ID: 1148052653

View in Genome Browser
Species Human (GRCh38)
Location 17:44776730-44776752
Sequence GGCGGGCACTGTGGAGAGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052653_1148052661 -2 Left 1148052653 17:44776730-44776752 CCCCTCTCTCCACAGTGCCCGCC 0: 1
1: 0
2: 0
3: 31
4: 386
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052653_1148052663 21 Left 1148052653 17:44776730-44776752 CCCCTCTCTCCACAGTGCCCGCC 0: 1
1: 0
2: 0
3: 31
4: 386
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1148052653_1148052658 -6 Left 1148052653 17:44776730-44776752 CCCCTCTCTCCACAGTGCCCGCC 0: 1
1: 0
2: 0
3: 31
4: 386
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052653_1148052664 29 Left 1148052653 17:44776730-44776752 CCCCTCTCTCCACAGTGCCCGCC 0: 1
1: 0
2: 0
3: 31
4: 386
Right 1148052664 17:44776782-44776804 GTGACCATGAGCAGGTATGATGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052653 Original CRISPR GGCGGGCACTGTGGAGAGAG GGG (reversed) Exonic
900387444 1:2417001-2417023 GGAGGGGTCTGTGGAGAGAGGGG + Intergenic
900389152 1:2426613-2426635 CGCCGGCACTCTGGAGACAGAGG - Intronic
900619550 1:3580547-3580569 GGCAGGGGCTCTGGAGAGAGAGG + Intronic
900649127 1:3722479-3722501 GCCAGGCACACTGGAGAGAGGGG - Intronic
901592177 1:10353755-10353777 GGCAGGGGCTGTGGAGAAAGAGG + Intronic
902378163 1:16039920-16039942 GCTGGGCACAGGGGAGAGAGGGG + Intergenic
902451853 1:16501270-16501292 AGAGGGGACTGTGGACAGAGCGG - Intergenic
902577899 1:17389858-17389880 GGCGGCCGGTGTGGAGCGAGTGG - Intronic
903331228 1:22598125-22598147 GGCGGGCAGTAGGGAGAGGGTGG - Intronic
904482402 1:30802151-30802173 AGCGGGCACTGTGGATCCAGAGG - Intergenic
904676101 1:32200103-32200125 GTCTGGCATTGTAGAGAGAGGGG + Intergenic
905018422 1:34792900-34792922 GGCGGGCGCTGGAGAGAGGGCGG - Intronic
906299303 1:44670556-44670578 GGTGGGCCCTGTGGTGGGAGAGG - Intronic
907523521 1:55040225-55040247 GGGGAGCACGGTGGAGAGCGGGG + Intronic
907877127 1:58501911-58501933 GGGGGGCAGTGAGGAGGGAGAGG - Intronic
908767316 1:67565685-67565707 GGCATGCAATGTGGAAAGAGGGG + Intergenic
908828667 1:68157803-68157825 GGAGGGCACTGAGTAGCGAGGGG - Intronic
912393204 1:109319228-109319250 GGGTGGCACTATGGAGAGATGGG - Intronic
912414164 1:109496964-109496986 GTCAGGCACTGTGGAAAGAAGGG + Intronic
912985225 1:114421236-114421258 GGCGGGGAATGCGGAAAGAGAGG + Intronic
913341052 1:117758603-117758625 GTCGGGCACTGGGGAGACAGAGG + Intergenic
914954112 1:152145640-152145662 GAGGGAGACTGTGGAGAGAGAGG + Intergenic
915430207 1:155860290-155860312 GGCGGCCTCTGGGGAAAGAGGGG + Intronic
915587519 1:156852184-156852206 GGGGCACACTGTGGGGAGAGTGG + Exonic
915897708 1:159824553-159824575 GGAGGGCTCTGTGGAGGGGGTGG - Intergenic
915936650 1:160093636-160093658 GGTGGGCACTGTGGCCACAGGGG - Intronic
917840240 1:178971581-178971603 GGCAGGGACTGAGGGGAGAGGGG - Intergenic
919895581 1:202007958-202007980 GGCAAGCTCTGTGGGGAGAGGGG + Exonic
920908607 1:210193540-210193562 TGGGGGCAGTGAGGAGAGAGTGG - Intergenic
921847879 1:219903459-219903481 GAAGAGCACTGTGGAGAAAGAGG + Intronic
922470735 1:225875642-225875664 GGCAGCCGCTGTGGACAGAGAGG - Intronic
922493871 1:226040795-226040817 AGTGGGCTCTGTGGAGAGTGGGG - Intergenic
922634927 1:227158849-227158871 GGAGGGAATTGTGCAGAGAGAGG - Intronic
1062913476 10:1229895-1229917 GTCTGGCACAGTTGAGAGAGGGG + Intronic
1062952237 10:1513414-1513436 GGAGGGCACTCTGGAGTGTGTGG + Intronic
1062971779 10:1654015-1654037 GGCTGGCTCTGTGGAGGTAGAGG + Intronic
1063134124 10:3201648-3201670 GGCGGGCACTGGGGACCGTGGGG + Intergenic
1065589851 10:27252830-27252852 GGCGGGCGCAGTGGAGGCAGTGG + Intergenic
1066464303 10:35639798-35639820 GGCGGGCACGGTGTAGAGCACGG + Exonic
1066984724 10:42454766-42454788 GGAGGGCACTGTGAAGTGTGGGG - Intergenic
1067686513 10:48469151-48469173 GGAGGGCACTCTGCAGAGACTGG - Intronic
1068444145 10:57098336-57098358 GGAGGCCACTGTGGTTAGAGTGG - Intergenic
1069627530 10:69877393-69877415 GCCGGGCAAGGTGGAGGGAGGGG - Intronic
1070128105 10:73638111-73638133 GGGGTGCACTGTGGAGATAATGG + Intronic
1070329856 10:75409216-75409238 GCAGGGCACTGGGGGGAGAGAGG - Intergenic
1070367600 10:75751292-75751314 GAGGGAGACTGTGGAGAGAGAGG + Intronic
1071449059 10:85777258-85777280 GGAGGGCCCAGGGGAGAGAGTGG - Intronic
1074137240 10:110638273-110638295 GCCGGGGAGTGTGGAGAGATGGG + Intergenic
1075567041 10:123512379-123512401 GGTGGGCACTGGGAAGAGAATGG - Intergenic
1075976564 10:126701273-126701295 GCCAGGCACAGTGTAGAGAGAGG + Intergenic
1076404666 10:130203853-130203875 GGCGGGCAGTGTAGAGAAGGTGG - Intergenic
1076763160 10:132615754-132615776 GGCGGGCTTTGAGGACAGAGTGG + Intronic
1076790533 10:132774821-132774843 GAGGGGCACGGAGGAGAGAGGGG + Intronic
1076790564 10:132774908-132774930 GAGGGGCACGGAGGAGAGAGGGG + Intronic
1076994085 11:289855-289877 GGGGGTCACTGGGCAGAGAGTGG - Exonic
1077081061 11:724958-724980 GGCGGGGACCCTGGAGAAAGGGG - Intronic
1077406528 11:2384712-2384734 GGATGGCTCTGTGGGGAGAGGGG + Intronic
1077906866 11:6541090-6541112 GCTGGGCACTGTGTGGAGAGAGG + Intronic
1078463572 11:11533591-11533613 AGGAGGCAGTGTGGAGAGAGTGG - Intronic
1078483538 11:11701308-11701330 TGAGGGCACTGTGGACAGAACGG - Intergenic
1078551816 11:12286264-12286286 GGGGGGCTCTGTGGGGAAAGGGG + Intronic
1079117889 11:17652161-17652183 GGCAGGGACTGTCGAGGGAGAGG - Intergenic
1081596129 11:44460834-44460856 TGGGGGCACTGTGAAGAGAGTGG - Intergenic
1081810086 11:45909626-45909648 GGCCAGCACTGGGGAGGGAGTGG - Intergenic
1082814842 11:57501036-57501058 AGCAGGCACTGTGGAGACACAGG + Exonic
1083406674 11:62462184-62462206 TGGGGGGACTGTGGTGAGAGAGG - Intronic
1087077743 11:94141445-94141467 GGTGGGCACTGGGGAGGGAGGGG - Intronic
1088489317 11:110371462-110371484 GGCTGGCACTGGGGATAGAGTGG - Intergenic
1088877246 11:113946163-113946185 TGCTGGCACTTAGGAGAGAGAGG + Exonic
1090948841 11:131454708-131454730 GGCGGGAGCAGTGGAGAAAGGGG + Intronic
1092236642 12:6814744-6814766 GGCAGTCACTGTGGAGGGAAAGG - Exonic
1092547684 12:9466244-9466266 GGCGGGGGCTTTGGAGAGAGGGG + Intergenic
1093366597 12:18307590-18307612 GGTGGGTAGTGTGGAGAGAAGGG - Intronic
1093524302 12:20089886-20089908 GGCAGGGACGGTGGAGAGAAAGG + Intergenic
1094486553 12:30930021-30930043 GACGGAGACTGTGGAGAGAAGGG + Intronic
1096386157 12:51196750-51196772 GGTGGGGACTGTGGAGAGGCTGG - Intronic
1096484122 12:51965995-51966017 GGAGGGGAGTGTGGAGATAGAGG + Intronic
1096707720 12:53432973-53432995 GGTGGGCACTGGGGAAAGAAGGG + Intergenic
1096753803 12:53782003-53782025 GAGGGGCACTGTGAAAAGAGAGG - Intergenic
1097008343 12:55934974-55934996 GGCGGGGTGTGAGGAGAGAGTGG + Intronic
1101163000 12:101998199-101998221 GCCGGGGACTGAGGAAAGAGAGG - Intronic
1101714582 12:107299697-107299719 GGCTGGTACTGTGGGGAGGGAGG - Intergenic
1101804502 12:108051646-108051668 GGCAGGAACTGAGGAGAGACTGG - Intergenic
1103339460 12:120213784-120213806 AGCAGGCAGTGGGGAGAGAGGGG - Intronic
1104749595 12:131229878-131229900 GGCGGGGACTGTGGGCAGGGAGG + Intergenic
1106321915 13:28647989-28648011 GGAAGGCAGTGTGGAGAGTGTGG + Intergenic
1106350226 13:28922682-28922704 GGCGGCCACTGTCAAGAGATGGG + Intronic
1106547518 13:30743501-30743523 GGAGGGCACTGGGGAGGGAATGG - Intronic
1107038438 13:35924064-35924086 GGGGAGCACTGGGGAGAGATGGG - Intronic
1107479639 13:40774910-40774932 GCCGGGCACTGTGTGGAGAGAGG - Intergenic
1108373465 13:49792697-49792719 GGCGGGAACGGTGCTGAGAGCGG + Exonic
1108747218 13:53408528-53408550 GGCGGGCACTGGGAAGAGTACGG + Intergenic
1111139300 13:84093311-84093333 GGTGGGCATTGAGGAGAGACTGG + Intergenic
1111333530 13:86792248-86792270 GGCGGGAGGTGTGGAGGGAGAGG + Intergenic
1112941877 13:104873318-104873340 AGCAGGCAATGTGGAGGGAGAGG - Intergenic
1116362352 14:44015770-44015792 AACAGGCATTGTGGAGAGAGAGG + Intergenic
1116959787 14:50957209-50957231 GAGGGAGACTGTGGAGAGAGAGG + Intergenic
1117297769 14:54394728-54394750 GCGGGGCAGTGTGGAGAGAGAGG - Intergenic
1118319733 14:64746202-64746224 GGCTGGCACCATGGAGACAGAGG - Exonic
1119371053 14:74143547-74143569 GGCGGACTATGTGGAGACAGAGG - Intronic
1119779879 14:77270651-77270673 GGCGCCCACGGTCGAGAGAGAGG + Intronic
1119789908 14:77340999-77341021 GGCAGTCAAAGTGGAGAGAGTGG - Exonic
1121143084 14:91558366-91558388 GAGGGGGACTGTGGGGAGAGGGG + Intergenic
1122007283 14:98716027-98716049 TGCAGGCACTGTGGAGGGACCGG - Intronic
1122324738 14:100875433-100875455 GGCAGCCAGTGTGGGGAGAGAGG + Intergenic
1122436622 14:101705712-101705734 GCTGGGCCCTGGGGAGAGAGAGG + Intergenic
1122459525 14:101883760-101883782 GGAGGGAGCTGTGGGGAGAGGGG - Intronic
1122626581 14:103088159-103088181 GGCGGACCCTGTGGAAAGTGGGG + Intergenic
1122652537 14:103233246-103233268 GGCAGGGAGTCTGGAGAGAGTGG - Intergenic
1122918688 14:104870743-104870765 GGCGGCCACTGAGGAGAGCTGGG - Intronic
1122936236 14:104957665-104957687 GCCGGACACTGCAGAGAGAGTGG + Exonic
1123090678 14:105740867-105740889 CTCGGGCCCTGTGGAGAGACTGG - Intergenic
1123096310 14:105768631-105768653 CTCGGGCCCTGTGGAGAGACTGG - Intergenic
1123632917 15:22274569-22274591 TGCAGGCCCTGTGGAGGGAGGGG - Intergenic
1125049235 15:35278289-35278311 GGCTGCCACTTTGGAGAGTGAGG + Intronic
1125717616 15:41828029-41828051 GGCGGGGACTCTGGGGAGGGCGG + Intergenic
1126849038 15:52786640-52786662 GGACGGCACTGTGGAGGGGGAGG - Intronic
1126860723 15:52880141-52880163 GCAGGCCAGTGTGGAGAGAGAGG + Intergenic
1127438635 15:58984189-58984211 GGTGGGAAATGTGGAGAAAGGGG + Intronic
1127842624 15:62844151-62844173 GGCCAGCACTGTGGAGAGATAGG - Exonic
1128226620 15:66006193-66006215 GGCTGGGACTGGGGAGAGATGGG + Intronic
1128233910 15:66054170-66054192 GGCAGGCACTTAGGAGACAGGGG - Intronic
1129052830 15:72796936-72796958 GGGTGGCAGTGTGGGGAGAGTGG + Intergenic
1129090392 15:73143539-73143561 GGCAGGCAGTGTGGACTGAGAGG + Intronic
1129236989 15:74229670-74229692 GGCTTGGACTGTGGAGAGGGAGG + Intergenic
1129254475 15:74326422-74326444 GGGGGTTGCTGTGGAGAGAGAGG - Intronic
1129330065 15:74822579-74822601 GGTGGGCTCTGAGAAGAGAGGGG + Intronic
1129381662 15:75171571-75171593 GGCGGGCTGTGTTGAGAGAGTGG - Intergenic
1129382809 15:75178548-75178570 GGCGGGCACTGTGGGGGGTGGGG + Intergenic
1132083935 15:98891310-98891332 TGGGCACACTGTGGAGAGAGAGG - Exonic
1132411147 15:101579023-101579045 GGTGGGCACTGCGGTGAGTGTGG - Intergenic
1132536215 16:482416-482438 AGAGGGCAGTGTGGAGGGAGGGG - Intronic
1132606791 16:796996-797018 GGGGGGCATTGGGGAGAAAGGGG + Exonic
1132802947 16:1763144-1763166 GGCAGGCAGTGTGCAGGGAGAGG - Intronic
1132841187 16:1979184-1979206 GGTGGGCACGGTGGGGGGAGGGG + Exonic
1132882998 16:2170597-2170619 GGGGGGCTGTGTGGAGGGAGAGG - Exonic
1133745985 16:8687104-8687126 TGGGTGCATTGTGGAGAGAGAGG + Intronic
1136508842 16:30723569-30723591 GGCTGAAGCTGTGGAGAGAGAGG - Exonic
1136540923 16:30927358-30927380 GGAGGACACGGTGGAGGGAGAGG + Exonic
1137345208 16:47651363-47651385 GGAGAGAACTGTGGACAGAGAGG - Intronic
1137439217 16:48483854-48483876 GAGGGAGACTGTGGAGAGAGAGG + Intergenic
1137539945 16:49355318-49355340 GGAGGACACTGTGGGGAGTGGGG + Intergenic
1137693798 16:50447955-50447977 GGGCAGCACTGTGGAGAGCGAGG - Intergenic
1137982476 16:53081538-53081560 GCTTGGCACTGTGGATAGAGTGG - Intronic
1139646960 16:68338501-68338523 TGAGGTCACTGTGGAGAGTGTGG + Intronic
1140516804 16:75549063-75549085 GGAGAGCAGGGTGGAGAGAGGGG + Intronic
1141157359 16:81606633-81606655 GCCAGGCACTGGGGAAAGAGTGG + Intronic
1141172701 16:81701301-81701323 GGAAGGAACTGGGGAGAGAGAGG + Intronic
1141502191 16:84451906-84451928 GGCCAGCACTGAGGAGAGAGGGG - Exonic
1141787363 16:86210707-86210729 AGCGGGCACTCTGCAGAGAATGG + Intergenic
1141949838 16:87333348-87333370 GGCAGGCACAGAGGAGGGAGGGG + Intronic
1142354287 16:89594975-89594997 AGCGGGCACCCTGGAGAGACTGG + Intronic
1142738691 17:1917823-1917845 GGCGGGCCCTGTAGGGACAGTGG + Intergenic
1142738699 17:1917851-1917873 GGCGGGCCCTGTAGGGACAGTGG + Intergenic
1142738725 17:1917969-1917991 GGCGGGCCCTGTAGAGACAGTGG + Intergenic
1142738752 17:1918087-1918109 GGCGGGCCCTGTAGGGACAGTGG + Intergenic
1142738788 17:1918233-1918255 GGCGGGCCCTGTAGGGACAGTGG + Intergenic
1143834849 17:9682884-9682906 TGCTCTCACTGTGGAGAGAGAGG - Exonic
1143879433 17:10018806-10018828 GGCAGGCACAGAGGAGTGAGAGG + Intronic
1144807813 17:17979224-17979246 GGAAGCCACTGTGGAGAGACAGG + Intronic
1146053386 17:29568945-29568967 GGCTGGGCCTGGGGAGAGAGAGG + Intronic
1146234362 17:31144613-31144635 GGACGCCATTGTGGAGAGAGAGG - Intronic
1146332327 17:31937373-31937395 GGCGGGAGCTGTGGAGGGGGTGG + Exonic
1146458302 17:33024141-33024163 GGCAGGGATTGTGGAGAGAGGGG + Intronic
1146508513 17:33425960-33425982 CGCAGGGACTCTGGAGAGAGAGG + Intronic
1146753910 17:35409163-35409185 GGAGGGCACTGGGGAGCGAGTGG - Intergenic
1147258971 17:39197656-39197678 GGCGGCGGCAGTGGAGAGAGCGG - Exonic
1147550644 17:41439152-41439174 GGAGGGCACTGGGCAGACAGGGG - Intronic
1148021949 17:44559085-44559107 GGCGGGCACTGTGTAGAGCACGG - Exonic
1148052653 17:44776730-44776752 GGCGGGCACTGTGGAGAGAGGGG - Exonic
1148330439 17:46810924-46810946 AGCGGGCTCTGGGGCGAGAGGGG - Intronic
1148386425 17:47238016-47238038 TGCTGGCTCTGTGGAGCGAGCGG + Intergenic
1148908825 17:50928952-50928974 GCCAGGCACTGTGCACAGAGGGG - Intergenic
1149026880 17:52036972-52036994 GGAGGGCAGTGAGCAGAGAGTGG + Intronic
1149647685 17:58252167-58252189 GGTGGGAACTGCAGAGAGAGTGG - Exonic
1149655491 17:58307755-58307777 CGCAGGGACTGTGGAGACAGTGG + Exonic
1151485193 17:74394595-74394617 GAGGGTCCCTGTGGAGAGAGGGG + Intergenic
1151524193 17:74652700-74652722 TGGGGGTAATGTGGAGAGAGAGG - Intergenic
1151820532 17:76494411-76494433 GGAGGGCACTGTGGTGGGTGGGG - Intronic
1152013448 17:77734886-77734908 GGAGGGCAGAGTGGGGAGAGAGG - Intergenic
1152138965 17:78525236-78525258 GGAGGGCACACTGGAGAGACGGG - Intronic
1152245353 17:79182459-79182481 GGCCTGCACTGGGGACAGAGGGG - Intronic
1152284877 17:79406545-79406567 GCCGGGAATTGTGGAGAGGGAGG + Intronic
1152539216 17:80966524-80966546 GGCAGGCACTGTGGCCACAGGGG + Intergenic
1152574598 17:81134507-81134529 GGAGAGCAGTGTGGTGAGAGTGG + Intronic
1152633115 17:81419548-81419570 GGCGGGCCCTGTGGGGAGCGGGG + Intronic
1152701542 17:81822227-81822249 GGAGGGCATTCTGGAGGGAGAGG - Intergenic
1155250853 18:23951862-23951884 GTCAGGCACTGTGGATGGAGGGG - Intronic
1155513165 18:26597349-26597371 GGAGGGCATTGTGCAGGGAGGGG + Intronic
1155999195 18:32366127-32366149 GGTGGGCAGGGTGGAGTGAGGGG - Intronic
1156243081 18:35272002-35272024 GCGGGGAGCTGTGGAGAGAGAGG - Intronic
1156526907 18:37776331-37776353 GGCTGGTCCTGTGGAGACAGGGG + Intergenic
1157577759 18:48754994-48755016 GGAGTGCACTGGGTAGAGAGAGG + Intronic
1159072191 18:63637868-63637890 GGAGGTCACTGAGGAGGGAGTGG - Exonic
1159425847 18:68285260-68285282 GGGGGGCACTGGGGAGGGTGGGG + Intergenic
1159428049 18:68314613-68314635 GGTGGGTAGTGTGCAGAGAGTGG - Intergenic
1160989713 19:1855524-1855546 GGAGGGGACTGTGGAGGAAGTGG - Intronic
1161109988 19:2463620-2463642 GGCAGGCACTGGGGGGACAGAGG + Intergenic
1161250164 19:3276038-3276060 GGCGGGGCCTGTGGGGAGGGTGG + Intronic
1161382883 19:3975771-3975793 GGATGGCCCTGTGGAGCGAGGGG - Intergenic
1161482162 19:4516671-4516693 GGCAGCCACTGTGGGGACAGGGG + Exonic
1161856294 19:6767658-6767680 GGCGGGGTCTATGGAGAAAGCGG - Intergenic
1161996113 19:7712530-7712552 GGCGGGGACTGGGGAGATGGTGG + Intergenic
1162065187 19:8121192-8121214 GGAGGGCATTGAGGAGAGGGAGG - Intronic
1162824827 19:13244984-13245006 GGAGGGCATTGTGGGGAGATGGG - Intronic
1163176462 19:15567028-15567050 GTCCGGGACTGAGGAGAGAGTGG - Intergenic
1163758456 19:19120505-19120527 GGCGGGGACTGTGGTGAGGCAGG - Intronic
1164597401 19:29539307-29539329 CGCGGGCACTGTGATGTGAGGGG + Intronic
1164615975 19:29666931-29666953 GGCGGCCCCTCTGGAGGGAGAGG + Intronic
1164667739 19:30052600-30052622 GGTGGGGACAGTGGAGACAGAGG + Intergenic
1165386534 19:35513489-35513511 GGAAGACACTCTGGAGAGAGAGG - Exonic
1165832410 19:38736234-38736256 GGCGGGCGCTGAGGGGCGAGCGG + Exonic
1165904208 19:39183732-39183754 GGCTGCCACTGGGGAGGGAGAGG + Intergenic
1167045778 19:47048034-47048056 GGCCACCACTGTGCAGAGAGCGG - Intronic
1167267973 19:48492997-48493019 GGCGGGGTCTGGGGAGAGACTGG - Intronic
1167622826 19:50568520-50568542 GGAGGGCAGCGTGGAGAGGGAGG + Intergenic
1168063609 19:53907536-53907558 GGCAGGCACTGGGGAGAGTTGGG - Exonic
1168136875 19:54357632-54357654 GGCGTGCACTGTGCAGAGGAGGG - Intronic
1168161207 19:54511459-54511481 GGCGTGCACTGTGCAGAGGAGGG + Intergenic
1168166607 19:54553003-54553025 GCCTGGCCCTGTGCAGAGAGCGG - Intergenic
1168458473 19:56534197-56534219 GGAGGGCACTCAGGTGAGAGGGG - Intergenic
925066378 2:931871-931893 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066395 2:931922-931944 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066412 2:931973-931995 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066461 2:932126-932148 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066478 2:932177-932199 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066495 2:932228-932250 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066512 2:932279-932301 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925066562 2:932433-932455 GGGGGGCATTGTGGAGGCAGAGG + Intergenic
925786492 2:7436172-7436194 GGCTCACACTGTGCAGAGAGAGG - Intergenic
926088511 2:10035222-10035244 GCTGGGCACTGGGGAGAGAGGGG - Intergenic
926111873 2:10188810-10188832 AGAGGGCGCTGCGGAGAGAGTGG + Intronic
926273426 2:11385448-11385470 GGCCGGCCATGTGGAGACAGAGG - Intergenic
929298459 2:40274001-40274023 AGCTGGGGCTGTGGAGAGAGGGG - Intronic
929872571 2:45771471-45771493 GCAGGGGACTGTGGAGAGAGAGG - Intronic
931243967 2:60477670-60477692 CGTGGGCACTGTGGAAACAGGGG + Intronic
936965744 2:118126093-118126115 GGAGGGCCCTTTGGACAGAGAGG - Intergenic
938104191 2:128519246-128519268 GGCGGGCGCATTGGAGATAGGGG + Intergenic
940835832 2:158520708-158520730 GGCTACCTCTGTGGAGAGAGGGG - Intronic
940896170 2:159083327-159083349 GGCAGGCCCTGTGGAGACACAGG - Intronic
941295658 2:163736179-163736201 GGCGGGCAGTGGAGAGAGACGGG + Intergenic
941997043 2:171610896-171610918 GGCAGGCACTGTGGGAAGTGTGG - Intergenic
942344709 2:174990334-174990356 GGCGGGCAAGATGGAGAGGGAGG + Intronic
942451188 2:176108723-176108745 GGCGGGCACAGGAGAGAGTGCGG - Intronic
943100178 2:183478568-183478590 GAGGGAGACTGTGGAGAGAGAGG - Intergenic
943577896 2:189652970-189652992 GAGGGAGACTGTGGAGAGAGAGG - Intergenic
944492929 2:200276672-200276694 GGCTGGCACTCTGGAGACTGAGG - Intergenic
946035132 2:216735931-216735953 GGATAGCAGTGTGGAGAGAGGGG + Intergenic
946428785 2:219613737-219613759 GAGGCTCACTGTGGAGAGAGGGG - Exonic
947274686 2:228377130-228377152 GTCAGGCACTGTGCAGGGAGCGG + Intergenic
947847878 2:233260102-233260124 GGCAGGAACTTTGGAGAGACAGG - Intronic
948164794 2:235852671-235852693 GGCAGGCCCTGGGGAGAGAAAGG - Intronic
948380187 2:237545182-237545204 GGAGGGCACAGTGGTGAGTGGGG + Intronic
948409046 2:237744933-237744955 GGTGGGCATGGTGCAGAGAGGGG - Intronic
948415430 2:237799234-237799256 GGCGGGGACTCTAGCGAGAGGGG + Intronic
948803216 2:240442116-240442138 GGAGGACACCGTGGAGGGAGGGG - Intronic
948829997 2:240594026-240594048 GGCAGGGGCTCTGGAGAGAGGGG + Exonic
948901652 2:240959423-240959445 GCGGGGCGATGTGGAGAGAGAGG + Intronic
1171346843 20:24471476-24471498 GGCGGGCGGTGGAGAGAGAGGGG - Intronic
1172175401 20:32969235-32969257 TGAGGGCACTGAGGAGAGTGTGG + Intergenic
1172610976 20:36252345-36252367 GTCGGGCGCTGTGCCGAGAGTGG + Intronic
1173062246 20:39673763-39673785 GGTGGGCACTCAAGAGAGAGAGG - Intergenic
1173666348 20:44766066-44766088 GGAGGGCACTGTGGTGGGGGAGG + Intronic
1173751813 20:45482329-45482351 AGGGGACACTATGGAGAGAGAGG - Intergenic
1173979105 20:47209077-47209099 GGTGGGCACACTGGAGAGAATGG - Intergenic
1175251470 20:57612615-57612637 GCCGGGCACTGTGGCAAGAGGGG - Intronic
1175366869 20:58461678-58461700 GGCAGGGAGTGAGGAGAGAGAGG - Intronic
1175825784 20:61936039-61936061 CGCGGGCACTGAGGAGAGGACGG + Intronic
1175836407 20:61998565-61998587 GGTGGGTACTGTGGAGTGGGAGG - Intronic
1176375496 21:6085196-6085218 GGCGGGCTCTGGGCAGAGAGAGG - Intergenic
1177717090 21:24852870-24852892 GACTGGCACTGTTGAGAGAAGGG + Intergenic
1178582794 21:33850391-33850413 GGTGGGCACAGAGGTGAGAGGGG - Intronic
1178873278 21:36393189-36393211 GAGGGAGACTGTGGAGAGAGCGG + Intronic
1179296742 21:40069714-40069736 GGCAGGGACTGTTGAGGGAGAGG - Intronic
1179488970 21:41728115-41728137 GGAGGGCACTGTGGAGGCGGCGG - Intergenic
1179573333 21:42291351-42291373 GGCGGGAGCTGTGGGGAGTGGGG + Intronic
1179747978 21:43453048-43453070 GGCGGGCTCTGGGCAGAGAGAGG + Intergenic
1179803185 21:43821605-43821627 GACGGAGACCGTGGAGAGAGAGG - Intergenic
1180911723 22:19455495-19455517 GGGTGGCACTGTGGAAGGAGGGG + Intronic
1182586244 22:31345839-31345861 GGCGGGCGGAGAGGAGAGAGTGG - Exonic
1182760860 22:32721274-32721296 GGTGGGCACAGAGGAAAGAGGGG + Intronic
1183698678 22:39437679-39437701 GGCTGGCAGGGTGGGGAGAGGGG + Intergenic
1184046565 22:41976178-41976200 GGTGGGCACCCTGGGGAGAGGGG - Intergenic
1184504552 22:44893011-44893033 GGCGGGCACCGTAAAGAAAGGGG - Intronic
1184694984 22:46134090-46134112 GGAAGGCGCTGTGGGGAGAGGGG - Intergenic
1184746563 22:46459563-46459585 TGCTGGCACTGTGGAGGGTGGGG - Intronic
1184784016 22:46663131-46663153 GGAGAACACTGTGGAGACAGAGG + Exonic
1184842897 22:47063046-47063068 GGCAGGCACGGTGGAGAAACAGG + Intronic
1184844252 22:47071425-47071447 GGAGGGCAGAGTGGGGAGAGAGG - Intronic
1184856699 22:47150277-47150299 GGAGGGCACTGGGGAGTGGGCGG + Intronic
1185032701 22:48453043-48453065 AGCGGGGACTGAGGAGAGACGGG + Intergenic
1185063670 22:48620231-48620253 TGCAGGCCCTGTGGAGGGAGAGG - Intronic
1185102254 22:48847207-48847229 GGCGGGTAGTGTGCAGAGACTGG - Intronic
949565795 3:5243457-5243479 GAGGGAGACTGTGGAGAGAGAGG + Intergenic
950164553 3:10784317-10784339 GGAGGGGAACGTGGAGAGAGTGG + Intergenic
950212145 3:11131678-11131700 GGAGGGGACTGGGGAGGGAGAGG - Intergenic
950569347 3:13790612-13790634 GGCAGGCAGTGTGGAGGGCGGGG - Intergenic
950666193 3:14496527-14496549 GACGGGCACCGTGCAGAGGGTGG - Exonic
953780965 3:45870107-45870129 AGCGGGCACTGGAGAGAAAGTGG - Intronic
953903021 3:46853866-46853888 GGCAGGCATTCTTGAGAGAGCGG + Intergenic
954397452 3:50300498-50300520 GGCAGGCACCGTGGTGTGAGCGG - Exonic
954982020 3:54754877-54754899 AGGGGGCATTTTGGAGAGAGGGG + Intronic
960019370 3:112932324-112932346 GGCTGGAAGTGTGGGGAGAGGGG - Intronic
961597367 3:128029117-128029139 GAGGGGAACTGTGGAGAGGGTGG - Intergenic
961674276 3:128555399-128555421 CGCGGGCGCTGCGGAGAGACCGG + Intergenic
964629335 3:158792934-158792956 GGCGGGGAGTGTGGAAACAGTGG - Intronic
966183073 3:177204274-177204296 GCCGGGAGCTGTAGAGAGAGAGG - Intergenic
967892219 3:194371529-194371551 GTCGGGCACTGTGCTGGGAGTGG + Intergenic
968132807 3:196201887-196201909 GGCGGGGAATGGGGAGAGGGGGG - Intronic
968746933 4:2365102-2365124 AGCGGGCAGCGTGGGGAGAGAGG + Intronic
969087645 4:4668276-4668298 GGGAGGCAATTTGGAGAGAGAGG - Intergenic
969486233 4:7473843-7473865 GGCGGGGTCTGGGGGGAGAGGGG + Intronic
969606593 4:8205152-8205174 GCCTGGCCCTGTGGACAGAGGGG - Exonic
971009575 4:22418583-22418605 GGGAAGTACTGTGGAGAGAGAGG + Intronic
974156704 4:58082759-58082781 GGTGGGCCCTGTGGAGACAGAGG - Intergenic
978306911 4:107339112-107339134 GTGGGGCAATTTGGAGAGAGGGG - Intergenic
978374574 4:108061217-108061239 GGGGGGTAGGGTGGAGAGAGAGG + Intronic
978588321 4:110296544-110296566 GGTGGGTACTGTGGGGAGACCGG + Intergenic
981695499 4:147555068-147555090 GGGGGACAATGTGGAGAAAGTGG - Intergenic
983525681 4:168758407-168758429 GAGGGCCACTGTGGAGAAAGTGG - Intronic
983583306 4:169330240-169330262 TGAGGGCCCAGTGGAGAGAGCGG - Intergenic
985104976 4:186491124-186491146 GGCGGGGACCGTGGAGACAAAGG - Intronic
985403638 4:189615593-189615615 TGCGGGAAGTGTGGAGGGAGAGG - Intergenic
985444642 4:190015312-190015334 GGCGGACAGGGTGGAGGGAGGGG - Intergenic
985530870 5:433293-433315 GGCAGGCCCTGGGGAGGGAGAGG - Intronic
986232625 5:5880681-5880703 GGCGGGCAGTGTGGGGAGGGTGG - Intergenic
986715832 5:10522956-10522978 GGAGGGCATTGGGGAGTGAGAGG + Intergenic
986736755 5:10673935-10673957 GGAGGGGTCTGCGGAGAGAGGGG + Intergenic
990968643 5:61478381-61478403 GGCAGCCACTGTGGACAGCGTGG + Intronic
993068894 5:83133934-83133956 GCGGGGCAGTGTGAAGAGAGAGG + Intronic
998067279 5:139169885-139169907 GAGGGAGACTGTGGAGAGAGAGG - Intronic
999208806 5:149869830-149869852 GGCAGGAACTGGGGAGAGGGAGG + Intronic
1000149936 5:158489997-158490019 GTGGGGCACTTTGGAGAGATTGG + Intergenic
1001569362 5:172719963-172719985 GGAGGGCAGGGTGCAGAGAGTGG - Intergenic
1001616166 5:173045287-173045309 GTGGGGAGCTGTGGAGAGAGGGG - Intergenic
1002341164 5:178517380-178517402 CACGGGCACTGTGGAGGGAGAGG + Intronic
1002647954 5:180671344-180671366 GGCAGGCACTCAGGATAGAGGGG + Intergenic
1002955607 6:1860450-1860472 GGTGGGGGCTGGGGAGAGAGAGG + Intronic
1002959715 6:1903780-1903802 GGAGGGCACTGAGGGGAGGGAGG - Intronic
1002964615 6:1951056-1951078 GGTGGGGAATGGGGAGAGAGTGG - Intronic
1003393229 6:5731340-5731362 GGAGGGCTATATGGAGAGAGAGG - Intronic
1003426212 6:5999877-5999899 GCCGGGAACTGTGGAGAGCAAGG - Intronic
1003690384 6:8347649-8347671 GGCAGGCACTGTGTAGAGTGTGG + Intergenic
1004167544 6:13270293-13270315 GGGGGGCACTGTTGGGAGGGTGG - Intronic
1004319683 6:14622592-14622614 GGTGGGCACTATGAAGGGAGAGG + Intergenic
1005248178 6:23912944-23912966 GGCGGGGACGGGAGAGAGAGAGG - Intergenic
1006073172 6:31511499-31511521 GGCTGTCACTGTAGAGGGAGCGG - Intergenic
1006073823 6:31516434-31516456 GGGTGGAACTGGGGAGAGAGAGG - Intergenic
1006295192 6:33167116-33167138 GGGGGTCCCTGTGGAGAGATGGG + Exonic
1006641688 6:35492595-35492617 GGCGGGGGGTGGGGAGAGAGTGG - Intronic
1007134310 6:39506904-39506926 GGAGGGCAGTGTGCAGAGGGAGG + Intronic
1007694964 6:43726112-43726134 GGCAGGCACTTTGGAGAGCCAGG + Intergenic
1007715149 6:43851402-43851424 ACCGGGCACTGGGCAGAGAGAGG + Intergenic
1009323922 6:62326937-62326959 GGCTGGCCCTGTAGAGGGAGTGG - Intergenic
1009413960 6:63395823-63395845 GGTGGGCACTGTGGAGAGCCTGG + Intergenic
1012350791 6:98248025-98248047 GGAGTGGACTGTGGAGGGAGGGG - Intergenic
1012500720 6:99885298-99885320 GGCGGGGACAGGGGAGAAAGTGG + Intergenic
1012998194 6:105994112-105994134 CGCGGGGACGGTGGAGAGGGAGG + Intergenic
1013231563 6:108165695-108165717 ATCTGGCACTCTGGAGAGAGGGG + Intronic
1014627918 6:123752159-123752181 GGCAGGGACTGGGGAGACAGAGG - Intergenic
1016559448 6:145378705-145378727 TGTGAGCACTGGGGAGAGAGTGG + Intergenic
1016979517 6:149841391-149841413 GCCAGGCACTGGGGATAGAGTGG - Intronic
1017381580 6:153837696-153837718 AGGGCGAACTGTGGAGAGAGAGG - Intergenic
1018481035 6:164190586-164190608 GGCCGGCACTGTGCAGGCAGAGG - Intergenic
1018690223 6:166338660-166338682 GGCAAGCACTGGGGAGAGGGTGG + Intronic
1019345122 7:526009-526031 TGTGGGCACGGTGGAGAGACGGG - Intergenic
1019475110 7:1240660-1240682 GGCGGGGGCTGTGGGGAGTGGGG + Intergenic
1019738624 7:2662249-2662271 GGAGGGCACTGCAGAGAGATGGG - Exonic
1020041063 7:5001957-5001979 GGAGGGCAGTGGGGAGAGTGGGG - Intronic
1020103488 7:5408704-5408726 GCCTGGCACAGTGGAGAGTGGGG + Intronic
1022508541 7:30921512-30921534 GGCAGGCACAGAGGAGAAAGAGG + Intronic
1025790175 7:64681256-64681278 GGAGGGCAGGGTGGAGTGAGTGG - Intronic
1026807077 7:73435362-73435384 GGCGGGCACCGTGTAGAGGATGG - Exonic
1031806536 7:126314715-126314737 GGAGGGAAGTGTGGAGAGAAAGG - Intergenic
1033589703 7:142798823-142798845 GGAGGTCACTGGGGAGACAGGGG + Intergenic
1033727075 7:144130014-144130036 GGAGGGCACTGAGGAAGGAGAGG + Exonic
1034273147 7:149812823-149812845 GGCTGGCTCTGTGCGGAGAGAGG - Intergenic
1034291200 7:149933073-149933095 GGCGTGCCCTGTAGTGAGAGGGG + Intergenic
1034814898 7:154163859-154163881 GGCGTGCCCTGTAGTGAGAGGGG - Intronic
1034865841 7:154641097-154641119 AGCGGGGACTGGGGAGTGAGAGG - Intronic
1035023147 7:155810326-155810348 GGGAGGCACTGCGGAGAGAGCGG - Intronic
1035114269 7:156509717-156509739 TGCGGGCAGTGAGAAGAGAGAGG - Intergenic
1035429498 7:158807979-158808001 GGCCTGCTCTCTGGAGAGAGAGG - Intronic
1037379411 8:18268504-18268526 GGTGGGCAGTCAGGAGAGAGTGG + Intergenic
1037499363 8:19470559-19470581 GGCAGGCACTGGGAAGCGAGTGG + Intronic
1038577453 8:28717291-28717313 AGTGGGCACTGTGTGGAGAGCGG + Exonic
1044944950 8:97381130-97381152 AGGGGGCTCAGTGGAGAGAGGGG - Intergenic
1045860543 8:106811245-106811267 GGTGGGAACTGTGGAGAAATGGG + Intergenic
1047201448 8:122771030-122771052 GGTGGGCAGTAGGGAGAGAGAGG + Intergenic
1049060430 8:140272338-140272360 GGTGGTCACAGTGGAGAGAGTGG + Intronic
1049439048 8:142600940-142600962 GGCTGCCACGGTGGAGGGAGGGG + Intergenic
1049661700 8:143822435-143822457 GGGGAGCACTGTTGGGAGAGAGG - Intronic
1049733080 8:144189142-144189164 GGCAGCCACTCTGGAGAGAGTGG + Intronic
1049847196 8:144808545-144808567 GCCGGGCACTGGGGAGGGAAAGG + Exonic
1051281209 9:15443148-15443170 GAGGGAGACTGTGGAGAGAGAGG + Intronic
1052754163 9:32523893-32523915 TGGTGGCATTGTGGAGAGAGAGG - Intronic
1054085737 9:60741954-60741976 GGGGGGCAGTGGGGAGGGAGGGG - Intergenic
1055495569 9:76851139-76851161 GGTGGGGACTGTGGGGACAGGGG + Intronic
1056296028 9:85193872-85193894 TGTGTGCACTGGGGAGAGAGTGG - Intergenic
1056974035 9:91234154-91234176 GGCTGATACAGTGGAGAGAGGGG - Intronic
1059996565 9:119915908-119915930 AGAGGGCACTGTGGAAAGACTGG - Intergenic
1060445949 9:123688424-123688446 GTCAGGCACTGAGTAGAGAGTGG + Intronic
1061133229 9:128719895-128719917 AACGGGCACTGTGGAGATGGGGG - Exonic
1061550973 9:131334524-131334546 GGCTTGCACTCTGGAGACAGAGG + Intergenic
1062192709 9:135256043-135256065 GGTGGCCAATGTAGAGAGAGGGG - Intergenic
1062207403 9:135344801-135344823 GGTGGTCACTGTGGTGAGAAAGG - Intronic
1062357645 9:136172410-136172432 CGCTGGCACTGTGGGGAGGGAGG + Intergenic
1062357655 9:136172441-136172463 GGCTGGCACTGTGGGGAGGGAGG + Intergenic
1062598894 9:137311385-137311407 GGCCTGCACAGTGGAGAGTGGGG - Intronic
1187097399 X:16162581-16162603 GGGGGGCTCTGTGATGAGAGGGG + Intergenic
1189344923 X:40233517-40233539 GGCAGGCAAAGGGGAGAGAGGGG - Intergenic
1189908791 X:45789006-45789028 GGCTGGGACTGTGGAGTGCGTGG - Intergenic
1190417962 X:50199775-50199797 GGAGGGGAGTGGGGAGAGAGGGG - Intronic
1191881632 X:65848577-65848599 GGGGAGCACTGTGGGGACAGAGG + Intergenic
1192948078 X:75987103-75987125 GGGGTGCACTGTGGGGACAGGGG - Intergenic
1195666062 X:107432505-107432527 GCCAGGCACTGGGGACAGAGTGG - Intergenic
1198233441 X:134715007-134715029 GACGAGGATTGTGGAGAGAGGGG - Intronic
1198276172 X:135097801-135097823 GGCCGGCACTGGGGAATGAGCGG + Intergenic