ID: 1148052654

View in Genome Browser
Species Human (GRCh38)
Location 17:44776731-44776753
Sequence AGGCGGGCACTGTGGAGAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052654_1148052661 -3 Left 1148052654 17:44776731-44776753 CCCTCTCTCCACAGTGCCCGCCT 0: 1
1: 0
2: 0
3: 26
4: 316
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052654_1148052658 -7 Left 1148052654 17:44776731-44776753 CCCTCTCTCCACAGTGCCCGCCT 0: 1
1: 0
2: 0
3: 26
4: 316
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052654_1148052664 28 Left 1148052654 17:44776731-44776753 CCCTCTCTCCACAGTGCCCGCCT 0: 1
1: 0
2: 0
3: 26
4: 316
Right 1148052664 17:44776782-44776804 GTGACCATGAGCAGGTATGATGG 0: 1
1: 0
2: 0
3: 9
4: 150
1148052654_1148052663 20 Left 1148052654 17:44776731-44776753 CCCTCTCTCCACAGTGCCCGCCT 0: 1
1: 0
2: 0
3: 26
4: 316
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052654 Original CRISPR AGGCGGGCACTGTGGAGAGA GGG (reversed) Exonic
900151881 1:1182471-1182493 AGGCTGGCCCTGGGGAGACAGGG + Intronic
900387443 1:2417000-2417022 GGGAGGGGTCTGTGGAGAGAGGG + Intergenic
902378162 1:16039919-16039941 AGCTGGGCACAGGGGAGAGAGGG + Intergenic
902404554 1:16175633-16175655 AGGTGGGGACTGTGGAGGGTGGG - Intergenic
904285970 1:29453496-29453518 AGGAGGGCACTCTGGGGAGACGG + Intergenic
904476684 1:30769545-30769567 AGGCGGGGACGGTGGAGAGCTGG - Intergenic
904613363 1:31737040-31737062 GTGCTGGCACTGTGCAGAGAAGG + Intronic
904906143 1:33898730-33898752 AGGAGGGCACTGTTGAGCCAGGG + Intronic
905387410 1:37614153-37614175 TGGCAGGCACTGTGGGCAGAGGG - Intronic
906248759 1:44295317-44295339 AGAGGAGCACTGTAGAGAGATGG - Intronic
907259997 1:53210861-53210883 TGGCTGGCTCTGTGGAGTGACGG - Exonic
908763780 1:67536267-67536289 CGGTGGGCAGAGTGGAGAGAAGG + Intergenic
908784410 1:67721051-67721073 AGGCCTGCAGTGTGGAGTGATGG - Intronic
911150117 1:94590349-94590371 AGGAGGGCCCTGGGGAGAGAGGG - Intergenic
912393205 1:109319229-109319251 TGGGTGGCACTATGGAGAGATGG - Intronic
912414163 1:109496963-109496985 GGTCAGGCACTGTGGAAAGAAGG + Intronic
912680879 1:111728002-111728024 AGGCAGGCACTGTCCTGAGAAGG + Intronic
913386143 1:118260193-118260215 AGGCTGGCCCTGAGGAGAGCTGG - Intergenic
913655027 1:120952425-120952447 AGGCGGGCCCTGGGAATAGAAGG - Intergenic
914006374 1:143736054-143736076 AGGCGGGCGCTGAGAATAGAAGG - Intergenic
914645211 1:149646585-149646607 AGGCGGGCCCTGGGAATAGAAGG - Intergenic
915243661 1:154541538-154541560 AGGTGAGAACAGTGGAGAGAGGG + Intronic
919914166 1:202129829-202129851 AGGGGGGCTTTGTGGAGAGAGGG - Exonic
922493872 1:226040796-226040818 AAGTGGGCTCTGTGGAGAGTGGG - Intergenic
1062913475 10:1229894-1229916 AGTCTGGCACAGTTGAGAGAGGG + Intronic
1063436805 10:6038694-6038716 AGGAGGGAACTGTGTAGAAAAGG + Intronic
1063512176 10:6656172-6656194 AGGAGGGGAATGTGGAGGGAAGG + Intergenic
1063817160 10:9788486-9788508 AAGAGGGAACTGTGGAGAAAAGG + Intergenic
1064370674 10:14749689-14749711 AAGAGGGCAATGGGGAGAGATGG - Intronic
1069621655 10:69841051-69841073 AGGGGGGCAGTGGGGAGGGATGG - Intronic
1069796193 10:71053385-71053407 AGGAGGCCACTGGGGAGACAAGG - Intergenic
1070466793 10:76732101-76732123 TGGTGGGCACTGAGAAGAGATGG - Intergenic
1072250989 10:93582205-93582227 TGGTGGGAACTGTGGAGAGAAGG + Intronic
1072260334 10:93664133-93664155 AGGCAGGCCCTGGGGAAAGATGG + Intronic
1072275194 10:93815953-93815975 GGAAGGGCACAGTGGAGAGAGGG + Intergenic
1072531166 10:96320828-96320850 AGGTGGGAACGGGGGAGAGAGGG + Intronic
1072797647 10:98368193-98368215 AGGCTGGCACTGCACAGAGATGG + Intergenic
1074137239 10:110638272-110638294 AGCCGGGGAGTGTGGAGAGATGG + Intergenic
1074774168 10:116754152-116754174 AGGCTGGCAATGTGGTGGGAGGG + Intergenic
1075082466 10:119393109-119393131 AGGGGGCCACTGTGGAGACATGG + Intronic
1075464778 10:122643159-122643181 AAGCGGGCAATGCGAAGAGATGG - Exonic
1075799200 10:125142259-125142281 AGGATGGCACTGGGGAGAGGAGG + Intronic
1076181284 10:128410743-128410765 TGGTGGGTACTGTGCAGAGAAGG - Intergenic
1076659362 10:132045096-132045118 AGGCAGGCACTGTGGAAAACGGG - Intergenic
1076790532 10:132774820-132774842 AGAGGGGCACGGAGGAGAGAGGG + Intronic
1076790563 10:132774907-132774929 AGAGGGGCACGGAGGAGAGAGGG + Intronic
1077192493 11:1261260-1261282 AGCAGGCCACTGTGGACAGAAGG + Intronic
1077433214 11:2526251-2526273 AGGTGGGCACTGTGGTCAGGGGG + Intronic
1077637478 11:3853729-3853751 TGGTGGGGACTGTGGAGAGCAGG - Intergenic
1078068036 11:8090650-8090672 AGGCAGACACGGTGCAGAGAGGG - Intronic
1078487737 11:11739741-11739763 AGGGGGGCACGGTGGAGGCATGG + Intergenic
1079942385 11:26697707-26697729 AGGCAGGCATTGTGGAAATAAGG + Intronic
1083420815 11:62552043-62552065 AAAAGGGGACTGTGGAGAGAAGG - Intronic
1083441261 11:62678277-62678299 AGACGTGTACTGGGGAGAGATGG + Intronic
1084087098 11:66859772-66859794 AGGCCGGCAGCGTGGAGAAATGG - Exonic
1085363228 11:75911667-75911689 GGGCTGGCACTGTGGTGGGAGGG + Intronic
1087077744 11:94141446-94141468 AGGTGGGCACTGGGGAGGGAGGG - Intronic
1087784409 11:102338781-102338803 AGTCTGGCATTGTGGAAAGATGG + Intronic
1088760200 11:112922322-112922344 AGTGGGGAACTGGGGAGAGAGGG + Intergenic
1089623068 11:119733785-119733807 AGGAGGGGAGTGAGGAGAGAGGG + Intergenic
1090873692 11:130770179-130770201 AGATGGGCAATGTGGAAAGATGG - Intergenic
1091453135 12:586194-586216 AGGAGGGCCCTGTGCTGAGAAGG - Intronic
1092547683 12:9466243-9466265 TGGCGGGGGCTTTGGAGAGAGGG + Intergenic
1093366598 12:18307591-18307613 AGGTGGGTAGTGTGGAGAGAAGG - Intronic
1093905695 12:24689613-24689635 AGTCATGCAGTGTGGAGAGAAGG + Intergenic
1094486552 12:30930020-30930042 GGACGGAGACTGTGGAGAGAAGG + Intronic
1094634458 12:32211824-32211846 AGCAGGCCACTGTGGGGAGAGGG + Intronic
1096707719 12:53432972-53432994 TGGTGGGCACTGGGGAAAGAAGG + Intergenic
1097251889 12:57639056-57639078 AGGCATGCAGTGGGGAGAGAGGG - Intergenic
1101306803 12:103536503-103536525 AGGATGGCACTTTGGAGAGAAGG + Intergenic
1102010369 12:109614607-109614629 AGATGGGCACAGTGGAGAGCTGG + Intergenic
1102189067 12:110972319-110972341 ACACGGGCACTTTGGAGATAAGG + Intergenic
1102439233 12:112948777-112948799 GGGCGGGAGCTGGGGAGAGAAGG + Intronic
1102585092 12:113917231-113917253 AGGCTGGCTCTCTGGAGATAGGG + Intronic
1102744997 12:115242616-115242638 AGGCGGGGACCTTGGAAAGAAGG - Intergenic
1102828496 12:115972119-115972141 AGGCAGGCACTAAGGATAGAAGG + Exonic
1104466370 12:128994057-128994079 AAGATGGCAATGTGGAGAGAGGG - Intergenic
1104804958 12:131583136-131583158 AGACGGACACAGTGCAGAGACGG - Intergenic
1105509337 13:21038134-21038156 AGGAGGGTACTGTGCAGGGAAGG + Intronic
1106350225 13:28922681-28922703 AGGCGGCCACTGTCAAGAGATGG + Intronic
1107038439 13:35924065-35924087 TGGGGAGCACTGGGGAGAGATGG - Intronic
1107443512 13:40449346-40449368 AGGCAGGCCCTGTGAAGATAGGG - Intergenic
1113607030 13:111616147-111616169 TGGGGAGGACTGTGGAGAGACGG + Intronic
1115499784 14:34039086-34039108 ATGGGTGAACTGTGGAGAGATGG - Intronic
1118844502 14:69536794-69536816 AGGCGGTCACAGGGGAGAAATGG - Intergenic
1118887256 14:69878002-69878024 ATGGGGCCAGTGTGGAGAGAGGG + Intronic
1120007923 14:79380938-79380960 AGGCTGGAAGTGTGGGGAGAAGG + Intronic
1121143083 14:91558365-91558387 AGAGGGGGACTGTGGGGAGAGGG + Intergenic
1122392462 14:101399672-101399694 AGGCGGGTAATGTAGAGGGAGGG - Intergenic
1122459526 14:101883761-101883783 AGGAGGGAGCTGTGGGGAGAGGG - Intronic
1122626580 14:103088158-103088180 AGGCGGACCCTGTGGAAAGTGGG + Intergenic
1122655737 14:103258331-103258353 GGGCGGGCAGGGTGGGGAGAGGG - Intergenic
1122918689 14:104870744-104870766 GGGCGGCCACTGAGGAGAGCTGG - Intronic
1127622831 15:60751013-60751035 AGGCAGGCAGTGAGGAGAGCAGG + Intronic
1128226619 15:66006192-66006214 AGGCTGGGACTGGGGAGAGATGG + Intronic
1128233911 15:66054171-66054193 AGGCAGGCACTTAGGAGACAGGG - Intronic
1128910270 15:71507570-71507592 AGGTGGGGGCTGAGGAGAGAAGG + Intronic
1129330064 15:74822578-74822600 AGGTGGGCTCTGAGAAGAGAGGG + Intronic
1129360244 15:75019917-75019939 AAGGGGGCTCTGGGGAGAGAAGG - Exonic
1129382808 15:75178547-75178569 GGGCGGGCACTGTGGGGGGTGGG + Intergenic
1130182548 15:81645257-81645279 AGGAGGGCTCCTTGGAGAGATGG - Intergenic
1130223676 15:82043081-82043103 AGGCGAGCGCTGGGGAAAGAGGG + Exonic
1130984324 15:88834717-88834739 AGGCATGCACCGTGGAGGGAAGG + Intronic
1132951003 16:2562442-2562464 AGCCGGGTGCTGGGGAGAGACGG - Intronic
1132963346 16:2637728-2637750 AGCCGGGTGCTGGGGAGAGACGG + Intergenic
1133147193 16:3797125-3797147 AGGCAGGCACTGAGGATGGAGGG + Intronic
1133530756 16:6653018-6653040 AGGAGGCCACTGTGGTTAGAGGG - Intronic
1136591686 16:31221527-31221549 AGAAGGGCATTGTGGGGAGAAGG + Intronic
1136591691 16:31221544-31221566 AGAAGGGCATTGTGGGGAGAAGG + Intronic
1136591696 16:31221561-31221583 AGAAGGGCACTGCGGGGAGAAGG + Intronic
1136591725 16:31221684-31221706 AGAAGGGCATTGTGGGGAGAAGG + Intronic
1136591736 16:31221738-31221760 AGAAGCGCACTGTGGGGAGAAGG + Intronic
1136591760 16:31221843-31221865 AGAAGGGCATTGTGGGGAGAAGG + Intronic
1136913405 16:34161715-34161737 AGGCGGGCAGTGTGTACATAGGG - Intergenic
1137777917 16:51071849-51071871 AGGAGGACACTGTAGAGAGTTGG - Intergenic
1140516803 16:75549062-75549084 AGGAGAGCAGGGTGGAGAGAGGG + Intronic
1140661107 16:77191768-77191790 AGGAGGTCACTGTGGACACATGG + Intronic
1141502192 16:84451907-84451929 GGGCCAGCACTGAGGAGAGAGGG - Exonic
1141949837 16:87333347-87333369 AGGCAGGCACAGAGGAGGGAGGG + Intronic
1142131445 16:88433292-88433314 AAGGGGGCACTGTGGAAGGAGGG + Exonic
1142682959 17:1561383-1561405 AGCCGTGAACTGAGGAGAGATGG - Intronic
1142715527 17:1745161-1745183 AGGGGAGAACTGTGGAGAAAGGG - Exonic
1143520774 17:7443093-7443115 TCGGGGACACTGTGGAGAGAAGG - Exonic
1143640004 17:8190340-8190362 ACGCCGGCAGGGTGGAGAGAAGG + Exonic
1144373044 17:14611199-14611221 AGGTAGCCACTGTGGAGAGTGGG + Intergenic
1144688677 17:17244333-17244355 AGGAGGGCACAGTGGGAAGATGG + Intergenic
1145847175 17:28050525-28050547 AGGCGGGCAATGATGAGAAAAGG + Intronic
1146458301 17:33024140-33024162 GGGCAGGGATTGTGGAGAGAGGG + Intronic
1146472500 17:33135669-33135691 AGGGAGGCCCTGTGTAGAGAAGG + Intronic
1148052654 17:44776731-44776753 AGGCGGGCACTGTGGAGAGAGGG - Exonic
1148238160 17:45983110-45983132 AGGCGGGGACTGGGCCGAGAAGG + Intronic
1148442754 17:47720335-47720357 AGCCGGGCAGTGTGGTGAGGGGG - Intergenic
1148751868 17:49949981-49950003 AGAAGGGCAGTGTGGACAGAAGG - Intergenic
1150145282 17:62763973-62763995 AGGCCCACACTGAGGAGAGAAGG + Intronic
1150481368 17:65514016-65514038 ATGAGGGTACTGTGAAGAGAAGG + Intergenic
1150641421 17:66952513-66952535 AGGGTGGCAGTGTGGAGAGGAGG - Intergenic
1151485192 17:74394594-74394616 AGAGGGTCCCTGTGGAGAGAGGG + Intergenic
1152138966 17:78525237-78525259 GGGAGGGCACACTGGAGAGACGG - Intronic
1152245354 17:79182460-79182482 AGGCCTGCACTGGGGACAGAGGG - Intronic
1152333082 17:79684869-79684891 CGAGGGGCACTGTGGAGAGAGGG - Intergenic
1152539215 17:80966523-80966545 AGGCAGGCACTGTGGCCACAGGG + Intergenic
1152633114 17:81419547-81419569 GGGCGGGCCCTGTGGGGAGCGGG + Intronic
1155513164 18:26597348-26597370 AGGAGGGCATTGTGCAGGGAGGG + Intronic
1155935985 18:31754588-31754610 AGACTGGAACTGTGGGGAGAGGG + Intergenic
1155999196 18:32366128-32366150 AGGTGGGCAGGGTGGAGTGAGGG - Intronic
1157481869 18:48060359-48060381 AGATGGCTACTGTGGAGAGAGGG - Intronic
1157503037 18:48204082-48204104 AGGGAGGCACTGCAGAGAGAAGG - Intronic
1157894174 18:51448256-51448278 ATGTGGCCACTGTGGAGGGATGG - Intergenic
1159684659 18:71403125-71403147 AGGCAGGAACTCTAGAGAGAAGG + Intergenic
1160828059 19:1089863-1089885 AGGTGAGCCCTGTGGGGAGAAGG - Exonic
1161984808 19:7647340-7647362 AAGCGGGCACTGTGCAGGGCAGG - Exonic
1162582661 19:11540152-11540174 GGGGGGGGACAGTGGAGAGAGGG + Intronic
1162617093 19:11810750-11810772 AGGCGGGCACTGTGTTGGGATGG + Intergenic
1162788671 19:13051913-13051935 AGGCGGGCGCTGTGAGGAGGAGG - Intronic
1162824828 19:13244985-13245007 AGGAGGGCATTGTGGGGAGATGG - Intronic
1162926615 19:13933394-13933416 CGGCGGGCACTGTGGTCAGCTGG + Exonic
1163116443 19:15191724-15191746 AGGTGGGCACTGCGGCCAGAGGG - Exonic
1163287055 19:16355467-16355489 GGGATGGCACAGTGGAGAGACGG + Exonic
1164763056 19:30742704-30742726 AGGCTGGCCCTGTGGACGGATGG + Intergenic
1165148774 19:33749145-33749167 AGGCGGGACCTGTGGTGAGGTGG - Intronic
1165760001 19:38315551-38315573 AGGCGGGTACTGGGGAGCCACGG + Intronic
1166044600 19:40222639-40222661 AGGCGAGCACCGGGGAGAGGTGG + Exonic
1166133708 19:40762887-40762909 CGGCATGCCCTGTGGAGAGAGGG - Exonic
1166982383 19:46639004-46639026 GGGAGGGCGCTGCGGAGAGAGGG + Intergenic
1168063610 19:53907537-53907559 TGGCAGGCACTGGGGAGAGTTGG - Exonic
1168136876 19:54357633-54357655 TGGCGTGCACTGTGCAGAGGAGG - Intronic
1168161206 19:54511458-54511480 TGGCGTGCACTGTGCAGAGGAGG + Intergenic
925939284 2:8799959-8799981 AGGCAGGCACAGTGGGGAAAAGG + Intronic
926053692 2:9761176-9761198 AGGTGGCCGCGGTGGAGAGAAGG + Intergenic
926088512 2:10035223-10035245 GGCTGGGCACTGGGGAGAGAGGG - Intergenic
928321318 2:30284690-30284712 AGGCAGGCAGTTTGGAGGGAAGG - Intronic
928595689 2:32856967-32856989 AGGTGGGCACTGGGCAGAGGGGG - Intergenic
928786931 2:34899260-34899282 AGTCTGGAACTGTGCAGAGAGGG - Intergenic
929489711 2:42385371-42385393 AGGCAGGGACTGTGGAAAGAGGG + Intronic
934640057 2:96022565-96022587 AGGCCAGCCCTGTGGAGTGATGG + Intronic
934793593 2:97082839-97082861 AGGCCAGCCCTGTGGAGTGATGG - Intergenic
935336506 2:102021792-102021814 TGGCAGGCACTTTGGAGAGGTGG + Intronic
936039589 2:109140114-109140136 AGGAGGGGACGGTGGACAGAGGG - Intronic
937490681 2:122364094-122364116 GGGCTGGCAGTGTAGAGAGAGGG - Intergenic
938548235 2:132353661-132353683 AGGCGGGCCCTCAGGAGGGAAGG + Intergenic
941295657 2:163736178-163736200 AGGCGGGCAGTGGAGAGAGACGG + Intergenic
945035772 2:205702847-205702869 AGCTGGACACTGTGGAGGGAGGG - Intronic
945333958 2:208570005-208570027 CTGCGGGTACTGTGGAGAGCAGG + Intronic
946566767 2:220974142-220974164 AGGAGGGGAATGTGGAGGGAAGG + Intergenic
947344037 2:229172536-229172558 AGACGTGCACTGAGGAAAGAGGG - Intronic
947854278 2:233312828-233312850 GGGAGGGCACTGAGGAGGGAAGG - Intronic
948125296 2:235560576-235560598 AGTCGGGGACTGTGGAAGGAGGG + Intronic
948409047 2:237744934-237744956 AGGTGGGCATGGTGCAGAGAGGG - Intronic
948430122 2:237913522-237913544 AGGGGGGAACAGAGGAGAGAAGG - Intergenic
948466556 2:238154723-238154745 CGCCGGGCACTGGGGAGGGACGG - Intergenic
948669464 2:239558765-239558787 AGGCGGGGACTGAAGAGAGTCGG - Intergenic
948962802 2:241354664-241354686 AGGCTGGCAGTCTGGAGGGAAGG - Intergenic
949077945 2:242073302-242073324 GGGTGGGCAGTGTGGAGGGAGGG + Intergenic
1169384429 20:5136151-5136173 AGGCATGGACTGTGGAGATATGG - Intronic
1169705214 20:8495858-8495880 AAGAAGGCAATGTGGAGAGATGG - Intronic
1172237544 20:33388594-33388616 AGACGGAGACTGTGGGGAGAGGG - Intronic
1172853519 20:37983631-37983653 AGGAAGACGCTGTGGAGAGATGG + Exonic
1175251471 20:57612616-57612638 TGCCGGGCACTGTGGCAAGAGGG - Intronic
1175796432 20:61774137-61774159 GGGCCGGCTCTGTGCAGAGAAGG - Intronic
1175892304 20:62321228-62321250 AGGCGGGGCCTGTGGAGGGGTGG + Intronic
1176101648 20:63367167-63367189 AGGCAGGGAGTGTGGAGGGAGGG - Intronic
1176167496 20:63681742-63681764 AGACGGCCACAGTGGAGGGAGGG - Intronic
1176267886 20:64220264-64220286 ACGTGGGCACTGTGGAGGCATGG + Intronic
1177717089 21:24852869-24852891 TGACTGGCACTGTTGAGAGAAGG + Intergenic
1179906027 21:44423814-44423836 AGGAGGGCTCTGAGGAGTGATGG + Intronic
1180006092 21:45021400-45021422 AGGCGATCCCAGTGGAGAGAGGG - Intergenic
1180115135 21:45698227-45698249 AGGTGGGCACTTTGGAGAAGGGG - Intronic
1183081896 22:35462208-35462230 AGGCGGGCAGTGTGGGAAGGAGG - Intergenic
1183111013 22:35648602-35648624 AGGAGAGCTCCGTGGAGAGAAGG + Exonic
1183219718 22:36504771-36504793 AGGCGGGGACAGAGGAAAGATGG + Intronic
1183553990 22:38510758-38510780 AGGTGGGGAAAGTGGAGAGAAGG + Intergenic
1183698677 22:39437678-39437700 AGGCTGGCAGGGTGGGGAGAGGG + Intergenic
1184046566 22:41976179-41976201 AGGTGGGCACCCTGGGGAGAGGG - Intergenic
1184478147 22:44732390-44732412 AGGTGGGCACAGTGGGCAGAGGG + Exonic
1184504553 22:44893012-44893034 AGGCGGGCACCGTAAAGAAAGGG - Intronic
1184716057 22:46282410-46282432 AGGTGGGCCCTCTGGACAGACGG + Intronic
1184865089 22:47197830-47197852 AGGCAGCCACTGTCGAGCGAGGG + Intergenic
1185032700 22:48453042-48453064 AAGCGGGGACTGAGGAGAGACGG + Intergenic
1185179685 22:49352019-49352041 AGGCGGGCACCGTGCAGCCACGG - Intergenic
950197812 3:11021683-11021705 AGGCGGCCAATGCGGAGAGGAGG + Intronic
950576867 3:13837326-13837348 TGCGGGGCACTGTGGAGAGGGGG - Intronic
950950624 3:16994805-16994827 TGGTGAGCACTGTGGAGAGCAGG - Intronic
952132072 3:30375799-30375821 AGGTGGGCATTGTACAGAGAAGG + Intergenic
953375233 3:42422719-42422741 AGGCAGGCTCTGAGGAGAGCAGG + Intergenic
954685941 3:52370265-52370287 AGGAGAGCAGTGTGGGGAGAGGG - Intronic
954982019 3:54754876-54754898 AAGGGGGCATTTTGGAGAGAGGG + Intronic
955626677 3:60926986-60927008 AGGGGGGCACCGTGGAAAGCGGG - Intronic
958720471 3:97837303-97837325 AGGTGGGCTCTGTGGTGAGGAGG + Intronic
960937234 3:122911676-122911698 AGGTGGGGTCTGAGGAGAGAGGG - Intronic
964488538 3:157210152-157210174 ACACAGGCACTGTGGGGAGAAGG - Intergenic
966562292 3:181336287-181336309 AAGCGGGGAGGGTGGAGAGAGGG + Intergenic
968565971 4:1313025-1313047 AGTGGGGCCCAGTGGAGAGAAGG + Intronic
968830355 4:2930425-2930447 AGGCTGCCACTGTGCAGAGGGGG + Intergenic
969853275 4:9979059-9979081 ATGTGGGCGCTCTGGAGAGAAGG - Intronic
974415102 4:61596070-61596092 AAGAGGGCACTGAGGAGAGCAGG - Intronic
977580137 4:98715983-98716005 AGACAAGCACTGTGGAGAGGTGG + Intergenic
978194701 4:105957340-105957362 TGGCGGGCACTAAGGAGACAGGG - Intronic
984766204 4:183402390-183402412 AGGCAGGCACTGGGCAGAGAGGG - Intergenic
984863121 4:184257323-184257345 AGGCAGGCAGTGGGGAGGGAGGG + Intergenic
984863144 4:184257399-184257421 AGGCAGGCAGTGGGGAGGGAGGG + Intergenic
985636186 5:1036942-1036964 AGGCGGGCAGTGTGGACGGCGGG + Intronic
986736754 5:10673934-10673956 AGGAGGGGTCTGCGGAGAGAGGG + Intergenic
988354165 5:30151428-30151450 ATGCAGGAACTATGGAGAGATGG - Intergenic
991438188 5:66617724-66617746 AGGGGTGGATTGTGGAGAGAGGG - Intronic
993491612 5:88558329-88558351 AGGGGGGCAGTGGGGAGTGATGG + Intergenic
993496459 5:88615276-88615298 AGAGGGAGACTGTGGAGAGAGGG - Intergenic
994353975 5:98774414-98774436 AGGCGGGGAGGGTGGAGAGAAGG - Intronic
994651037 5:102528781-102528803 TGGTAAGCACTGTGGAGAGATGG + Intergenic
996010389 5:118475896-118475918 AGATGGGCACTGTGGAGCAATGG + Intergenic
996523321 5:124451060-124451082 AGGGGGGCACTCTGGACAAAGGG - Intergenic
996957739 5:129204897-129204919 AGGTGGGCAAGGGGGAGAGAGGG + Intergenic
997209466 5:132068964-132068986 GGGAGGGCACTGTGGTGGGAAGG + Intergenic
998016049 5:138733255-138733277 AGGTGGGTGCTGAGGAGAGAAGG + Intronic
1001101487 5:168818135-168818157 GCAAGGGCACTGTGGAGAGATGG - Intronic
1001279096 5:170373189-170373211 AGGAAAGCACTGTGGAGAGGAGG + Intronic
1001591960 5:172871754-172871776 TGGCGGGCAGTGGGGTGAGAAGG + Intronic
1001694992 5:173663467-173663489 AGGCGGGCTCTGTAGTCAGAAGG - Intergenic
1002972985 6:2043463-2043485 AGGTGGGAGCTGTGGAGACAGGG - Intronic
1003031586 6:2605808-2605830 AGGTGGGGAATGTGGAAAGATGG - Intergenic
1003835322 6:10065636-10065658 AGGTAGGCACTCTAGAGAGAAGG + Intronic
1004545614 6:16595669-16595691 AGGCAGGCAGTGAGGGGAGAGGG + Intronic
1004657380 6:17676820-17676842 AGTAGGGAACTGTGCAGAGAGGG + Intronic
1004902816 6:20209835-20209857 TGGGGGCCACTGTGAAGAGATGG + Intronic
1006257550 6:32843792-32843814 AGGCGGGCGCTGAGGAGTGGAGG - Intronic
1006295191 6:33167115-33167137 TGGGGGTCCCTGTGGAGAGATGG + Exonic
1006883298 6:37358156-37358178 AGGCTGGCACTTCGGGGAGATGG + Intronic
1007304253 6:40892003-40892025 AGGAGGGCCCTGGGGAGAGCAGG + Intergenic
1007614079 6:43170515-43170537 AGGCGGGCAGGGAGGAGAGACGG - Intergenic
1010030649 6:71267371-71267393 AGGGGGAGACTGTGGGGAGAGGG + Intergenic
1017155596 6:151320206-151320228 AGGCGGGACCAGTGGACAGATGG - Intronic
1018057897 6:160068374-160068396 AGGCTGGCACTGGTGAGAGAGGG + Exonic
1018057922 6:160068494-160068516 AGGCTGGCACTGGTGAGAGAGGG + Intronic
1018057954 6:160068674-160068696 AAGCTGGCACTGGTGAGAGAGGG + Intronic
1018057964 6:160068734-160068756 AGGCTGGCACTGGTGAGAGAGGG + Intronic
1019168185 6:170112900-170112922 AGGCAGTCACTGTGCAGAGAAGG - Intergenic
1019345123 7:526010-526032 CTGTGGGCACGGTGGAGAGACGG - Intergenic
1019738625 7:2662250-2662272 AGGAGGGCACTGCAGAGAGATGG - Exonic
1022129953 7:27395837-27395859 AGTCGAGCACTGTTGAGAGCCGG - Intergenic
1023299765 7:38757714-38757736 ATGGGGGCACTGAGGAGAGGTGG + Intronic
1023935560 7:44737522-44737544 AGGTGGGCAGGGAGGAGAGAAGG - Intergenic
1023972099 7:44999604-44999626 AGGCGGCCACTGTTGAGGGGCGG - Intronic
1024014213 7:45296426-45296448 AGGCAGGCATTGAGGAGACAAGG - Intergenic
1024458515 7:49635762-49635784 AAGCTGGCAGTGTGTAGAGATGG - Intergenic
1025280276 7:57621828-57621850 AGGAAGGAACTGGGGAGAGAGGG - Intergenic
1025304457 7:57843673-57843695 AGGAAGGAACTGGGGAGAGAGGG + Intergenic
1026732153 7:72921373-72921395 AGGAGGGCACTATGCAAAGAGGG - Intronic
1027111814 7:75445990-75446012 AGGAGGGCACTATGCAAAGAGGG + Intronic
1027284044 7:76630521-76630543 AGGAGGGCACTATGCAAAGAGGG + Intergenic
1028482102 7:91318084-91318106 AGGTGGGCTATCTGGAGAGATGG + Intergenic
1028602128 7:92613569-92613591 AGGCTGGCTCTGTAGAGAGCAGG + Exonic
1029517096 7:101031377-101031399 AGGCAGGGACTGTGGAGGAAAGG + Intronic
1031493132 7:122413505-122413527 AAACTGCCACTGTGGAGAGAGGG + Intronic
1033589702 7:142798822-142798844 AGGAGGTCACTGGGGAGACAGGG + Intergenic
1034291199 7:149933072-149933094 AGGCGTGCCCTGTAGTGAGAGGG + Intergenic
1034384402 7:150726905-150726927 AGATAGGCAATGTGGAGAGAGGG + Intronic
1034814899 7:154163860-154163882 AGGCGTGCCCTGTAGTGAGAGGG - Intronic
1034815411 7:154168050-154168072 AGGCAGACACTGAGGACAGATGG + Intronic
1035536484 8:395103-395125 GGGTGGGCAGTGTGGAGGGAGGG + Intergenic
1035603430 8:912849-912871 AGGCGGGCACCGTGGTGCGGGGG - Intergenic
1035631616 8:1111055-1111077 AGTCGGGCACTGTGGCGTGCAGG - Intergenic
1037422453 8:18717757-18717779 AGGCAGGCTGTATGGAGAGAAGG - Intronic
1038404527 8:27311472-27311494 AGGCGGGAACTGCGGGCAGAAGG - Exonic
1040298643 8:46176419-46176441 AGGCAGGCAGTGGGGAGAAACGG + Intergenic
1041098504 8:54373384-54373406 AGGCGGGCCCTGGGGAGACGTGG + Intergenic
1042170451 8:65985849-65985871 AGGAGGGCCTTGTGGGGAGATGG - Intergenic
1042568579 8:70137684-70137706 AGGCGCACACTGTGTAGACAGGG - Intronic
1044944951 8:97381131-97381153 AAGGGGGCTCAGTGGAGAGAGGG - Intergenic
1045860542 8:106811244-106811266 TGGTGGGAACTGTGGAGAAATGG + Intergenic
1046946429 8:119978507-119978529 AGGCGGGGGCTGAGGAGACAAGG + Intronic
1048164313 8:132048883-132048905 AGGCAGGCCCTTTGGTGAGATGG - Intronic
1049409358 8:142465479-142465501 AGGTGGGCTCTGTGGAGACGTGG + Intronic
1049439047 8:142600939-142600961 AGGCTGCCACGGTGGAGGGAGGG + Intergenic
1049451936 8:142666651-142666673 TGGCATGCACTGTGGGGAGAGGG + Intronic
1049819084 8:144623500-144623522 AGGCTGGCTCTGTGGATACAAGG + Intergenic
1051441874 9:17093474-17093496 AGGAGGCATCTGTGGAGAGAGGG - Intergenic
1051486372 9:17612826-17612848 AGGTAGGCACTGTGGAAAAATGG - Intronic
1055430079 9:76234363-76234385 TGGTGGGGACTGGGGAGAGATGG - Intronic
1055861014 9:80748831-80748853 AGATGGGCACTGTGGGGAGGAGG - Intergenic
1055944635 9:81681889-81681911 AGGCAGGCACTAGGGAGACATGG + Intronic
1056764141 9:89434565-89434587 AGGAGGGCAGAGAGGAGAGAAGG - Intronic
1056974036 9:91234155-91234177 AGGCTGATACAGTGGAGAGAGGG - Intronic
1057386146 9:94607351-94607373 AGGTGGGCTCTCAGGAGAGACGG + Intronic
1059366001 9:113786785-113786807 AGGGAGGTACAGTGGAGAGAGGG + Intergenic
1060106927 9:120878415-120878437 AGGTGGGCGCTGTGGACTGAGGG - Intronic
1060553903 9:124498721-124498743 AGGCGGGCAGTGTTGAGAAGGGG + Intronic
1060865009 9:126988702-126988724 AGGTGGTCACACTGGAGAGAAGG + Intronic
1061156190 9:128863213-128863235 AGGAGGGCAGTGCTGAGAGACGG + Intronic
1061163610 9:128910082-128910104 AGGCAGGCAGTGTGGATGGAGGG + Intronic
1061433361 9:130545094-130545116 AGGGGGGCACAGGGGAGGGACGG + Intergenic
1061458082 9:130713295-130713317 AGGCGGGCCCCGTGTAGAGGAGG - Intergenic
1061481893 9:130901602-130901624 AGGCTGGCACTGGGGAAAAACGG - Intergenic
1061675419 9:132212885-132212907 AGGCAAGCAGTGTGGGGAGATGG - Intronic
1062290427 9:135791926-135791948 AGGTGGGCACTGGGGAGATGAGG + Intronic
1186495647 X:10011126-10011148 AGGCGAGGGCTGGGGAGAGAAGG + Intergenic
1187097398 X:16162580-16162602 AGGGGGGCTCTGTGATGAGAGGG + Intergenic
1191749124 X:64522114-64522136 AGGGGGGCACTTTGGAGAAGTGG - Intergenic
1192948079 X:75987104-75987126 AGGGGTGCACTGTGGGGACAGGG - Intergenic
1194965996 X:100289392-100289414 AGGCAGGCACTTGGTAGAGAAGG + Intergenic
1195711520 X:107776681-107776703 AGGGGAGGACTGAGGAGAGACGG - Intronic
1198233442 X:134715008-134715030 AGACGAGGATTGTGGAGAGAGGG - Intronic
1198530609 X:137547409-137547431 AGGCGGGCTCTGCGGCGAGCCGG + Intergenic
1198648071 X:138831159-138831181 AGGCAGGAGCTGTGTAGAGATGG + Intronic
1202061571 Y:20894715-20894737 AAGTGGGCACTGTGTAGACAAGG - Intergenic