24251724-24251746 GGGCACTGTGGGGAGGTGGAAGG + Intronic
1065330038 10:24586414-24586436 GGGCACTGTGGAAGGAGGGAAGG - Intronic
1065545365 10:26814025-26814047 GGGCACTGGGGAGGTAGGGCGGG - Intronic
1065752130 10:28896853-28896875 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1065802656 10:29366506-29366528 GGGCGCTGTGGAGTAGGGGGTGG - Intergenic
1065895934 10:30163139-30163161 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1065995556 10:31056149-31056171 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1066705719 10:38175597-38175619 GGGCATTGTGAAGTGTGGGGTGG + Intergenic
1066758174 10:38730791-38730813 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1066963511 10:42241925-42241947 GGGGACTGGGGGGAGGGGGGAGG + Intergenic
1066984723 10:42454763-42454785 GGGCACTGTGAAGTGTGGGGCGG - Intergenic
1067053691 10:43039435-43039457 GGGGTCTGTGCAGAGAGAGGAGG - Intergenic
1067102392 10:43342818-43342840 AGGCACTGGGGGGACAGGGGGGG - Intergenic
1067217810 10:44316947-44316969 GGGGACTGTCGAGGAAGGGGAGG - Intergenic
1067370570 10:45678399-45678421 GGGCATTGTGAAGTGTGGGGTGG + Intergenic
1067389211 10:45847757-45847779 GGGCATTGTGAAGTGTGGGGTGG - Intronic
1067416861 10:46109201-46109223 GGGCATTGTGAAGTGTGGGGTGG + Intergenic
1067445046 10:46336792-46336814 GGGCATTGTGAAGTGTGGGGTGG + Intergenic
1067461391 10:46461123-46461145 GGCCACTGTGGGGTGAGGGAAGG - Exonic
1067502262 10:46816084-46816106 GGGCATTGTGAAGTGGGGGGTGG + Intergenic
1067528015 10:47050026-47050048 GAGCACTATGGAGAGTGGTGGGG - Intergenic
1067543481 10:47175146-47175168 GGGCACTTTGGAGACAGGGTGGG - Intergenic
1067592326 10:47523936-47523958 GGGCATTGTGAAGTGTGGGGTGG - Intronic
1067625803 10:47923478-47923500 GGCCACTGTGGGGTGAGGGAAGG + Intergenic
1067639442 10:48032009-48032031 GGGCATTGTGAAGTGTGGGGTGG - Intergenic
1067762082 10:49056110-49056132 GGGCACTGTGGACAGGGAGATGG - Intronic
1067874053 10:49988296-49988318 GGGCATTGTGAAGTGTGGGGTGG + Intronic
1068792321 10:61040941-61040963 GGGTACTGTGGAGCAGGGGGTGG - Intergenic
1068867971 10:61915228-61915250 GCGCACTGGAGAGAGAGAGGTGG + Intronic
1069718947 10:70538080-70538102 GGGCCCGGTGGAAAGAGGTGGGG - Intronic
1069735470 10:70651150-70651172 GGGCAATGTGGAGAGAACAGTGG - Intergenic
1069993025 10:72326281-72326303 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1070136429 10:73698159-73698181 GGGCATTGTGAAGTGTGGGGTGG - Exonic
1070645117 10:78196398-78196420 GGGCAGTGTGGACAGAAGGTGGG + Intergenic
1071163497 10:82778859-82778881 AGGCTCTGTGTAGACAGGGGTGG + Intronic
1072237097 10:93462888-93462910 AGGTAATGTGGAGAAAGGGGAGG - Intronic
1072390201 10:94976607-94976629 GGGTAGTGTGGGGGGAGGGGAGG - Intronic
1072443756 10:95480094-95480116 GGGCAATGTGGAGACAGGGGAGG + Intronic
1072637537 10:97187259-97187281 GGGCAGGGTGGGGATAGGGGAGG + Intronic
1072848102 10:98855327-98855349 GGGGATTGTGGATAGAGAGGAGG + Intronic
1073104883 10:101026905-101026927 AGGCCCTGAGGAGAGAGGGTTGG - Intronic
1073262441 10:102200903-102200925 AGGCACTGTGGAGCAGGGGGTGG + Intergenic
1073339598 10:102735070-102735092 GGGCACTTTGGAGTGGGGGAGGG - Intronic
1073509692 10:104035237-104035259 GGGCACTGTGGAGTGGGATGGGG - Intronic
1073847465 10:107574158-107574180 AGAAACTGTGGAGGGAGGGGAGG + Intergenic
1074098186 10:110331793-110331815 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1074140602 10:110668734-110668756 GAGGACTGTGAAGAGAGGGGAGG + Intronic
1074723595 10:116285106-116285128 GGGAAAGGTGGAGAGAGGAGGGG + Intergenic
1074773080 10:116745780-116745802 GGGCACAGAGGAGAGAGGAGGGG - Intergenic
1074874725 10:117604782-117604804 GTGCCTGGTGGAGAGAGGGGAGG + Intergenic
1074923685 10:118046428-118046450 GGGGAAGGTGGAGACAGGGGCGG - Exonic
1075069425 10:119310934-119310956 GGGCAGTGTGGAAAGAGAAGGGG - Intronic
1075249870 10:120857950-120857972 GGATACTGAGAAGAGAGGGGTGG + Intronic
1075307668 10:121382446-121382468 GGGCACGGTGGAGCAGGGGGCGG - Intergenic
1075476034 10:122734668-122734690 CGGCATTGTGGAGGGAGAGGTGG - Intergenic
1076449571 10:130547382-130547404 GGGCACTGGGGAAAGAGAGTGGG - Intergenic
1076484769 10:130808857-130808879 GGGCACTGTGAGGAGAGGTCAGG + Intergenic
1076606239 10:131691667-131691689 GGCCACCATGGAGATAGGGGAGG - Intergenic
1076614276 10:131745857-131745879 GGCCACGGTGGACAGAGGTGAGG + Intergenic
1076696626 10:132250302-132250324 GGTCACTGCAGAGAGAGGGCAGG + Intronic
1077264048 11:1640290-1640312 GGGCACTGTGGCAAGACGGCGGG + Intergenic
1077278740 11:1732300-1732322 GGGCAGCATGGGGAGAGGGGAGG + Intergenic
1077313349 11:1903306-1903328 GGGAGCTGTGGAGCGGGGGGTGG + Intergenic
1077362471 11:2146815-2146837 AGGCACTGGGGTGACAGGGGAGG - Intronic
1077603278 11:3589007-3589029 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1078442339 11:11378273-11378295 TGGCACTGTGGAGTCTGGGGAGG + Intronic
1078550078 11:12274136-12274158 TGACACTGTGGAGAGGGAGGAGG + Intergenic
1078551817 11:12286267-12286289 GGGCTCTGTGGGGAAAGGGGAGG + Intronic
1078633164 11:13023756-13023778 GGCTACTGTGGAGCTAGGGGCGG + Intergenic
1078730156 11:13966185-13966207 GGGGACTGTGGGAAGAGGGAGGG - Intronic
1079029269 11:16973746-16973768 GGGCAGAGTGGTGACAGGGGAGG - Intronic
1079431003 11:20388026-20388048 GGGCGCTGTGGAGAATGAGGAGG + Exonic
1079444657 11:20547763-20547785 GGAGACCGTGGAGAGAGGGAGGG - Intergenic
1079601508 11:22316647-22316669 AGGCACAGGGGAGAGAGAGGCGG - Intergenic
1079731706 11:23942311-23942333 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1080107453 11:28525830-28525852 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1080481643 11:32657530-32657552 GAGCAGTGTGGAGAAAGGGTGGG - Intronic
1080895522 11:36446272-36446294 GGGGACAGAGGAGAGAGGGCCGG - Intronic
1081035137 11:38134590-38134612 GGGGATTGTGGGGAAAGGGGAGG + Intergenic
1081126887 11:39333102-39333124 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1081539210 11:44017877-44017899 GGGCACTGGGAAGAGAGGGGTGG + Intergenic
1081833836 11:46137061-46137083 GGGGCCTGTGGTGGGAGGGGAGG + Intergenic
1083418765 11:62542021-62542043 GGGCAGTGTGCAGGGAGGAGGGG + Intronic
1083420813 11:62552039-62552061 GGGGACTGTGGAGAGAAGGGAGG - Intronic
1083489092 11:63001661-63001683 GGGGAAAGTGGAGAGAGAGGAGG - Intronic
1083729546 11:64645303-64645325 GGGAACTGGAGAGAGATGGGGGG + Intronic
1083748124 11:64746187-64746209 CGGCACTGGGAAGAGAGGCGTGG + Intergenic
1084240653 11:67817690-67817712 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1084263944 11:67995574-67995596 GGGCACTGGGGGGGGGGGGGCGG - Intronic
1084270226 11:68025568-68025590 GGGCACTGCAGACAGAGTGGAGG - Intronic
1084560846 11:69904802-69904824 GGACACTGTGGGGATGGGGGAGG - Intergenic
1084560916 11:69905026-69905048 GGACACTGTGGGGATGGGGGAGG - Intergenic
1084560959 11:69905162-69905184 GGACACTGTGGGGATGGGGGAGG - Intergenic
1084798561 11:71526083-71526105 GGGTACACTGGAGTGAGGGGTGG - Intergenic
1084803658 11:71564344-71564366 GGGTACACTGGAGTGAGGGGTGG - Intronic
1084898687 11:72293967-72293989 GGGCCCTGGGGAGGGAGGTGTGG + Intronic
1085046567 11:73356953-73356975 GGGCACTATGGGCAGGGGGGTGG + Intronic
1085073554 11:73571236-73571258 GGAGACTGTGGGGAGGGGGGGGG - Intronic
1085127105 11:74009192-74009214 GGGCAGTGAGGTGAGAGGGGAGG + Exonic
1085145509 11:74192143-74192165 GGGCACACTGGTGTGAGGGGTGG - Intronic
1085255017 11:75167602-75167624 GGGCACTGGGGACACAGGGATGG + Intronic
1085259774 11:75197876-75197898 GGGAACTGAGGAAAAAGGGGAGG - Intronic
1085363229 11:75911671-75911693 TGGCACTGTGGTGGGAGGGAAGG + Intronic
1085397763 11:76215632-76215654 GGGCACCACGGAGAGATGGGAGG + Intergenic
1085448633 11:76617443-76617465 GGGCACTGGGGGGACAGGAGCGG + Intergenic
1086599224 11:88612119-88612141 GGGGACTGTGGTGGGATGGGGGG - Intronic
1087486339 11:98763442-98763464 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1087770620 11:102205937-102205959 GGGCTCTGGGGAGCCAGGGGTGG - Exonic
1088530521 11:110803497-110803519 GGGGACTGTGGTGGGGGGGGAGG - Intergenic
1088877247 11:113946166-113946188 TGGCACTTAGGAGAGAGAGGAGG + Exonic
1089302134 11:117505039-117505061 GGGCACTGCAGAAAGAGGGAAGG + Exonic
1090242187 11:125192061-125192083 GGGCACTGTGAAGAGATGTGAGG + Intronic
1090334676 11:125954518-125954540 GGGGAGAGTGGAGAGAGAGGAGG - Intergenic
1090398460 11:126434155-126434177 AGGCTCTGTGCAGAGAGGAGGGG - Intronic
1090515202 11:127417649-127417671 GGGTACTGGGGAGTGAGGTGTGG - Intergenic
1090848384 11:130548938-130548960 GGGTACTGTGGACAGAGAGCAGG - Intergenic
1091233404 11:134002922-134002944 GGGCGCCGTGGAGCGGGGGGCGG + Intergenic
1091252839 11:134158194-134158216 GGGCACAGTGTGGAGCGGGGTGG + Intronic
1091317885 11:134628263-134628285 GGGCACAGTGGAGAAGGGGTGGG - Intergenic
1091397555 12:163236-163258 CGGTTCTGTGGAGGGAGGGGAGG - Intronic
1091397569 12:163268-163290 CGGTTCTGTGGAGGGAGGGGAGG - Intronic
1091397583 12:163300-163322 CGGTTCTGTGGAGGGAGGGGAGG - Intronic
1091648841 12:2294488-2294510 GGGCAGTGGAGAGTGAGGGGCGG + Intronic
1091669604 12:2443363-2443385 GGGCACACTGGTGTGAGGGGTGG + Intronic
1091825923 12:3512648-3512670 GGGCAATGTGGATAGAGAGAAGG - Intronic
1092045488 12:5429746-5429768 TGTCTTTGTGGAGAGAGGGGAGG - Intergenic
1092120323 12:6039029-6039051 GGGAGCTGTGCAGAGAGGCGGGG + Intronic
1092258857 12:6941832-6941854 GGGCACGGTGGGGGGAGGGTGGG - Exonic
1092280489 12:7094168-7094190 GGGCAGAGTGGAGACAGGGCTGG - Intronic
1092834174 12:12472467-12472489 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1093524745 12:20093354-20093376 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1093973009 12:25391756-25391778 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1094496493 12:30992418-30992440 AGGCAGTGTGGAGAGTGGGCAGG - Exonic
1094777365 12:33745987-33746009 GGGCAGTGTGGAGAGAAATGTGG + Intergenic
1094826765 12:34275507-34275529 GGGCACTGTGGACAGAGGAGGGG - Intergenic
1095620773 12:44250836-44250858 GGGCAGTGTGGGGCGAGGGGAGG + Intronic
1096513161 12:52143054-52143076 AGGCCCGGTGGAGAGAGGGTGGG + Intergenic
1096693376 12:53334537-53334559 GGGCACTGGGAAGAGAGATGTGG + Intronic
1096693540 12:53335268-53335290 GGGGAGTGAGGAGAGAGGGGTGG - Intronic
1096775015 12:53958304-53958326 GTGCACTAGGGAGAGTGGGGTGG - Exonic
1096803318 12:54126073-54126095 CGGCTCTGGGGAGAAAGGGGGGG + Intergenic
1097841520 12:64326202-64326224 GGGCACAGGGTAGAGAGGAGGGG + Intronic
1097981478 12:65741555-65741577 GGGAACTGCGGAGAGAGGAGAGG + Intergenic
1098186896 12:67906055-67906077 GGGGACTGTGGTGAGGTGGGGGG + Intergenic
1098271888 12:68777477-68777499 GTGCAGTGTGGGGAGAGGAGTGG - Exonic
1098759289 12:74403274-74403296 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1099192478 12:79574199-79574221 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1099204408 12:79711266-79711288 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1099328200 12:81246278-81246300 CAGCTCTGTAGAGAGAGGGGTGG + Intronic
1099806599 12:87527993-87528015 GGGAAGGGTGGAGAGAGGCGGGG - Intergenic
1100016412 12:90015874-90015896 GGGCAGCTTGGAGAGATGGGAGG + Intergenic
1100498414 12:95147920-95147942 GGGACTTGTGGAGAGAGGGAGGG - Intronic
1100521506 12:95379912-95379934 GGGCACCGTGGAGCAGGGGGTGG - Intronic
1101365225 12:104064527-104064549 GTGCATTGTGGGCAGAGGGGCGG + Exonic
1101565076 12:105897292-105897314 GGGCAGTTTGGGGAAAGGGGTGG + Intergenic
1101734656 12:107453952-107453974 GGGCACTGTTTACTGAGGGGTGG + Intronic
1102004946 12:109583250-109583272 GGGGACTGTGGTGGGATGGGGGG - Intronic
1102189069 12:110972323-110972345 GGGCACTTTGGAGATAAGGAGGG + Intergenic
1102246817 12:111361555-111361577 GGGCACTGTGGTGAGAAGAAAGG + Exonic
1102565409 12:113794381-113794403 GGGCACTGTGCATGGAGAGGAGG - Intergenic
1102933444 12:116879218-116879240 TAGAACTGTGGAGAGAGGGCTGG - Intronic
1103045204 12:117730433-117730455 GGAGACTGTGGAAAGAGGAGAGG - Intronic
1103146095 12:118597209-118597231 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1103536086 12:121634710-121634732 GGAGACTGTGGGGAGAGGGAGGG + Intronic
1103935627 12:124475034-124475056 GGGCTCTGTGGGGTGAGGGGAGG - Intronic
1104714401 12:131006700-131006722 GGGAAATGAGGAGGGAGGGGAGG + Intronic
1104940311 12:132392044-132392066 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1104940324 12:132392073-132392095 GGTCCCTGGGGAGAGCGGGGTGG - Intergenic
1105075410 13:16012219-16012241 GAGCACTTTGGAGAGAATGGTGG + Intergenic
1106221276 13:27748347-27748369 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1106276745 13:28216319-28216341 GGGCAGAGAGCAGAGAGGGGTGG + Intronic
1106394526 13:29367304-29367326 GTGCAGTGTGGGGAGAGGGCAGG + Intronic
1106600511 13:31183085-31183107 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1106617014 13:31339699-31339721 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1106643384 13:31608862-31608884 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1106662171 13:31810983-31811005 AGGCACAGTGGTGTGAGGGGTGG - Intergenic
1106810999 13:33358308-33358330 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1106962440 13:35014750-35014772 GGCCAATGTGGGGACAGGGGCGG + Intronic
1107420332 13:40240110-40240132 GGCCAGTGTGGAGGGAGGGCAGG - Intergenic
1107549231 13:41458845-41458867 GGGCACAGTGGGGACATGGGAGG + Intronic
1107765482 13:43729998-43730020 GGATCCTCTGGAGAGAGGGGAGG - Intronic
1108459107 13:50647349-50647371 GGCACCTGTGGTGAGAGGGGAGG + Intronic
1108550817 13:51542127-51542149 AGGGACTGAGGAGAGAGGGAAGG + Intergenic
1108643928 13:52408108-52408130 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1108751487 13:53452427-53452449 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1109201917 13:59440239-59440261 GGGCGCCGTGGAGAAGGGGGCGG - Intergenic
1109884430 13:68524270-68524292 GGGCACTGCGGAGTAGGGGGTGG - Intergenic
1110940245 13:81340804-81340826 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1111747722 13:92291173-92291195 GGGCACAGTGGAGCAGGGGGTGG - Intronic
1112204004 13:97306135-97306157 GGACACTGGGGAAAGAGGAGAGG - Intronic
1112533120 13:100224082-100224104 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1112679838 13:101751031-101751053 GGGGAGGGTGGAGAGAGGGAGGG + Intronic
1113384167 13:109832994-109833016 GGGGATTGTGGGGCGAGGGGAGG + Intergenic
1113443987 13:110351649-110351671 AGGCACTGTGGACAAAGGGAAGG - Intronic
1113464847 13:110505926-110505948 GGGCACTGGGCACAGAGGAGGGG - Intronic
1113618045 13:111694929-111694951 GGAGACAGTGGAGAGAGGAGAGG - Intergenic
1113618057 13:111694988-111695010 GCGGACAGTGGAGAGAGGAGAGG - Intergenic
1113623578 13:111780190-111780212 GGAGACAGTGGAGAGAGGAGAGG - Intergenic
1113623590 13:111780249-111780271 GCGGACAGTGGAGAGAGGAGAGG - Intergenic
1113714174 13:112491469-112491491 GGGCACATTGGAGTGATGGGAGG - Intronic
1113788466 13:113015209-113015231 GGCCACAGTGGACAGAGGCGTGG - Intronic
1113999355 14:16137065-16137087 GAGCACTTTGGAGAGAATGGTGG - Intergenic
1114649816 14:24277402-24277424 GGGTGCTCTGGGGAGAGGGGAGG + Intergenic
1114689111 14:24563758-24563780 GGGCACACTGGTGTGAGGGGTGG - Intergenic
1115809680 14:37092680-37092702 AGGCACTATGGAAAGTGGGGCGG + Intronic
1116005524 14:39286425-39286447 GGAGACTGTGGAGAGGGGAGAGG + Intronic
1116255367 14:42548055-42548077 GGGCACACTGGTGTGAGGGGTGG + Intergenic
1116362353 14:44015773-44015795 AGGCATTGTGGAGAGAGAGGAGG + Intergenic
1116653815 14:47626840-47626862 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1117082636 14:52167070-52167092 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
1117446106 14:55805133-55805155 GGGGACTGTGGGCAGAGGGAAGG + Intergenic
1117449859 14:55839794-55839816 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1117598843 14:57352828-57352850 GTGCATTGTGGAGGAAGGGGTGG - Intergenic
1118132767 14:62986144-62986166 TGGCTCTGTGGAGAATGGGGAGG - Intronic
1118558866 14:67056757-67056779 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1120437113 14:84495409-84495431 GGGCACTCTGGTGTGAAGGGTGG - Intergenic
1120846040 14:89125963-89125985 GGCCACTGTGCAGAGGAGGGAGG - Intronic
1121268667 14:92622752-92622774 GGGCACAGCAGAGAGAGGGAGGG + Intronic
1121269444 14:92628126-92628148 AGGCACAGTGGAGATAGGGAGGG + Intronic
1121431769 14:93892912-93892934 GGGTACTGGGGAGAGAGGCTCGG - Intergenic
1121732184 14:96194535-96194557 GGGCACTGGTGAGAGACGGTCGG + Intergenic
1122031579 14:98916163-98916185 GGGCACTGCTGGGAGAGGGCTGG - Intergenic
1122179856 14:99947084-99947106 TGGCAAGCTGGAGAGAGGGGCGG - Intergenic
1122255147 14:100471044-100471066 GGCCACAGTGGAGAGTGTGGTGG + Intronic
1122348005 14:101072287-101072309 GGGCACTGTGGAGAGACCCCAGG + Intergenic
1122428408 14:101624741-101624763 GGGTCCTGTGGAGGAAGGGGAGG + Intergenic
1122447913 14:101782257-101782279 GGGGAATGGGGAGAAAGGGGGGG - Intronic
1122447971 14:101782416-101782438 GGGGAATGGGGAGAAAGGGGGGG - Intronic
1122448029 14:101782574-101782596 GGGGAATGGGGAGAAAGGGGGGG - Intronic
1122459524 14:101883757-101883779 GGGAGCTGTGGGGAGAGGGGAGG - Intronic
1122840603 14:104461110-104461132 GGGCGGTGCGGAGAGAAGGGAGG + Intergenic
1122854419 14:104553306-104553328 GGGCCCTGTGGGGTGCGGGGAGG - Intronic
1122862425 14:104588560-104588582 GGGCACTGCGGCCAGAGGGCAGG - Intronic
1122917568 14:104865908-104865930 GGGAAATGAGGAGAGAGGGGAGG - Intronic
1122922554 14:104886022-104886044 AGGCCCTGTGGAGAGGAGGGTGG - Exonic
1123441577 15:20295505-20295527 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1123949080 15:25253226-25253248 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1124003722 15:25780092-25780114 GGGCACTGTAGGGAGTGGGGCGG - Intronic
1124387811 15:29224826-29224848 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1124679405 15:31717382-31717404 GGGAACTGGGGGGCGAGGGGAGG - Intronic
1125480239 15:40074806-40074828 GGGCGCCGTGGAGAAGGGGGCGG + Intergenic
1125491144 15:40149476-40149498 GGACACTGTTGAGAGAAGAGCGG - Intergenic
1125537740 15:40452239-40452261 GGGCACTGAGGAGGCAGGGCTGG + Intronic
1125966237 15:43877563-43877585 GGACAATGGGGAGAGAGGGTGGG + Intronic
1126438695 15:48663841-48663863 GGACAATATGGAGAGAGTGGAGG - Intergenic
1126847211 15:52772021-52772043 GTTCACTGTGGGGAGAGAGGAGG - Intronic
1127271546 15:57406256-57406278 GGGCACTGTGAAGAGGGGACAGG + Intronic
1127520244 15:59736356-59736378 TGGCACTGGGGACAGAGGAGAGG + Intergenic
1127650747 15:61004209-61004231 GGGGGCAGTGGGGAGAGGGGAGG + Intronic
1127734711 15:61830029-61830051 GGCCACTGTGGAGGGAGGAGAGG + Intergenic
1127984829 15:64061213-64061235 GGGCTCTGTGGAGCAGGGGGTGG - Intronic
1128087277 15:64894809-64894831 TGGCCCTGCAGAGAGAGGGGAGG + Intronic
1128151840 15:65368208-65368230 AGGCACTCTGGAGAGAAGAGGGG + Intronic
1128352596 15:66901086-66901108 GGGCAGTGTGGAGTGGGGAGCGG - Intergenic
1128669933 15:69567391-69567413 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1128690265 15:69719333-69719355 GGCCACTGTGGATAGGGGGCAGG + Intergenic
1128813011 15:70585737-70585759 GGGCACTGTGCAGAGACTGGGGG - Intergenic
1129254105 15:74324605-74324627 GGCAACTGTGGAGTGAGGAGGGG - Intronic
1129254472 15:74326419-74326441 GGTTGCTGTGGAGAGAGAGGGGG - Intronic
1129263317 15:74381046-74381068 GGGGTCTGGGAAGAGAGGGGTGG - Intergenic
1129299969 15:74619861-74619883 GGGAAGTGGGCAGAGAGGGGAGG - Intronic
1129382810 15:75178551-75178573 GGGCACTGTGGGGGGTGGGGCGG + Intergenic
1129388168 15:75207129-75207151 GGGCACCGTGGAGTGAGAGGCGG - Exonic
1129661392 15:77554848-77554870 GGGCAGTGGGGAGGGAGGAGGGG + Intergenic
1129777453 15:78246170-78246192 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1130298793 15:82665087-82665109 GGGCACTGTCCATGGAGGGGAGG + Intronic
1130411476 15:83652626-83652648 GGTCAGTGTGGAGACAGGAGAGG - Intergenic
1131032977 15:89201848-89201870 GGGGACGATGGCGAGAGGGGAGG + Exonic
1131059883 15:89398112-89398134 GGGCAGTGGGGTGAGAGGAGGGG + Intergenic
1131087341 15:89588197-89588219 GGAGGCTGAGGAGAGAGGGGAGG + Intronic
1131266563 15:90918859-90918881 GGGCTTTCTGGAGAGAAGGGGGG + Intronic
1131461324 15:92619634-92619656 GGGAACTGTGGGGAGGGAGGGGG - Intronic
1132044253 15:98550040-98550062 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1132404669 15:101535187-101535209 GGGCACTGGGGTGACAGGGCCGG + Intergenic
1132509194 16:328836-328858 GGGGACTGTGCAGAGAGGACAGG - Intronic
1132616337 16:842783-842805 AGGCACCGTGGACAGATGGGCGG + Intergenic
1132671128 16:1102724-1102746 GGGGTCTGTGGAGGGAGGTGGGG - Intergenic
1132671160 16:1102803-1102825 GGGGTCTGTGGAGGGAGGTGGGG - Intergenic
1132684484 16:1156607-1156629 GGGCCCTGCGGAGGGAGGGGAGG - Intronic
1132767085 16:1539888-1539910 GGGCAGTGCGCAGAGAGTGGAGG - Intronic
1132785025 16:1652139-1652161 TGGGGCAGTGGAGAGAGGGGTGG + Intronic
1132841188 16:1979187-1979209 GGGCACGGTGGGGGGAGGGGCGG + Exonic
1132988069 16:2778131-2778153 GAGGGCTGTTGAGAGAGGGGTGG + Intergenic
1133170903 16:3982039-3982061 GGGCACTGAGGCAGGAGGGGAGG + Intronic
1133257375 16:4525545-4525567 GGGCATGGTGGAGAGGGGAGTGG - Intronic
1133626387 16:7574222-7574244 GGCCACTGGGGAGAGTGGGCTGG + Intronic
1133998638 16:10766006-10766028 GGTCACTGGGGACAGAGTGGGGG + Intronic
1135113351 16:19707637-19707659 GTGCACTGTGTAGGGAGGTGGGG - Intronic
1135517218 16:23146226-23146248 GGGCAGTGTGGGGTGGGGGGCGG + Intronic
1136140001 16:28282316-28282338 GGGCTCTGGGGAGAGATGAGTGG + Intergenic
1136187762 16:28598040-28598062 GGGCACAGAGGAGGGAGGAGGGG - Intergenic
1136190237 16:28611034-28611056 GGGCACAGAGGAGGGAGGAGGGG - Intronic
1136346423 16:29679102-29679124 TGGGACTGTGGAGGGAGGGAGGG - Exonic
1136361465 16:29782681-29782703 GGGCACTGTGGTGAGGAGGAAGG + Exonic
1136392364 16:29973776-29973798 CGGCAGTGAGGAGAGAGGGCGGG + Exonic
1136724659 16:32348405-32348427 GGGGACTGGGGGGAGGGGGGAGG + Intergenic
1136842986 16:33554445-33554467 GGGGACTGGGGGGAGGGGGGAGG + Intergenic
1137382976 16:48015618-48015640 GGGGACTGTGGTGAGGTGGGGGG - Intergenic
1137394995 16:48110678-48110700 GGACACTGTGGTGAGAAGGTGGG - Intronic
1137442558 16:48509015-48509037 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
1137587959 16:49675467-49675489 GGGCACCGCTGAGGGAGGGGTGG - Intronic
1138105746 16:54286377-54286399 GGGCAGTGAGGAGCGAGGAGCGG - Exonic
1138463794 16:57171697-57171719 GGGCAGTGTGATGAGAGTGGGGG + Intronic
1138560501 16:57798172-57798194 GGGGCCTGTGGAGAGTGGGCCGG - Exonic
1138657166 16:58498184-58498206 GGGCATTGTGGGCAGAGGGCAGG + Intronic
1138658476 16:58503965-58503987 GGGCCCTGTGGGGAGGGTGGGGG - Intronic
1138724091 16:59117054-59117076 AGGCACTTTGGAGGAAGGGGTGG - Intergenic
1138940897 16:61787930-61787952 GGGGACTGTGGTGGGGGGGGCGG + Intronic
1139125492 16:64072361-64072383 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1139193437 16:64891346-64891368 AGTCACTGTGGCCAGAGGGGTGG - Intergenic
1139246357 16:65448348-65448370 GGGCATCTTGGAGAAAGGGGTGG - Intergenic
1139346120 16:66305016-66305038 GAGCACTGTGGAGAGGGTGCAGG + Intergenic
1139422194 16:66855722-66855744 GGGTGCTGAGGAGTGAGGGGAGG + Intronic
1139430646 16:66909379-66909401 GATCACTGAGGGGAGAGGGGAGG + Exonic
1139442355 16:66974556-66974578 GGGCGCTGTGGAGCAGGGGGCGG - Exonic
1139603105 16:67998543-67998565 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1139646961 16:68338504-68338526 GGTCACTGTGGAGAGTGTGGAGG + Intronic
1139864020 16:70050329-70050351 GGAGACCGTGGAGAGAGGGAGGG - Intergenic
1140215027 16:73000228-73000250 GGGCACTGGAGAGAGGAGGGAGG + Intronic
1140790826 16:78389348-78389370 GGGCTCTGAGAAGAGAGTGGTGG + Intronic
1140980759 16:80106787-80106809 GAGCACAGTGGAGAGTGGAGGGG - Intergenic
1141219786 16:82058816-82058838 AGGCACTGTGGACAGATGGCGGG + Intronic
1141220966 16:82069065-82069087 GGGCCTGGTGGAGGGAGGGGAGG - Intronic
1141432471 16:83977559-83977581 GGGCTCTGTGGAGGGATGGGTGG - Intronic
1141434274 16:83990453-83990475 AGGCACTGAGGGGAAAGGGGTGG - Intronic
1141474951 16:84266642-84266664 AGACACTGTGGAGAGGGGAGGGG - Intergenic
1141533225 16:84661094-84661116 CAGGACTGTGGGGAGAGGGGAGG - Intronic
1141540413 16:84716021-84716043 GAGCACTGTGGCGAGGAGGGTGG + Intronic
1141886501 16:86895860-86895882 AGGCACTGTGCAGTGAGGGAGGG - Intergenic
1142131446 16:88433296-88433318 GGGCACTGTGGAAGGAGGGAAGG + Exonic
1142296914 16:89230217-89230239 GGGCAGAGTGGAGAGGGGCGAGG + Exonic
1203001771 16_KI270728v1_random:169350-169372 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1203133374 16_KI270728v1_random:1705756-1705778 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1203153151 16_KI270728v1_random:1854743-1854765 GGGGACTGGGGGGAGGGGGGAGG + Intergenic
1142505717 17:361921-361943 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1142713277 17:1734946-1734968 CAGCACTGTGCAGAGAGAGGAGG + Intronic
1142889411 17:2933223-2933245 GACCACTGTGGAGTGAGGGAGGG + Intronic
1143018492 17:3904294-3904316 GGGGACTGTGGAGGGACAGGAGG + Intronic
1143617871 17:8064301-8064323 GGACACAGTGGGGAGGGGGGAGG + Intergenic
1144128132 17:12221191-12221213 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1144373046 17:14611203-14611225 AGCCACTGTGGAGAGTGGGAGGG + Intergenic
1144467199 17:15506016-15506038 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1144767585 17:17740976-17740998 AGGCAGTGTGGGGAGAGGGCAGG + Intronic
1144771449 17:17761859-17761881 GGTCACTGAGGAGCGAGGGCAGG + Intronic
1144994992 17:19261739-19261761 GGCCACTGAGGTGAGAGGGTTGG - Intronic
1145050249 17:19654345-19654367 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1146332233 17:31937119-31937141 GGGGAAGGAGGAGAGAGGGGAGG - Exonic
1146955458 17:36934488-36934510 GGTCACGGTGGAGTGTGGGGCGG - Intergenic
1147135359 17:38431049-38431071 GTGCACTGTGGAGCCAGGGTAGG + Intronic
1147307422 17:39573698-39573720 GGGCACTGAGGAGCGGGGGCCGG - Intergenic
1147310934 17:39595870-39595892 GGGCACCAAAGAGAGAGGGGTGG + Intergenic
1147338110 17:39739005-39739027 GGGGCCTGGGGAGAGTGGGGTGG + Intronic
1147373672 17:40011261-40011283 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1147718019 17:42521155-42521177 GATCACTGTGGAGGGAGGCGGGG - Exonic
1147805308 17:43126827-43126849 GGGAAGTGTGGAGGGAGAGGCGG + Intergenic
1147951498 17:44110403-44110425 TGGCACTGTGGTCAGAGGGGAGG - Intronic
1148018657 17:44539654-44539676 GGGCAGTGTGGATCGAGGAGGGG + Intergenic
1148018693 17:44539781-44539803 GGGCAGTGAGGAGACTGGGGAGG + Intergenic
1148052652 17:44776727-44776749 GGGCACTGTGGAGAGAGGGGTGG - Exonic
1148161764 17:45454216-45454238 GGGCACCGTGGAGCGGCGGGGGG - Exonic
1149099212 17:52884008-52884030 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1149478486 17:56983236-56983258 GGGGAATGAGGAGAGAGGAGAGG + Intronic
1149916441 17:60613944-60613966 GGGCACCGTGGAGCAGGGGGTGG - Intronic
1150330469 17:64290175-64290197 GGGCATGGTGGAGAGGGGGAAGG + Intergenic
1150730906 17:67692719-67692741 TGCGTCTGTGGAGAGAGGGGTGG - Exonic
1150732903 17:67711311-67711333 GGGCACAGAGGTGAGGGGGGTGG + Intergenic
1150765005 17:67995702-67995724 GGGCGCTGTGGAGGGCTGGGGGG - Intergenic
1150772330 17:68052199-68052221 GGGCGCCGTGGAGCAAGGGGCGG - Intergenic
1150804561 17:68308945-68308967 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1151310175 17:73287983-73288005 GGACACTGAGGAGCGAGGTGGGG - Intronic
1151431671 17:74067705-74067727 GGGCAGTGTGGAGAGATTGAGGG + Intergenic
1151482798 17:74380137-74380159 CAGCACCGTGGAGAGAGGGCAGG - Intergenic
1151954928 17:77375407-77375429 GAGCCCTGTGGCGGGAGGGGAGG + Intronic
1152096976 17:78278240-78278262 GGGCTCTGTGGTGGGAGGCGGGG - Intergenic
1152266550 17:79298243-79298265 GGGCACTGTGAAGGCATGGGTGG + Intronic
1152300811 17:79494555-79494577 GAGCACTGTGGACACAGGGAGGG + Intronic
1152609444 17:81308351-81308373 GGACACCGTGGAGATGGGGGGGG + Intergenic
1152684970 17:81689441-81689463 GGGGATTGTGTAGAGAGAGGTGG + Intronic
1152790712 17:82277583-82277605 GGGCACTTTGGAGAGGGGCTTGG + Intergenic
1152888171 17:82864819-82864841 GGGCACCGTGGGGACAGCGGGGG + Intronic
1152888186 17:82864857-82864879 GGGCACCGTGGGGACAGCGGGGG + Intronic
1152888200 17:82864895-82864917 GGGCACCGTGGGGACAGCGGGGG + Intronic
1153070431 18:1098559-1098581 GGGCGCTGTGGAGCGGGGAGCGG - Intergenic
1153644006 18:7178699-7178721 GGGCACCGTGGAGCAGGGGGAGG + Intergenic
1154057191 18:11023680-11023702 GGGCACTGTGGAGCAGGGGGCGG + Intronic
1154217097 18:12423349-12423371 CAGCCCTGTGGAGAGAGGGCCGG + Intronic
1154426227 18:14274205-14274227 GGGCACAGTGGTGTGAGGGCTGG - Intergenic
1155062734 18:22242855-22242877 GGGCACTCTGGAGTGAGGGCAGG - Intergenic
1155195398 18:23469383-23469405 GGGGAGAGAGGAGAGAGGGGAGG - Intronic
1155693483 18:28654899-28654921 GGGGACTGGGGAGGTAGGGGAGG + Intergenic
1155999194 18:32366124-32366146 GGGCAGGGTGGAGTGAGGGGAGG - Intronic
1156354249 18:36328119-36328141 GGGCACTGGGGAGAGGGCAGTGG + Intronic
1156805319 18:41172127-41172149 GGGGACTGTGGTGGGATGGGGGG - Intergenic
1157246206 18:46057212-46057234 GGCCCCTGTGGAGGGAGGGAGGG - Intronic
1157417764 18:47520370-47520392 GGGCACTGCGGGGGGGGGGGGGG - Intergenic
1157426477 18:47588692-47588714 GGGCAATGTGGAGAGGCTGGTGG + Intergenic
1157646317 18:49276740-49276762 GGGCACTGTGGAGACATGAAAGG + Intronic
1158460691 18:57643692-57643714 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1158481337 18:57824243-57824265 GGGCACTGGGCAGAGTCGGGAGG - Intergenic
1159169866 18:64752042-64752064 AGGCAATGGGGAGAAAGGGGTGG - Intergenic
1159472894 18:68880028-68880050 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1159887621 18:73924140-73924162 GGGCTCTGTGGGAAGCGGGGTGG + Intergenic
1159923483 18:74246997-74247019 GGGGGCTGTGGAGATGGGGGTGG - Intergenic
1160154428 18:76422709-76422731 GGGCACTGGGGAGGCATGGGAGG + Intronic
1160198606 18:76777572-76777594 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1160585158 18:79909919-79909941 GGGGACTGTGGTGAGATGGTGGG - Intronic
1160820243 19:1054468-1054490 GGGCACTGGGGAGCCATGGGTGG + Intronic
1160890146 19:1373468-1373490 TGGGGCTGTGGAAAGAGGGGAGG - Intronic
1160894968 19:1398040-1398062 GGGCACTGGGGAGCCATGGGAGG + Intronic
1161017066 19:1988292-1988314 GGGCTCTGGGTAGGGAGGGGAGG + Intronic
1161326375 19:3666079-3666101 GGGCAGTGTGGAGGGTGGCGCGG - Intronic
1161369633 19:3903425-3903447 TGGCACCGTGGGGAGAGGTGGGG + Intronic
1161454083 19:4361559-4361581 GGCCAGTGTGGACGGAGGGGCGG + Exonic
1161572624 19:5038783-5038805 GGGCACTGTGCAGAGCGTGCTGG - Intronic
1161657095 19:5523069-5523091 GGACAGTGTGGAGGGAGGGATGG - Intergenic
1161773575 19:6244446-6244468 GCCCACTGTTGAGAGAGGCGGGG - Intronic
1162022612 19:7874521-7874543 GCGCGCTTTGGAGAGAAGGGTGG + Intergenic
1162033530 19:7927326-7927348 GGGCACTGTTGAGAGGGTTGAGG + Intronic
1162072322 19:8161441-8161463 TCCCACTGAGGAGAGAGGGGTGG - Intronic
1162110376 19:8396737-8396759 GGGCCCTGTGGGCAGCGGGGAGG + Intronic
1162153292 19:8660337-8660359 GGGCACTGTAGACACAGAGGGGG + Intergenic
1162311811 19:9912593-9912615 GTGTCCTGAGGAGAGAGGGGAGG - Intronic
1162561299 19:11419364-11419386 GGGCGCTGAGGCCAGAGGGGCGG + Intergenic
1162672206 19:12266558-12266580 GGACACAGTGCAGAGAGGAGAGG + Intronic
1162791826 19:13066967-13066989 GGGAACGGTGGATAGATGGGGGG - Intronic
1163155339 19:15437125-15437147 GGCCACTGTGGAGAGAGGACAGG + Exonic
1163176460 19:15567025-15567047 CGGGACTGAGGAGAGAGTGGAGG - Intergenic
1163413580 19:17172182-17172204 GGGCTCTGTGCACAGAGGGGTGG - Intronic
1163635206 19:18434199-18434221 GAGTACTGCGGAGAGAGGAGGGG - Exonic
1163664764 19:18598129-18598151 GGGCCCTGGGGAGAGGGGAGGGG - Intronic
1164155764 19:22596078-22596100 GCCCACTCTGGGGAGAGGGGCGG - Intergenic
1164659482 19:29949915-29949937 GGAGACTGTGGGGAGACGGGAGG + Intronic
1164746298 19:30617284-30617306 GGGGACTGTGGGGAAAGGGTGGG - Intronic
1164813685 19:31177839-31177861 TAGCACTGCGCAGAGAGGGGAGG + Intergenic
1164908554 19:31986937-31986959 GGGAGCTGTGGAGAGCTGGGAGG - Intergenic
1165095676 19:33408505-33408527 TGGGACTGTGGAGAGAGGGATGG + Intronic
1165362990 19:35348163-35348185 GGGTACTGAGCAGAGATGGGAGG - Intergenic
1165386531 19:35513486-35513508 AGACACTCTGGAGAGAGAGGGGG - Exonic
1166287198 19:41838477-41838499 GGGCACAAGGGAGAGAGGAGTGG - Intronic
1166295380 19:41886875-41886897 AGGAGCTGTGGAAAGAGGGGTGG - Intronic
1166571545 19:43799830-43799852 GGACCCTGGGGAGAGAGGCGTGG + Exonic
1166739107 19:45103484-45103506 GGAGACCGTGGAGAGAGGGAGGG - Intronic
1166742843 19:45124626-45124648 TGGCACTGGGGAGACAGGGATGG - Intronic
1166786469 19:45370275-45370297 GGGCACTGTGGAGGCGGGAGAGG - Intronic
1166976496 19:46608030-46608052 GAGCACTGAGGAGAGAGAGCTGG + Intronic
1167044055 19:47039660-47039682 GGGCACTGGGGAGCCATGGGAGG + Intronic
1167230729 19:48281475-48281497 GGGAAATGTGGACAGAGGGAGGG - Intronic
1167282204 19:48576107-48576129 GGGGGCTGGGGAGAGTGGGGAGG + Intronic
1167285921 19:48598984-48599006 GGGCAATGTGGAGGGTAGGGAGG + Intronic
1167296653 19:48654481-48654503 GGGCACTGAGGAGCCATGGGAGG - Intergenic
1167321235 19:48798361-48798383 GGGCACTGGGGAGCCATGGGAGG - Intronic
1167467319 19:49657266-49657288 GGGCACTGGGGAGTGGGGGTGGG - Intronic
1167471165 19:49677222-49677244 GGGGAGTGAGGAGAAAGGGGGGG + Intronic
1167599363 19:50445373-50445395 AGGCAGTGAGGAGAGAGAGGAGG - Intronic
1167631986 19:50631042-50631064 GGGCACTGAGGAGCCATGGGAGG - Intronic
1167744582 19:51342986-51343008 GGGCACTGGGGAGCCAGGGGAGG - Intergenic
1167770190 19:51510063-51510085 GAGCTCTGTGGATGGAGGGGAGG - Intergenic
1167784824 19:51628089-51628111 GGGCTTTGGGGAGAGAAGGGTGG + Exonic
1168019223 19:53596364-53596386 GCGCACTGGGGGGAGGGGGGAGG + Intergenic
1168084590 19:54036158-54036180 TGGGACTGTGTAGTGAGGGGAGG + Intergenic
1168099540 19:54133924-54133946 GGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168596964 19:57685110-57685132 TGGAACTGTGGGGAGAGGGTAGG + Intronic
925098926 2:1229631-1229653 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
925311734 2:2889604-2889626 GCGCACTGTGCAGAGAAGCGAGG + Intergenic
925715346 2:6779805-6779827 GTGCACTGTGGTGAAATGGGGGG - Intergenic
926243483 2:11105217-11105239 GGGCACAGTGGGGTGGGGGGAGG - Intergenic
926313043 2:11688287-11688309 GGTGACTGTGGGGAGAGGGAGGG - Intronic
926427779 2:12754987-12755009 GGGCACTGTGGGGATAGGAGCGG - Intergenic
926705464 2:15834396-15834418 GGCCACTGGGGAGAGAGGATTGG - Intergenic
926783517 2:16497894-16497916 GAGCACTGTGGTGATAGGAGAGG + Intergenic
927147902 2:20178981-20179003 GAGCACTGTGGGTAGAGGGGTGG - Intergenic
927866935 2:26595141-26595163 GGGGACTGAGGGGTGAGGGGTGG - Intronic
928558286 2:32448644-32448666 GGGGACCGTGGAGAGGGGAGAGG + Intronic
928723072 2:34142567-34142589 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
928904746 2:36356725-36356747 GGGCTCTGCGGGAAGAGGGGCGG + Intronic
928936948 2:36688588-36688610 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
929561192 2:42957596-42957618 GGCCACAGTGGAGACAGGGCAGG + Intergenic
929571968 2:43028382-43028404 CAGCACTGAGTAGAGAGGGGAGG - Intergenic
929573512 2:43038484-43038506 GGGCAGAGTGGGGAGAGGAGGGG - Intergenic
929579697 2:43074081-43074103 GGGCACTAAGGGGAGAGGGATGG - Intergenic
929746910 2:44668497-44668519 GGGCACTGTGGAGTCAAGAGGGG - Intronic
929822882 2:45287630-45287652 GGAGACTGAGGAGGGAGGGGAGG - Intergenic
929994106 2:46814448-46814470 GGGGAGCGTGGAGAGAGGAGGGG - Intergenic
930001866 2:46866994-46867016 GGGATCTGAGGAGAGAGAGGTGG + Intergenic
930593440 2:53356758-53356780 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
930751579 2:54939641-54939663 GGGCACTGCAGGGAGCGGGGAGG - Intronic
931477103 2:62599682-62599704 GGGCATGGTGGGGTGAGGGGAGG - Intergenic
931708737 2:64969332-64969354 GGGCGCCGTGGAGCGGGGGGCGG - Intergenic
931999279 2:67869166-67869188 GGGCACAGTGTGGAGAGGGAAGG - Intergenic
932178326 2:69622368-69622390 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
932239979 2:70148633-70148655 GGGCACTGTGGAGCAGGGGGTGG - Intergenic
932367096 2:71160469-71160491 GGAGACCGTGGAAAGAGGGGAGG - Intergenic
932419313 2:71592197-71592219 GAGCACCCTGCAGAGAGGGGAGG + Intronic
932835460 2:75031614-75031636 AGGCATTGTTGAGAGAGGTGTGG - Intergenic
932876867 2:75461631-75461653 TGGCACTGTGGAAAGAGTGAAGG + Intergenic
933572915 2:84034891-84034913 AGGCACTGTGGAGAAAATGGGGG + Intergenic
933738374 2:85513508-85513530 GGGCACTGAAGAGAGAGAGTAGG - Intergenic
933936586 2:87208960-87208982 GGGAAGTGAGGAGAGAGGGGAGG - Intergenic
934546378 2:95220083-95220105 GGGCAATGTGTGGGGAGGGGTGG + Intronic
934713286 2:96529147-96529169 GGGCACGGAGGAGAGGGAGGAGG - Intergenic
934898543 2:98139330-98139352 GGGCACCGTGGAGCAGGGGGTGG - Intronic
935005101 2:99066811-99066833 GGGAGCTGTGGATACAGGGGAGG - Intronic
935350011 2:102144587-102144609 AGGCACTGTGGTGAGTGGTGGGG + Intronic
935697186 2:105780540-105780562 GGGCACTATTGAGAGTGGGAGGG + Intronic
935926777 2:108078198-108078220 GGGCACTGGGATGAGAGGGAGGG + Intergenic
936035972 2:109111784-109111806 GGGGACTGTGGTGGGATGGGGGG - Intergenic
936050187 2:109216663-109216685 GGGCACTGGCTAGAGAGGGCAGG - Intronic
936172664 2:110190265-110190287 GGGCACTGTGGAGCAGGGGGTGG + Intronic
936475203 2:112833571-112833593 GAGCACTGCGGAGAGAGCGAGGG + Exonic
937227679 2:120379088-120379110 GGGCACAGTGGGGAGAAGGAAGG - Intergenic
937329310 2:121015924-121015946 GAGCACAGTGGGGAGAGCGGAGG + Intergenic
937746645 2:125422576-125422598 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
937922161 2:127138251-127138273 GGCCACTGTGGGGTGGGGGGTGG - Intergenic
938119887 2:128625909-128625931 GGGCACTGTGAGCAGAGGGTTGG - Intergenic
938401073 2:130991772-130991794 GGGCGCTGTGGAGCACGGGGTGG - Intronic
938976366 2:136481952-136481974 GGGGACTGGGGATACAGGGGAGG + Intergenic
939053167 2:137331640-137331662 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
939241986 2:139573000-139573022 GGGCACACTGGAGTGAAGGGTGG - Intergenic
939477114 2:142701908-142701930 GGAGACTGTGGGGAGAGGGAGGG - Intergenic
939777311 2:146403724-146403746 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
940987353 2:160062577-160062599 GTTCACTGTGGAGACAGCGGTGG - Exonic
941012656 2:160319103-160319125 GGCCACTATGGAGAGAGTGTGGG - Intronic
941192238 2:162399513-162399535 GTGAGGTGTGGAGAGAGGGGAGG - Intronic
941200378 2:162501388-162501410 GGGTACTTTGGAGAGTGGGAGGG + Intronic
941820840 2:169841861-169841883 GGGCACCGTGGAGTAGGGGGTGG - Intronic
942202094 2:173581626-173581648 GGGCATTGGGGAGAGTGGGTGGG + Intergenic
942297197 2:174529069-174529091 AGGCAGTGTAGAGAGAGGAGAGG + Intergenic
942553946 2:177151857-177151879 CTGCAGTGTGGAGAGAGGGTTGG - Intergenic
942662553 2:178281788-178281810 GGGGTCTGTGGTGAGGGGGGTGG + Intronic
943364091 2:186952873-186952895 GGGGACTGTGGTGAGGTGGGGGG - Intergenic
943612316 2:190047585-190047607 GGGAACTATGGAGAGAGAAGGGG - Intronic
943648498 2:190431708-190431730 GGAGACTGTGGGGAGAGGGAGGG + Intronic
943875468 2:193061766-193061788 GGGCACATTGGAGAGTGGGTTGG - Intergenic
944531291 2:200670170-200670192 GGGCGCTGTTGCCAGAGGGGAGG - Intronic
944857884 2:203785607-203785629 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
945328738 2:208514982-208515004 GGGCACTCTGAGGTGAGGGGTGG + Intronic
945728576 2:213504240-213504262 GGGCAGTGTGTAGAGAGGGAAGG + Intronic
946358036 2:219201460-219201482 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
946428908 2:219614278-219614300 GGGCTCTGTGGAAAGAGGATTGG - Intronic
947841133 2:233208620-233208642 GGCCACGGTGGAGAGAGAGCTGG + Intergenic
948075167 2:235160314-235160336 GGTCACTGTGGGATGAGGGGAGG - Intergenic
948267615 2:236647089-236647111 GGACACTGTGGGGGGTGGGGAGG - Intergenic
948295464 2:236857170-236857192 GGGGAAAGAGGAGAGAGGGGAGG - Intergenic
948379891 2:237544111-237544133 GGGCACGGTGGTGAGTGGAGGGG + Intronic
948379990 2:237544469-237544491 GGGGACAGTGGTGAGTGGGGGGG + Intronic
948380003 2:237544506-237544528 GGGGACAGTGGTGAGTGGGGGGG + Intronic
948380064 2:237544753-237544775 GGGCACGGTGGTGAGTGGAGGGG + Intronic
948682438 2:239645011-239645033 GGGCACCAGGGAGAGTGGGGCGG - Intergenic
948803982 2:240445238-240445260 GGGCAATTTGGGGTGAGGGGTGG + Intronic
948838397 2:240637169-240637191 GGGCAGGATGGAGAGAGGAGAGG - Intergenic
948867116 2:240781807-240781829 GGGAACTGTGGAGAACGGTGTGG - Intronic
948873630 2:240816453-240816475 GGGCACTGTGGGGAGGGGTGAGG + Intronic
949008828 2:241667139-241667161 GGGCACAGTGGAGACCCGGGAGG - Intronic
1168891206 20:1296307-1296329 GGGGGCTGAGGAGAGAGGGCGGG - Exonic
1169111723 20:3038544-3038566 GGGGACCAGGGAGAGAGGGGAGG - Exonic
1169324070 20:4661159-4661181 GGGGACTGGGGAGGGAGGGAGGG + Intergenic
1169331018 20:4716562-4716584 AAGCACTGTGGAGAGAGGGATGG - Intergenic
1169490329 20:6065671-6065693 AGGCACTGGGGAGTGGGGGGAGG + Intergenic
1169814407 20:9641622-9641644 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1170123158 20:12933659-12933681 GGTCATTGTGGAGAGATGGTAGG + Intergenic
1170290144 20:14760209-14760231 GGGCAGGGTGGAGTGAGGGCAGG + Intronic
1170562449 20:17569525-17569547 GGACAGTGTGGGGAGAGGAGGGG - Intergenic
1171346842 20:24471473-24471495 GGGCGGTGGAGAGAGAGGGGAGG - Intronic
1171412971 20:24958877-24958899 GGGCACAGGGGAGGGAGGGCAGG - Intronic
1171426123 20:25049833-25049855 GGGGACTTTGGAGGGTGGGGCGG - Intronic
1172064155 20:32207596-32207618 GGGGACGGCGGGGAGAGGGGCGG - Intronic
1172614182 20:36272785-36272807 GGGAACGGAGGAGAGATGGGTGG + Intergenic
1172785371 20:37464984-37465006 GGGGACTGTTGGTAGAGGGGTGG - Intergenic
1172793684 20:37522984-37523006 GGGCAGGGTCGAGAGAGGAGGGG + Exonic
1173195481 20:40910502-40910524 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1173433981 20:43016242-43016264 GGGCACTGTGGAGCCAAGAGTGG + Intronic
1173560761 20:44003807-44003829 GGTCACTGTGGTTAGAGGGGTGG + Intronic
1173647501 20:44642594-44642616 GGGCAAAGTGGAGAGGGGGCAGG + Intronic
1173698996 20:45049913-45049935 GTGAACAGTGTAGAGAGGGGAGG - Intronic
1173849334 20:46208067-46208089 GGGCATTGAGGAGAGGGGGAGGG - Intronic
1174186256 20:48708364-48708386 GGGCACTCTGGACCGCGGGGTGG + Exonic
1174306588 20:49617795-49617817 GGGCACCGAGGAGAGGGTGGCGG - Intergenic
1174483705 20:50848488-50848510 GGGCAGAGTGGAGAGAGAGAAGG + Intronic
1174723830 20:52840649-52840671 GGGCACTGAGGAGAAAATGGCGG - Intergenic
1175259333 20:57664724-57664746 GGGTCCTCTGGAGAGAGGGAGGG - Intronic
1175618618 20:60424381-60424403 AGGAGCTGTGGAGAGTGGGGTGG + Intergenic
1175733574 20:61370449-61370471 CGGCACTGGGGAGAGGGAGGAGG - Intronic
1175832731 20:61975669-61975691 GGGCAGAGAGGAGAGCGGGGTGG + Exonic
1176099334 20:63357837-63357859 CTGCAGGGTGGAGAGAGGGGTGG + Intronic
1176102200 20:63369676-63369698 GGGTCCTGTGCAGAGGGGGGTGG + Intronic
1176109700 20:63405718-63405740 GGGCAGTCAGGAGAGAGGGGAGG + Intergenic
1176143993 20:63557464-63557486 GGCATCTGTGGAGGGAGGGGTGG - Intergenic
1176156572 20:63625158-63625180 AGGAGCTGTGGAGAGAGGAGGGG - Intronic
1176166283 20:63675742-63675764 GGGGACTGTGGAGAGGAGGGAGG - Intronic
1176519854 21:7816179-7816201 GGGCACTGTCTAGACAGAGGAGG - Intergenic
1176535812 21:8049288-8049310 GAGCACTTTGGAGAGAATGGTGG - Intergenic
1177107006 21:16969336-16969358 GGGCACTGGGGGCAGAGGGGAGG + Intergenic
1177182340 21:17757620-17757642 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1177835681 21:26184223-26184245 GGGCACACTGGAGCAAGGGGTGG + Intergenic
1178653882 21:34446192-34446214 GGGCACTGTCTAGACAGAGGAGG - Intergenic
1178896398 21:36562220-36562242 GGGTACTGTTGAAAGAGGGTGGG + Intronic
1180037311 21:45256528-45256550 GGACAGTGTGGAGGGAGAGGGGG - Intergenic
1180115134 21:45698223-45698245 GGGCACTTTGGAGAAGGGGAAGG - Intronic
1180309743 22:11159190-11159212 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1180548220 22:16521000-16521022 GGGGACTGGGGGGAGGGGGGAGG - Intergenic
1180702846 22:17791067-17791089 GGGCACTGAGGAGGCAGGGCAGG + Exonic
1181500737 22:23314254-23314276 GGCCACAGTGCAGAGAGAGGAGG - Intronic
1181697099 22:24599166-24599188 GGGCACTGTGGATACTGTGGAGG + Intronic
1181985781 22:26799116-26799138 GGGCTCTGGGGAGAGAGGAGGGG - Intergenic
1182875460 22:33687677-33687699 GGAAAGTGTGGAGAGATGGGAGG + Intronic
1183064000 22:35351320-35351342 GGGCTCTGTAAAGAGAGGGAGGG - Intergenic
1183151048 22:36037657-36037679 AGGGGCTGAGGAGAGAGGGGAGG - Intergenic
1183281408 22:36934664-36934686 GGTCACTGTGGTGAAAGGTGAGG - Intronic
1183467268 22:37986026-37986048 GGGCACAGGGAAGAGAAGGGAGG - Intronic
1183686084 22:39362215-39362237 GGGCATTCTGGAAAGAGGGAGGG + Intronic
1183698679 22:39437682-39437704 TGGCAGGGTGGGGAGAGGGGAGG + Intergenic
1183721866 22:39567366-39567388 GGACACTGGGGAGAGAGTTGAGG + Intergenic
1183727216 22:39596501-39596523 GGGCAGGGTGGAGAGAGATGGGG + Intronic
1183836929 22:40461897-40461919 GGGCATGGTGGAGAGAGAGAAGG - Intronic
1184094641 22:42309961-42309983 GGGCACTGGAGAGACAGGGCTGG - Intronic
1184291151 22:43498776-43498798 GGGCAGAGAGGAGAGATGGGAGG - Intronic
1184478148 22:44732394-44732416 GGGCACAGTGGGCAGAGGGTCGG + Intronic
1184489300 22:44799911-44799933 GGGCCCTGGGCAGAGAGAGGAGG + Intronic
1184642208 22:45878674-45878696 GGCCACAGCTGAGAGAGGGGCGG - Intergenic
1184679622 22:46063282-46063304 AAGCACTGCTGAGAGAGGGGTGG - Intronic
1184787551 22:46679135-46679157 GGGCCCTGGGGAGAGAGGTGTGG - Exonic
1185063669 22:48620228-48620250 AGGCCCTGTGGAGGGAGAGGTGG - Intronic
1185070894 22:48655053-48655075 GGGCACTGTGTTTAAAGGGGAGG + Intronic
1185184646 22:49391700-49391722 GGGCACCGTGGAGGGAGGGCTGG - Intergenic
1185359208 22:50395296-50395318 GGGCAGTGTGGCGAGATGGCTGG + Intronic
1185366895 22:50440981-50441003 GGCCACTGTGGGCAGCGGGGGGG - Exonic
1185373496 22:50471483-50471505 GTGCACTGTGGGGAGTGTGGTGG - Intronic
949202253 3:1393396-1393418 GGGGACTGTGGTGAGGTGGGGGG + Intronic
949786525 3:7747537-7747559 GGGCACAGTAGAGAGAAGTGAGG - Intergenic
950043947 3:9937983-9938005 GGGCAGGGTGGAGGGAGGTGGGG - Intronic
950118775 3:10468153-10468175 GGACACTGGGCAGAGAGGAGGGG - Intronic
950172138 3:10846296-10846318 GTGAACTGTGAAGAGAAGGGAGG + Intronic
950513318 3:13447229-13447251 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
951550693 3:23872353-23872375 GGAGACCGTGGAAAGAGGGGAGG + Intronic
951710394 3:25580767-25580789 GGGCACCGTGGAGGGGAGGGAGG + Intronic
951925903 3:27908569-27908591 GGGCACTGCAGAGTGAGGGAAGG - Intergenic
952360519 3:32625962-32625984 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
952751321 3:36827193-36827215 GCTCACTGTGGGGAGAGGGTAGG + Exonic
952882209 3:37991850-37991872 TGGCACTGTGGGGAGGGAGGAGG + Intronic
953373241 3:42407339-42407361 GGGCACTGTGGGGGTGGGGGTGG + Exonic
953810077 3:46104668-46104690 GGGCAGTGGGGAGAAAGAGGAGG + Intergenic
954305186 3:49721927-49721949 GGGCTGGGTGGGGAGAGGGGCGG - Exonic
954672405 3:52298090-52298112 GGGCTCTGTGGATAGGGGTGGGG - Intergenic
954907590 3:54076183-54076205 GGGCACAGCAGAGAGAGGGAGGG - Intergenic
955238073 3:57157307-57157329 GGGAAGTGTGGAGAGAGGACGGG + Intronic
955353449 3:58210852-58210874 GGGCGCTGTGGATGGAGAGGAGG + Exonic
956481505 3:69677781-69677803 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
956610677 3:71119471-71119493 AGTCACTGTGGATATAGGGGTGG + Intronic
957382494 3:79450326-79450348 GGGTGCTGGGGAGAGAGGGAGGG + Intronic
957419616 3:79951403-79951425 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
958503198 3:94941052-94941074 GGGGGGTGAGGAGAGAGGGGAGG - Intergenic
958714989 3:97769680-97769702 GGGTAGGGCGGAGAGAGGGGTGG - Intronic
959921463 3:111872716-111872738 GGGCACTCTGGAAATAGGGAAGG + Intronic
960043663 3:113175601-113175623 GGGCACTCTGTAGAAAGGAGAGG - Intergenic
960157201 3:114308021-114308043 GGGCTCTGTGGAGAGCAGCGGGG + Exonic
960592195 3:119377329-119377351 GGGCACAGTGGAGAGAATGATGG + Intronic
960937232 3:122911672-122911694 GGGGTCTGAGGAGAGAGGGAGGG - Intronic
961102665 3:124214884-124214906 GAGCCCTGTGGAGAGAGGTCTGG - Intronic
961298266 3:125904220-125904242 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
961382692 3:126505932-126505954 TGGCACTGTGGTGAGAGATGGGG - Exonic
961384599 3:126516540-126516562 GGGCACTGGGGGGAGGGGGGAGG - Intronic
961467264 3:127089413-127089435 GGGACCTGTGGACAGAGGGTGGG - Intergenic
961570647 3:127796096-127796118 GGGCTCTGTGCAGAGAGTGGTGG - Intronic
961594588 3:128006544-128006566 GGGCACTTGGAAGAGGGGGGTGG + Intergenic
961629110 3:128283277-128283299 GGACACTGTGTCCAGAGGGGTGG + Intronic
961674277 3:128555402-128555424 GGGCGCTGCGGAGAGACCGGCGG + Intergenic
961677849 3:128578449-128578471 GGAGTCTGTGGAGGGAGGGGTGG - Intergenic
961780790 3:129319084-129319106 GGGCACTGAGGAGAGCGGCCAGG + Intergenic
962661557 3:137606232-137606254 GGGGACTGGGGAGAGAGGAAGGG - Intergenic
962826590 3:139105022-139105044 GAGTTCTGTGGAGAGAGTGGAGG + Intronic
963498213 3:146095902-146095924 GGAGACTGTGGAGGGAGAGGGGG - Intronic
963583386 3:147154396-147154418 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
964139171 3:153378368-153378390 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
964198191 3:154088299-154088321 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
964378561 3:156073444-156073466 GGGCACCGTGGAGCAGGGGGCGG - Intronic
964802847 3:160574021-160574043 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
965753178 3:171998903-171998925 GGGCGCCGTGGAGCAAGGGGTGG + Intergenic
966190966 3:177271761-177271783 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
966425426 3:179775551-179775573 GGGCACTGCGGAGCAGGGGGCGG + Intronic
966725381 3:183103779-183103801 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
966973381 3:185065450-185065472 GGGCACTGACGGGAGAGGGGAGG + Intergenic
967386128 3:188912737-188912759 GGGCAGGAGGGAGAGAGGGGGGG + Intergenic
967892220 3:194371532-194371554 GGGCACTGTGCTGGGAGTGGTGG + Intergenic
968412763 4:404032-404054 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
968503104 4:960274-960296 GGGCTCAGTGGGGAGAGGGATGG + Exonic
968565973 4:1313029-1313051 GGGCCCAGTGGAGAGAAGGTGGG + Intronic
968647904 4:1749232-1749254 GGGCGCAGTGGGGAGGGGGGAGG - Intergenic
968653269 4:1768163-1768185 GGGCTCTGGGGCCAGAGGGGAGG + Intergenic
968702282 4:2062746-2062768 GGGCAATGGGGAGGGATGGGAGG + Intronic
968740799 4:2330842-2330864 GGGGACTGGGGAGAGAGGACTGG + Intronic
968984779 4:3869177-3869199 GGGCAGTGGGGAGGGAGGAGAGG + Intergenic
969192538 4:5533754-5533776 GGGCATGGGGGAAAGAGGGGTGG + Intergenic
969516549 4:7651421-7651443 GGCCACTCTGGAGAGAGAAGAGG + Intronic
969516728 4:7652257-7652279 GGCCACTGTGGAAAGGGGAGCGG + Intronic
969627479 4:8314929-8314951 GGGCACCGAGGGGAGAGGGCAGG + Intergenic
970314445 4:14815850-14815872 ATGCACTGTGGAGGGAGGGAAGG + Intergenic
970576819 4:17436595-17436617 GGGCGCTGTGGAGAAGGGGAAGG + Intergenic
971294541 4:25377094-25377116 GGGCAGGGAGGAGCGAGGGGCGG - Intergenic
971301148 4:25443246-25443268 GGTCACTGTGGAGGGGGCGGGGG + Intergenic
971302966 4:25456919-25456941 GGGCAGTGTTGACAGAGAGGAGG - Intergenic
971929001 4:33053744-33053766 GGGCACTGTTTAGAGTGGGAAGG - Intergenic
972000420 4:34025097-34025119 GGGCAGTGGGGAGCTAGGGGAGG - Intergenic
972034753 4:34506653-34506675 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
972345023 4:38185555-38185577 GGGCCCTGTGGTAAGATGGGAGG + Intergenic
974804434 4:66860497-66860519 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
974838188 4:67275282-67275304 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
975073773 4:70178472-70178494 GAGCACTGGAGAGAAAGGGGAGG - Intergenic
975595139 4:76043327-76043349 GGGCACCGTGGAGCAGGGGGTGG + Intronic
975596317 4:76050689-76050711 GGGCACCGTGGAGCAGGGGGTGG + Intronic
976406429 4:84665019-84665041 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
978515943 4:109568586-109568608 GGGGTCTGTGGGGAGATGGGGGG - Intronic
979688641 4:123538245-123538267 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
980470179 4:133240439-133240461 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
980628643 4:135406947-135406969 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
981012940 4:139944331-139944353 GGGGACTGTGGTGGGATGGGGGG - Intronic
982288275 4:153757037-153757059 AGGGGCAGTGGAGAGAGGGGAGG - Intronic
982728237 4:158928030-158928052 GGGCACCGTGGAGCAGGGGGCGG - Intronic
982740364 4:159051419-159051441 AGGCACTGTGGGGAGAGGCATGG - Intergenic
982813909 4:159861701-159861723 CGGCACTGTGGAGATTGGGCAGG - Intergenic
983398453 4:167233721-167233743 GGGCACAGGGGAGAGCAGGGTGG + Intronic
984241793 4:177227597-177227619 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
984265710 4:177495920-177495942 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
984754541 4:183313357-183313379 AGGCATTGTGGAGAGTGGGCTGG + Intronic
984766202 4:183402386-183402408 AGGCACTGGGCAGAGAGGGAGGG - Intergenic
984901791 4:184592194-184592216 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
984948667 4:184990119-184990141 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
985496970 5:214172-214194 GGGGGCTATGGAGGGAGGGGCGG + Intronic
985630535 5:1011688-1011710 GGGGGCTGGGGAGAGAGGGTAGG - Intronic
985808608 5:2067061-2067083 GGCAACTGTGGAATGAGGGGAGG - Intergenic
985992482 5:3574963-3574985 GGGCACCCTAGGGAGAGGGGAGG - Intergenic
986152053 5:5138114-5138136 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
986232624 5:5880678-5880700 GGGCAGTGTGGGGAGGGTGGTGG - Intergenic
986321263 5:6633927-6633949 GGGCACCGGGCAGTGAGGGGAGG - Intronic
986710931 5:10487263-10487285 GCGCACTGGGGAGAGACGAGGGG + Intergenic
987347395 5:16991013-16991035 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
987352240 5:17032460-17032482 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
987373953 5:17217560-17217582 GGGCACTGGGCAGGAAGGGGAGG + Exonic
987591409 5:19932551-19932573 GTGTATTGTGGGGAGAGGGGCGG - Intronic
987663240 5:20904688-20904710 GGGCACTCTGGTGCTAGGGGTGG + Intergenic
987666351 5:20946449-20946471 GGGTAATGAAGAGAGAGGGGAGG - Intergenic
987891061 5:23879273-23879295 GGGCACTCTGGTTTGAGGGGCGG - Intergenic
988074357 5:26333666-26333688 GGGGACTGTGGGGTGGGGGGAGG + Intergenic
988759451 5:34297497-34297519 GGGCACTCTGGTGCTAGGGGTGG - Intergenic
989003249 5:36782909-36782931 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
989965874 5:50465342-50465364 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
990949955 5:61288818-61288840 GGGCAGCCTGGAGAGAGGGCAGG + Intergenic
991054690 5:62307268-62307290 AGGCACTGCTGAGAGAGTGGGGG + Intronic
991145427 5:63297437-63297459 GGGGAGAGTAGAGAGAGGGGCGG - Intergenic
991567511 5:68020434-68020456 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
992333050 5:75737396-75737418 GGGCACAGAGGAGAGATGGAGGG + Intergenic
992594146 5:78328549-78328571 TGGCCCTTTGGAGAAAGGGGAGG - Intergenic
992778921 5:80110721-80110743 AGGCCCGGTGGAGAGAGGGATGG - Intergenic
993320886 5:86466713-86466735 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
993822087 5:92631660-92631682 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
994424933 5:99573519-99573541 AGGCACTGTGGAGAGAAGTTTGG + Intergenic
994605552 5:101962477-101962499 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
994647717 5:102491423-102491445 GGGCACCGTGGAGCAGGGGGCGG + Intronic
994935328 5:106246539-106246561 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
995185839 5:109268742-109268764 GGGCACTGTTGTGGGATGGGGGG + Intergenic
995276660 5:110285247-110285269 GGGCAGTGGGGAGAGAACGGAGG - Intergenic
995503692 5:112836169-112836191 GGGCACGGTGGCGGGGGGGGGGG - Intronic
995544683 5:113218121-113218143 GGGGAGTATGGAGAGTGGGGGGG + Intronic
995656556 5:114433009-114433031 GGGCACCGTGGAGCAGGGGGTGG - Intronic
995747180 5:115416125-115416147 GGGAGCTGTAGAGAGAGGTGGGG + Intergenic
995975877 5:118034154-118034176 TGGCACTGTGGAGCAGGGGGCGG - Intergenic
996280148 5:121720528-121720550 GGGGGCTGGGGAGAAAGGGGAGG - Intergenic
996586031 5:125088983-125089005 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
996649615 5:125858416-125858438 GGGGGTTGGGGAGAGAGGGGAGG - Intergenic
996839294 5:127828932-127828954 GAGCAATGTGGAGAGAGGATTGG + Intergenic
996957740 5:129204901-129204923 GGGCAAGGGGGAGAGAGGGAAGG + Intergenic
997222577 5:132181427-132181449 GGGCACTGGGGATAGAGAAGTGG + Intergenic
997466171 5:134089550-134089572 AGGCACTGAGGAGAGGTGGGGGG + Intergenic
997585261 5:135039878-135039900 GGGACCTGCGGGGAGAGGGGCGG + Intronic
997766624 5:136511219-136511241 GGGAGGTGTGGAGAGAGGGAAGG + Intergenic
998088032 5:139342444-139342466 GGGGTTTGGGGAGAGAGGGGCGG + Exonic
998134625 5:139668248-139668270 TGGCACCGTGGAATGAGGGGAGG + Intronic
998238373 5:140420001-140420023 GGAGACTGTGTGGAGAGGGGAGG - Intronic
998559171 5:143155177-143155199 GGGCACTGTGGGGAGCAAGGAGG - Intronic
999001877 5:147932567-147932589 GGGCACTGAGGTTAGAGAGGAGG + Intergenic
999274613 5:150321218-150321240 GGCCACTGTGGAGGGAGGTGGGG - Intronic
999764937 5:154732905-154732927 GGGCAATGTGCAGACAGGGAAGG - Intronic
1000262330 5:159599977-159599999 GGGCACGCTGGTGTGAGGGGTGG + Intergenic
1000372260 5:160548298-160548320 AAGCATTGTGGAGAGAGGGAAGG + Intergenic
1001301443 5:170536597-170536619 GGCCAAGGTGGAGTGAGGGGAGG + Intronic
1001453861 5:171846120-171846142 AGGCACTGTGGAGTGAGCGCTGG + Intergenic
1001655516 5:173345890-173345912 GGGTAGTGTGGAGAGAGAGAGGG - Intergenic
1001698900 5:173692432-173692454 GGGCACTGTGCAGGAATGGGAGG + Intergenic
1001953333 5:175831269-175831291 GAGCAGTGGGGAGAGAAGGGAGG - Intronic
1002004585 5:176222057-176222079 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1002041802 5:176520243-176520265 GGGCACTGGAAAGAGAGGGCAGG + Intergenic
1002082921 5:176748209-176748231 GGCCACGGTGGGGAGAGGTGGGG - Intergenic
1002373478 5:178772627-178772649 GTCCACTGTGGAGACAGGAGAGG + Intergenic
1002392743 5:178928579-178928601 GGGCACTCTGCTGCGAGGGGTGG + Intronic
1002467729 5:179416160-179416182 GGGCACTGAGGAGGGAGGCAGGG - Intergenic
1002564341 5:180101343-180101365 GGCCACTGTGGGGGGGGGGGGGG + Exonic
1002762753 6:214601-214623 GGGGACTCTGGGGAGAGAGGTGG + Intergenic
1002795022 6:465273-465295 GGACACTGTGGGGGGGGGGGGGG + Intergenic
1002838302 6:884083-884105 GGGCACTGGGGAAGGAGGGCGGG + Intergenic
1002848908 6:973829-973851 GGGGACTTTGGAGAAAGGGTGGG - Intergenic
1002955608 6:1860453-1860475 GGGGGCTGGGGAGAGAGAGGAGG + Intronic
1003060774 6:2860469-2860491 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1003426210 6:5999874-5999896 GGGAACTGTGGAGAGCAAGGAGG - Intronic
1003432472 6:6052720-6052742 GGACACAGAGGAGAGAGGTGAGG + Intergenic
1003578273 6:7316855-7316877 GGGCGCTGTGGAGCTGGGGGTGG + Intronic
1003589645 6:7426066-7426088 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1003908181 6:10720918-10720940 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
1004075590 6:12341557-12341579 GGTGACAGTGGAGGGAGGGGCGG - Intergenic
1004189002 6:13447958-13447980 GGCCACAGTGGAGAGAATGGAGG + Intronic
1004224442 6:13772818-13772840 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1004235496 6:13871953-13871975 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1004519350 6:16347168-16347190 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1004631814 6:17428613-17428635 GGGGACTGTGGTGGGATGGGGGG + Intronic
1004902817 6:20209839-20209861 GGCCACTGTGAAGAGATGGAAGG + Intronic
1004905466 6:20233502-20233524 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1005035519 6:21552314-21552336 GGGCACTGTGGAGTAGGGGGTGG + Intergenic
1005345921 6:24890494-24890516 TGGGACAGTGGGGAGAGGGGAGG + Intronic
1005596160 6:27381099-27381121 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1005976699 6:30805584-30805606 AGGCACTGTGGAGAGAACAGTGG - Intergenic
1006021851 6:31121991-31122013 GGGAGCTGTGGAGAGAGGAAGGG + Intronic
1006115610 6:31774622-31774644 GGCCACTGGGAAGAGAGGGCAGG + Exonic
1006131452 6:31871623-31871645 GGGCACTGTGGACTGGGAGGGGG - Intronic
1006132784 6:31878897-31878919 GGACCCTGTGGAGGGAGGGGAGG - Intronic
1006300033 6:33189102-33189124 GGGCACTGTAGAGAGTCAGGAGG + Exonic
1006515717 6:34544563-34544585 GGGCCCTGTGGACAGTGGGCTGG + Intronic
1006589434 6:35143149-35143171 GGGGAGGGTGGAGAGTGGGGAGG + Intronic
1006748850 6:36364263-36364285 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1007099511 6:39235901-39235923 GGGCATTGAGGAGAGAGATGTGG + Intergenic
1007144566 6:39615490-39615512 GGGGTCTGGGGAGAGTGGGGTGG - Intronic
1007383487 6:41505055-41505077 GGGCAGGGTGGAGAGATGGAGGG - Intergenic
1007407683 6:41644355-41644377 GGGCAATGGGGAGGGAGGGCTGG - Intronic
1007409400 6:41653275-41653297 GGGGACGGGTGAGAGAGGGGAGG - Intronic
1007546516 6:42698617-42698639 GAGCACTGTGGAGTGTGGGTTGG + Intronic
1007716848 6:43861782-43861804 GGGGACACTGGAGAGAGGCGTGG - Intergenic
1007748058 6:44055265-44055287 GGGCCCCCTGGAGAGAGGGATGG - Intergenic
1007825628 6:44598719-44598741 GGGGTTTGTGGGGAGAGGGGAGG + Intergenic
1008128722 6:47696639-47696661 GAGCACTAGGGAGAGAGGGAGGG + Intronic
1008202422 6:48607558-48607580 GGGGACTGTGGTGGGATGGGGGG - Intergenic
1008270445 6:49483453-49483475 GGGCACTGTGGAGCAGGGGGCGG + Intronic
1008420320 6:51291696-51291718 GAGCAATGTGGAGACAGGAGGGG + Intergenic
1009407061 6:63326482-63326504 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1009470316 6:64024063-64024085 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1009510762 6:64547757-64547779 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1010018116 6:71128262-71128284 GGGGACTGTGGTGGGATGGGGGG - Intergenic
1011765331 6:90613323-90613345 GGGCAGTGAAGAGAAAGGGGAGG + Intergenic
1012000401 6:93647244-93647266 GGGCAGTGGGGAGCAAGGGGAGG - Intergenic
1012145069 6:95670371-95670393 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1012578182 6:100829263-100829285 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1012760452 6:103294435-103294457 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1012851034 6:104446616-104446638 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1013622434 6:111903149-111903171 GGGGACTGTGGTGAGGTGGGGGG - Intergenic
1013955295 6:115834631-115834653 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1014460221 6:121686486-121686508 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1014739050 6:125126183-125126205 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1014752969 6:125273513-125273535 GGGCAATGTGGAGAGAACAGTGG - Intronic
1015078317 6:129191458-129191480 GGGCAGTCTGGAGGGTGGGGTGG - Intronic
1016476619 6:144434323-144434345 GGAGACCGTGGAAAGAGGGGAGG + Intronic
1016501385 6:144724584-144724606 GGGAACTGGGGAGGGAGGGGAGG - Intronic
1016693508 6:146965844-146965866 GGGCACACTGGTGAAAGGGGTGG - Intergenic
1017084532 6:150701603-150701625 GGCCACTGTGGGGTGAGGGGAGG - Intronic
1017809014 6:157970726-157970748 GGGGGCTGTGGGGTGAGGGGAGG + Intergenic
1018074598 6:160200676-160200698 TGGCACTGTGGGAAGAGAGGTGG - Intronic
1018198513 6:161375455-161375477 AGGCACTGTGGAGAGAGGAAAGG - Intronic
1018419936 6:163632127-163632149 GGGCATTGTGGGCAGAGGGGGGG + Intergenic
1018632783 6:165835094-165835116 GGACACAGTGCAGAGAGAGGTGG + Intronic
1019371468 7:664129-664151 GGGGTCTGTGGAGAGAGGCCAGG - Intronic
1019460218 7:1154261-1154283 AGGCAGTGAGGAGAGTGGGGAGG + Intronic
1019780757 7:2938449-2938471 GAGCAATGTGGGCAGAGGGGAGG - Intronic
1019871448 7:3767189-3767211 GGTGACTATGGAGGGAGGGGTGG + Intronic
1019944217 7:4313969-4313991 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1019965706 7:4496962-4496984 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1021120591 7:16791048-16791070 GGAGACCGTGGAAAGAGGGGGGG + Intergenic
1021628821 7:22623512-22623534 GGGCATTGGGGAGGGAGGGGAGG - Intronic
1021942876 7:25696627-25696649 GGGCAGTGTGGCGGGAGAGGAGG - Intergenic
1022127881 7:27375583-27375605 GGGCTCTGTGGGGGGTGGGGTGG - Intergenic
1022156038 7:27662796-27662818 GGTCACCGCGGGGAGAGGGGCGG - Exonic
1022403622 7:30065386-30065408 GGGAACTTTGGAGGGAGGGTGGG - Intronic
1022410030 7:30132341-30132363 TGTCACAGTGGAGAGAGGGGAGG + Intergenic
1022700166 7:32753188-32753210 GGAGACTGTGGAGAGAGAGAGGG - Intergenic
1023136819 7:37060876-37060898 AGGCACAGAGGGGAGAGGGGAGG + Intronic
1023607475 7:41943348-41943370 GGGGAGTGTGGAGGGAGGGAAGG + Intergenic
1023625193 7:42108587-42108609 GGGCACTGTAGAGGGAGGCAGGG - Intronic
1024465953 7:49711582-49711604 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1024607487 7:51034292-51034314 GTGCACCGTGGAGTGAGGGAAGG + Intronic
1025697901 7:63789651-63789673 GGGGCCCGGGGAGAGAGGGGCGG - Intergenic
1026653121 7:72233211-72233233 AGGCACTGTGGAGAAAGGCATGG + Intronic
1026685179 7:72503812-72503834 GGGCACTCTGGCCAGAGAGGAGG + Intergenic
1026915847 7:74120080-74120102 TGGCCCTGTGAAGACAGGGGTGG - Intronic
1027173828 7:75890751-75890773 GGGGGCTGTGGAGGGAGGGTGGG + Intergenic
1027230341 7:76268378-76268400 GGGCACTGGGGTGGGTGGGGGGG + Intronic
1028392724 7:90334742-90334764 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1029169527 7:98620825-98620847 GGGAACTGTGGAACGAGAGGAGG + Intronic
1029365632 7:100114335-100114357 GAGGACAGTGGAGACAGGGGAGG + Intronic
1029487064 7:100849825-100849847 GGGCACAGTAGAAAGAGGGTAGG - Intronic
1029809586 7:103034275-103034297 GCGCACCGTGGAGCGGGGGGCGG + Intronic
1030486247 7:110171967-110171989 GGGAACTTTGGAGAGACTGGTGG - Intergenic
1031085486 7:117298068-117298090 GGGCAGTGGGTGGAGAGGGGAGG + Intronic
1031378839 7:121060264-121060286 GGGCGCCGTGGAGCAAGGGGCGG - Intronic
1031409256 7:121422056-121422078 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1031489984 7:122374722-122374744 GGGGGCTGTGGGGATAGGGGAGG + Intronic
1032056501 7:128688791-128688813 GGAGACTGTGGGGAGAGGGAGGG - Intergenic
1032561558 7:132898638-132898660 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1032948086 7:136874568-136874590 GGGAAGAGGGGAGAGAGGGGGGG - Intronic
1033065124 7:138146450-138146472 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1033758569 7:144418001-144418023 GGGCACCGTGGAGTAGGGGGTGG + Intergenic
1034091096 7:148364137-148364159 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1034200091 7:149278790-149278812 GGGTCCGGTGGAGTGAGGGGAGG + Intronic
1034501947 7:151456420-151456442 GGGCACACTGGTGTGAGGGGTGG + Intergenic
1034530127 7:151690417-151690439 GAGCAATGTGTAGAAAGGGGAGG - Intronic
1034865838 7:154641094-154641116 GGGGACTGGGGAGTGAGAGGGGG - Intronic
1034982332 7:155487151-155487173 GGGGACTGTGGTGAGAGGGTGGG + Intronic
1035019483 7:155792211-155792233 GGGCATTACGGAGAGAGGGAGGG - Intergenic
1035023146 7:155810323-155810345 AGGCACTGCGGAGAGAGCGGCGG - Intronic
1035294801 7:157861013-157861035 GGGAGCTGTGGAGAGGTGGGGGG + Intronic
1035349508 7:158236381-158236403 GAGCACGGTGGCTAGAGGGGTGG - Intronic
1035359453 7:158300768-158300790 TGGCCGTGTGGAGGGAGGGGAGG + Intronic
1035582308 8:747799-747821 GGGCTCTGTGGTGGGATGGGCGG + Intergenic
1035582324 8:747839-747861 GGGCTCTGTGGTGGGATGGGCGG + Intergenic
1035582369 8:747959-747981 GGGCTCTGTGGTGGGATGGGCGG + Intergenic
1035813846 8:2517200-2517222 GCGCAGGGTGGAGAGAGGGAAGG - Intergenic
1035861621 8:3034918-3034940 CGGCACTGTGGAGAAAGGGAAGG + Intronic
1035965852 8:4190938-4190960 CGGCTCAGTGGAGAGTGGGGGGG + Intronic
1036207537 8:6816004-6816026 GGGCACTCAGGATGGAGGGGAGG - Intronic
1036541382 8:9715537-9715559 GGGCACTGGGAGGAGATGGGGGG - Intronic
1036668640 8:10765241-10765263 GGGAAATGTGGCGAGAGGGCAGG + Exonic
1037382672 8:18304041-18304063 GGCCACTGTGGAGAGATGTTTGG + Intergenic
1037605400 8:20433867-20433889 TGGGACAGTGGAGGGAGGGGTGG + Intergenic
1037804461 8:22051286-22051308 GGACAGGGTGGAGAAAGGGGAGG - Intronic
1037983574 8:23272445-23272467 GGGCGCCGTGGAGCGGGGGGTGG - Intronic
1038226943 8:25666335-25666357 GGGCTATGTGTAGAGTGGGGAGG - Intergenic
1038319150 8:26512683-26512705 TGCCACTGTGGAAAGAGAGGCGG + Intronic
1038433976 8:27521799-27521821 GGTCAGTGTGGAGCGAGGTGTGG + Intronic
1038531335 8:28320256-28320278 GGCCAGTGTGGAAAGAGGGGAGG - Intronic
1038534436 8:28343859-28343881 GGACAGGGTGGAGAGAGGGCAGG + Intergenic
1039611716 8:38924411-38924433 GGGGACTGTGAAGAGAGCTGGGG + Intronic
1039713491 8:40083475-40083497 GTTTACAGTGGAGAGAGGGGGGG - Intergenic
1039957972 8:42221833-42221855 CTGCACTGTGGAGAGAGCAGGGG - Intergenic
1041484822 8:58363719-58363741 GGGGCCTGTGGAGTGAGGGGAGG - Intergenic
1041605765 8:59780848-59780870 GGGCACTGTGTAGGGAGGTCTGG - Intergenic
1041844391 8:62311280-62311302 GGTAACTGTGGAGAGAGGGAAGG + Intronic
1042399628 8:68330963-68330985 GGGCGCTGCGGAGAGCGGCGAGG + Exonic
1043620986 8:82192288-82192310 GGACACTGCGGAGAAGGGGGTGG + Intergenic
1043701171 8:83290679-83290701 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1044088529 8:87971444-87971466 GGGCACGGTGGAGCAGGGGGTGG - Intergenic
1044625821 8:94234521-94234543 GGGCAGTGTGGAGACAGCGCGGG + Intergenic
1044633426 8:94300365-94300387 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1045127116 8:99104541-99104563 GGGGACGGTGGGGAGAGGGGAGG - Intronic
1045324774 8:101109918-101109940 GGGCAGGGTGGAGGGAGGGAGGG + Intergenic
1046432785 8:114151095-114151117 GGGGAGTGTGGGGCGAGGGGAGG - Intergenic
1046692771 8:117304316-117304338 AGGCATTGTGGAGAGCGTGGGGG - Intergenic
1046804848 8:118468798-118468820 TGTCACTGTGCAGAGAAGGGAGG + Intronic
1047009949 8:120661639-120661661 GGGCGTTGTGGGGAAAGGGGAGG - Intronic
1047201451 8:122771033-122771055 GGGCAGTAGGGAGAGAGAGGGGG + Intergenic
1047870653 8:129078077-129078099 GGGCATGGTGGAGGGAGTGGGGG + Intergenic
1048065716 8:130966406-130966428 GGTCACTGTTAAGAGTGGGGTGG + Intronic
1048228825 8:132617026-132617048 GGGCACAGTAGAGATAGGGAGGG + Intronic
1048254539 8:132895797-132895819 GGGAAATGTCGAGAAAGGGGAGG + Intronic
1048268121 8:133005288-133005310 GGGGACAGTGGGGCGAGGGGAGG + Intronic
1048516226 8:135113992-135114014 GGGCACAGTGGTGCAAGGGGTGG - Intergenic
1049060431 8:140272341-140272363 GGTCACAGTGGAGAGAGTGGTGG + Intronic
1049300742 8:141868095-141868117 GGGCACAGGGGAGAGAGGACAGG - Intergenic
1049302564 8:141879388-141879410 GGCCACTGTGCAGAGAGGATGGG - Intergenic
1049388529 8:142356345-142356367 AGGCAGCGTGCAGAGAGGGGAGG - Intronic
1049412256 8:142478551-142478573 GTGCACTGTGGGGTGTGGGGTGG + Intronic
1049441618 8:142612316-142612338 GGGCATTGGGGAGAGTGGGCCGG - Intronic
1049577407 8:143396109-143396131 GGTCACTGTGGGGAGTGGGTTGG + Intergenic
1049780687 8:144427456-144427478 GGACACTCAGGAGAGCGGGGCGG + Intronic
1049800102 8:144513734-144513756 GGGCAGTGGGGAGTGAGGAGGGG + Intronic
1049949257 9:628660-628682 GGGAACTGGGCAGAGAGGGGAGG - Intronic
1050120165 9:2299717-2299739 GGGCAAGGGGGAGAGAGGGATGG + Intergenic
1050335412 9:4585294-4585316 GGTCCCTGGGGAGAGACGGGAGG - Exonic
1051314132 9:15810430-15810452 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1051716652 9:19991713-19991735 GGGCAATGGGGAGACAGGAGAGG + Intergenic
1051920024 9:22253807-22253829 GTGCATTGTGGAGGAAGGGGTGG - Intergenic
1052075492 9:24135395-24135417 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1052903750 9:33817038-33817060 AGGCACGGTGGGGGGAGGGGAGG + Intergenic
1052928524 9:34038298-34038320 GGAGACCGTGGGGAGAGGGGAGG - Intronic
1052993889 9:34539362-34539384 GGGCGCTGTGGCTACAGGGGAGG - Intergenic
1053612519 9:39729205-39729227 GGGCAGGGGGGAGGGAGGGGAGG + Intergenic
1053870551 9:42487176-42487198 GGGCAGGGGGGAGGGAGGGGAGG + Intergenic
1054085736 9:60741951-60741973 GGGCAGTGGGGAGGGAGGGGAGG - Intergenic
1054240995 9:62613187-62613209 GGGCAGGGGGGAGGGAGGGGAGG - Intergenic
1054555128 9:66647712-66647734 GGGCAGGGGGGAGGGAGGGGAGG - Intergenic
1056296027 9:85193869-85193891 GTGCACTGGGGAGAGAGTGGTGG - Intergenic
1056720446 9:89066796-89066818 GGGCACTGTTGAGAGAGAAGGGG - Intronic
1056737698 9:89223933-89223955 GAACACTGTGGAGGGAGGGAGGG - Intergenic
1056797315 9:89667708-89667730 GGGCTCTGTGGAGGGAGGCTGGG - Intergenic
1056799578 9:89681580-89681602 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1056974034 9:91234151-91234173 TGATACAGTGGAGAGAGGGGTGG - Intronic
1057160599 9:92885813-92885835 ATTCACTGTGCAGAGAGGGGAGG - Intergenic
1057383875 9:94591176-94591198 GAGCGCTGTGGAGCGGGGGGTGG + Intronic
1058233272 9:102457729-102457751 GGGGACTGTGGTGGGATGGGGGG + Intergenic
1058687597 9:107491518-107491540 GGGCTCCGTGGAGAGGGGGGCGG - Intergenic
1058813862 9:108666083-108666105 GTGCACTGTGATGAGAAGGGAGG + Intergenic
1059781491 9:117532910-117532932 GGGCACTGTAGGGAGTGGAGAGG + Intergenic
1060149033 9:121275613-121275635 AGGTACTGTGGTGGGAGGGGAGG - Intronic
1060212996 9:121721886-121721908 GGGAACTGGGAAGTGAGGGGCGG + Intronic
1060392431 9:123289324-123289346 GGGCAGTGGGGAGAGAGGGATGG - Intergenic
1060484937 9:124040963-124040985 GGGGACTGGGGAGAGGGGGGCGG + Intergenic
1060549100 9:124476833-124476855 GGGACCTGTGGAGTGAGGGGAGG - Intronic
1060729924 9:126030786-126030808 TGGCACTGGGGAGACAGGGCTGG + Intergenic
1060839529 9:126782749-126782771 GGGCACCATGGAGAGAAGAGAGG + Intergenic
1061188257 9:129067755-129067777 GGGCTCTGTGGAGAGAAGCACGG - Exonic
1061343450 9:130002510-130002532 GGGCACAATAGAGAGGGGGGAGG - Intronic
1061483876 9:130910450-130910472 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1061524710 9:131149809-131149831 GGGCTCTGTGAAGTCAGGGGAGG - Intronic
1061563631 9:131422708-131422730 GGGCACTGTCTGGAGAGGCGGGG + Intronic
1061662365 9:132138709-132138731 GGGCTCTGAGGATACAGGGGTGG - Intergenic
1061749665 9:132769093-132769115 GGGCACTGTGGGGAGGGGCAGGG + Intronic
1061755302 9:132808381-132808403 TGGCACTGTGGACAGAGGACTGG - Intronic
1061779573 9:132987664-132987686 GGGCACTGTGGAGTGAGGCTGGG + Intronic
1061858322 9:133455267-133455289 GAGCACTGCCAAGAGAGGGGAGG - Exonic
1061916828 9:133759802-133759824 GGGGAGGGTGGAGCGAGGGGAGG + Intergenic
1061963744 9:134001639-134001661 GGGAACTGGGGAGAGAGTGTGGG + Intergenic
1062146166 9:134991065-134991087 GGGCACAGTGGAGCAGGGGGCGG + Intergenic
1062299412 9:135856629-135856651 GGCCACTGGGGAGAGAGGCTGGG - Intronic
1062731313 9:138111731-138111753 GGGCAGGGTGGATGGAGGGGTGG - Intronic
1062733707 9:138122852-138122874 GGGCACTGTGGTGTGAGGCGAGG + Exonic
1186547656 X:10467608-10467630 GAGCACTGTGGAGAGTGGAGAGG - Intronic
1186686736 X:11932839-11932861 GGCCACTCTGGTGAGTGGGGTGG - Intergenic
1186744927 X:12557680-12557702 GGGCACTATGGAGATAGGACTGG - Intronic
1187005800 X:15231763-15231785 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1187035220 X:15531560-15531582 GGGCAGTGGGGTGAGAGTGGTGG - Intronic
1187735844 X:22302934-22302956 GGGCAGTGTGAAGAGGGGTGGGG + Intergenic
1187843244 X:23510021-23510043 GGGCACACTGGTGTGAGGGGTGG - Intergenic
1187904060 X:24050020-24050042 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1188189574 X:27157331-27157353 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1188519563 X:31022532-31022554 GGGCTGTGTGGAGAGAGAGAGGG + Intergenic
1189082861 X:37992748-37992770 GAGCCCTGTGGAGAGACAGGAGG + Intronic
1189722786 X:43937337-43937359 GGGCACTGCGTTGAGAGGTGTGG - Intergenic
1190298397 X:49042069-49042091 GGGCACTGGGGTGAGCAGGGAGG + Intronic
1190417961 X:50199772-50199794 GGGGAGTGGGGAGAGAGGGGAGG - Intronic
1190457845 X:50643036-50643058 AGGCAGTGGGGAGAGAGAGGAGG + Intronic
1190621060 X:52287592-52287614 GGGCACTGATGAGAGTGGGAGGG + Intergenic
1190702581 X:52999666-52999688 GGGAGCTGGGGAGAGAGAGGAGG - Intergenic
1191053868 X:56222636-56222658 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
1191693239 X:63962305-63962327 GGGCAGAGTGGAGAGAGGTGAGG - Intergenic
1191778743 X:64845363-64845385 GGGTACTGGGGAGAGAGGTCAGG - Intergenic
1192449994 X:71238600-71238622 GGGGACTGTGGGGATAGGGAAGG - Intergenic
1192557653 X:72103208-72103230 GGCCACAGTGGAGGGAGTGGGGG + Intergenic
1192561178 X:72129051-72129073 GGGCAATGTGGTGAGAGGAAAGG + Exonic
1193424722 X:81328084-81328106 GGGCACACTGGTGTGAGGGGTGG - Intergenic
1193538113 X:82738236-82738258 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1194650777 X:96512284-96512306 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1195035165 X:100965584-100965606 GGGCACTCTGGTGTGAGGAGTGG - Intergenic
1195216853 X:102711988-102712010 GGGGACTGGGGAGAGGGAGGGGG + Intergenic
1195272233 X:103243138-103243160 AGGCACTGTTCACAGAGGGGTGG - Intergenic
1195964215 X:110415570-110415592 GGGTGCTGTGGGGAGATGGGTGG + Intronic
1196728886 X:118922016-118922038 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1197000243 X:121431561-121431583 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1198179893 X:134196380-134196402 GGGGCCTGTGGAGTGTGGGGAGG + Intergenic
1198301701 X:135339749-135339771 GGGCAAGGTGGAGCGAGGGAGGG - Intronic
1198664269 X:139004058-139004080 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1199356201 X:146866915-146866937 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1199669522 X:150131560-150131582 GGGGACTGTGGAGGGGTGGGGGG - Intergenic
1199996721 X:153030653-153030675 GGGCCCTTTGGAGGGAGGTGGGG - Intergenic
1200316425 X:155137289-155137311 GGGCACTGAGGGGAGGGGGAGGG - Intronic
1200969442 Y:9135164-9135186 GGGGACTGTGGTGGGATGGGGGG + Intergenic
1201188974 Y:11430357-11430379 GGGGACTGGGGGGAGAGGGGAGG - Intergenic
1201423003 Y:13820238-13820260 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1201479981 Y:14428418-14428440 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1201573071 Y:15434171-15434193 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1201774536 Y:17648735-17648757 GGGTACTGTGGACAGAGGAGGGG - Intergenic
1201827020 Y:18257254-18257276 GGGTACTGTGGACAGAGGAGGGG + Intergenic