ID: 1148052655

View in Genome Browser
Species Human (GRCh38)
Location 17:44776732-44776754
Sequence TAGGCGGGCACTGTGGAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052655_1148052658 -8 Left 1148052655 17:44776732-44776754 CCTCTCTCCACAGTGCCCGCCTA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1148052658 17:44776747-44776769 CCCGCCTAACCTGCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1148052655_1148052663 19 Left 1148052655 17:44776732-44776754 CCTCTCTCCACAGTGCCCGCCTA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1148052663 17:44776774-44776796 TTACTACTGTGACCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1148052655_1148052664 27 Left 1148052655 17:44776732-44776754 CCTCTCTCCACAGTGCCCGCCTA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1148052664 17:44776782-44776804 GTGACCATGAGCAGGTATGATGG 0: 1
1: 0
2: 0
3: 9
4: 150
1148052655_1148052661 -4 Left 1148052655 17:44776732-44776754 CCTCTCTCCACAGTGCCCGCCTA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052655 Original CRISPR TAGGCGGGCACTGTGGAGAG AGG (reversed) Exonic
900475300 1:2873577-2873599 CAGGCAGCCACTGGGGAGAGAGG + Intergenic
900736070 1:4300276-4300298 GAGGCTGGCTCTGGGGAGAGAGG + Intergenic
901572662 1:10174246-10174268 TAGCCGGGCACAGTGGAAGGCGG + Intronic
902211739 1:14909524-14909546 CAGGTGGGCACTGTGGGCAGAGG - Intronic
902404555 1:16175634-16175656 GAGGTGGGGACTGTGGAGGGTGG - Intergenic
904906142 1:33898729-33898751 TAGGAGGGCACTGTTGAGCCAGG + Intronic
905665897 1:39763034-39763056 GTGGGGGGCCCTGTGGAGAGGGG - Intronic
906211790 1:44016268-44016290 CAGGCAGGCACTCTGGAAAGTGG + Intronic
910870190 1:91826379-91826401 TAGGAGGCCGCTGTGGTGAGTGG + Intronic
911150118 1:94590350-94590372 GAGGAGGGCCCTGGGGAGAGAGG - Intergenic
917166026 1:172114150-172114172 TGGAGGGGCAGTGTGGAGAGAGG + Intronic
919914167 1:202129830-202129852 AAGGGGGGCTTTGTGGAGAGAGG - Exonic
920067631 1:203280282-203280304 TAGAAGGGCACTGGGCAGAGTGG - Intergenic
922192619 1:223332826-223332848 TAAGCGGGTACTGGGGAGGGTGG + Intronic
922493873 1:226040797-226040819 CAAGTGGGCTCTGTGGAGAGTGG - Intergenic
924694588 1:246385706-246385728 AAAGCGGGAACTGTGTAGAGCGG + Intronic
1067441561 10:46311668-46311690 GAGAAGGGCACAGTGGAGAGGGG + Intronic
1072531165 10:96320827-96320849 TAGGTGGGAACGGGGGAGAGAGG + Intronic
1072611348 10:97019376-97019398 CGGGCGGGCACTGTGCACAGTGG + Intronic
1073217992 10:101847303-101847325 TGGGTGGGCACAGTGGGGAGAGG - Exonic
1074450600 10:113556377-113556399 TTGGCTGGCACCATGGAGAGGGG + Intronic
1074498318 10:113999498-113999520 TAGGAGGGAACTGAAGAGAGAGG - Intergenic
1076659363 10:132045097-132045119 GAGGCAGGCACTGTGGAAAACGG - Intergenic
1077124962 11:929289-929311 TAGTCGGGCCCTGTGGAAAGAGG + Intronic
1077223047 11:1425824-1425846 TAGATGTGCACTGTGGAGATGGG + Intronic
1077433213 11:2526250-2526272 GAGGTGGGCACTGTGGTCAGGGG + Intronic
1079709675 11:23666095-23666117 TGGGCCAGCCCTGTGGAGAGAGG + Intergenic
1080261529 11:30354347-30354369 TAGGCAGGCACTGAGCAAAGGGG - Intergenic
1081668446 11:44930102-44930124 GAGGCGGGCAGTGTGGACAAGGG - Exonic
1082809035 11:57467596-57467618 GAGGCGGGAGCTGTGGGGAGGGG - Exonic
1084646587 11:70462672-70462694 TAGGCAGGGTCTGTGCAGAGCGG - Intergenic
1085363227 11:75911666-75911688 TGGGCTGGCACTGTGGTGGGAGG + Intronic
1087077745 11:94141447-94141469 AAGGTGGGCACTGGGGAGGGAGG - Intronic
1087094143 11:94304398-94304420 TAGGAGGGGCGTGTGGAGAGAGG + Intergenic
1088708165 11:112482357-112482379 TAGGGGAGCCCTGTGGAGTGGGG + Intergenic
1088746070 11:112806068-112806090 CAAGCGGGCACTGGGGAGAAGGG + Intergenic
1091436964 12:480738-480760 TAGGCGGGGGCTGTGAGGAGGGG + Intronic
1093007277 12:14064274-14064296 GAGGTGGGCACTGGGGAGACTGG + Intergenic
1094035485 12:26065824-26065846 AAGGAGGGTACTGTGGAGAGGGG - Intronic
1094826768 12:34275512-34275534 GTGGGGGGCACTGTGGACAGAGG - Intergenic
1098620710 12:72594362-72594384 TAGCCGGGCATGGTGGAGACGGG - Intronic
1102167839 12:110820686-110820708 AAGGAGGGGACTGGGGAGAGGGG - Intergenic
1103337293 12:120199264-120199286 GAGACGGGCACTGGGGAGAAAGG + Intronic
1104217690 12:126750207-126750229 GAGCCAGTCACTGTGGAGAGAGG + Intergenic
1105775226 13:23653585-23653607 TAGGGGAGCATTGTGGACAGAGG + Intronic
1105800390 13:23898037-23898059 TAGGAGGCCACTGTGAAGAAGGG + Intronic
1105848622 13:24314915-24314937 TAGGAGGCCACTGTGAAGAAGGG - Intronic
1106182348 13:27380540-27380562 GAGGCTGGGAGTGTGGAGAGAGG - Intergenic
1107443513 13:40449347-40449369 TAGGCAGGCCCTGTGAAGATAGG - Intergenic
1107534219 13:41311844-41311866 TGCCCGGGCACTGCGGAGAGCGG - Intronic
1114052282 14:18930543-18930565 TAGGCAGGCACTGCAGGGAGTGG - Intergenic
1114110275 14:19471382-19471404 TAGGCAGGCACTGCAGGGAGTGG + Intergenic
1116964573 14:51000729-51000751 TCGGCGGGCACCGTGGACAGAGG + Exonic
1118744041 14:68761402-68761424 TAGGAGGGCACAATGGAGATGGG + Intergenic
1119421586 14:74510625-74510647 TGGGCGGGCAGCGTGGAGAGAGG + Intronic
1119543381 14:75455250-75455272 GAGTCAGGCACTGTGGAGTGTGG - Intronic
1119749666 14:77068299-77068321 TAGGGGGGCACTGCCCAGAGGGG - Intergenic
1122626579 14:103088157-103088179 GAGGCGGACCCTGTGGAAAGTGG + Intergenic
1125265311 15:37872648-37872670 TATGCAGGCACTGTGGCAAGAGG + Intergenic
1129382807 15:75178546-75178568 GGGGCGGGCACTGTGGGGGGTGG + Intergenic
1129761564 15:78131707-78131729 GAGGCGGGCAGTGGGGCGAGTGG + Intronic
1132478227 16:153125-153147 GGGGAGGGCACTGTGGGGAGAGG + Intronic
1132478245 16:153181-153203 GAGGAGGGAACCGTGGAGAGGGG + Intronic
1132480302 16:163701-163723 GAGGAGGGGACTGTGGGGAGAGG + Intronic
1132480331 16:163785-163807 GAGGAGGGGACTGTGGGGAGGGG + Intronic
1134156976 16:11851838-11851860 GAGGCGGGGACCGTGGAGTGTGG - Intergenic
1135071771 16:19358385-19358407 TAGCCGGGCGCTGTGGCGGGTGG - Intergenic
1136403353 16:30030240-30030262 AAGGCAGGCAGTGAGGAGAGAGG + Intronic
1137785431 16:51134322-51134344 GAGGCAGGCAGTGGGGAGAGGGG - Intergenic
1138616246 16:58169513-58169535 AAGGCGGGCAGTGGGGAGGGGGG + Intronic
1139633195 16:68243148-68243170 CATGCTGGCACTGTGGAGAAGGG - Intergenic
1140097109 16:71884278-71884300 TGGGCGGGGCCTGAGGAGAGGGG + Intronic
1144373043 17:14611198-14611220 AAGGTAGCCACTGTGGAGAGTGG + Intergenic
1145013552 17:19382970-19382992 TAGACTGGGACTGTGGGGAGAGG + Intronic
1146325760 17:31884654-31884676 TAGGGGGACACTGGGGTGAGGGG - Intronic
1146507461 17:33417704-33417726 TAGGAGGGGAATGTGCAGAGGGG - Intronic
1147177966 17:38668583-38668605 TAGGAAGGGACTGTGGAGTGTGG - Intergenic
1147326446 17:39672028-39672050 TAGGTGCGCAGTGTGGAGACGGG - Exonic
1147339638 17:39745872-39745894 TGGGCGGTCACTTTGGGGAGGGG - Intronic
1148052655 17:44776732-44776754 TAGGCGGGCACTGTGGAGAGAGG - Exonic
1148442755 17:47720336-47720358 TAGCCGGGCAGTGTGGTGAGGGG - Intergenic
1148957070 17:51362692-51362714 TAGGGGAGCACTGTCCAGAGTGG + Intergenic
1152333083 17:79684870-79684892 GCGAGGGGCACTGTGGAGAGAGG - Intergenic
1152609429 17:81308310-81308332 TGGGGGGGCACCATGGAGAGGGG + Intergenic
1152633113 17:81419546-81419568 TGGGCGGGCCCTGTGGGGAGCGG + Intronic
1153767243 18:8386088-8386110 GTGGGGGGCATTGTGGAGAGAGG + Intronic
1153770188 18:8409020-8409042 TAGGAGGGCCCTTAGGAGAGAGG - Intergenic
1154190942 18:12230785-12230807 TAGATGGGCACCCTGGAGAGGGG + Intergenic
1155999197 18:32366129-32366151 TAGGTGGGCAGGGTGGAGTGAGG - Intronic
1156552917 18:38037124-38037146 TAGGTGTGCATTGTAGAGAGAGG - Intergenic
1157481870 18:48060360-48060382 TAGATGGCTACTGTGGAGAGAGG - Intronic
1158140822 18:54253605-54253627 GAGGCGGGCACTGAGGCTAGGGG + Intergenic
1158841524 18:61393260-61393282 TTGGCAGGCACTGTGAAGTGTGG - Intronic
1159425845 18:68285258-68285280 TGGGGGGGCACTGGGGAGGGTGG + Intergenic
1161759568 19:6161306-6161328 GAGGTGGGCACTGGGGAAAGGGG + Intronic
1161842063 19:6688277-6688299 TAGCCGGGCATGGTGGAGGGGGG - Intronic
1163155338 19:15437120-15437142 AAGTTGGCCACTGTGGAGAGAGG + Exonic
1163550780 19:17965533-17965555 GAGGTGGGAACTGTGGCGAGGGG + Intronic
1165101705 19:33442252-33442274 TAGCCGGGCATGGTGGAGGGTGG + Intronic
1167100863 19:47403544-47403566 GAGGCTGGGTCTGTGGAGAGGGG + Exonic
1167460661 19:49623222-49623244 TAGGCTGGCACTGAGGATTGTGG + Intronic
926139506 2:10359883-10359905 CCGGCGGGCACTGTGGAAGGAGG - Intronic
928595690 2:32856968-32856990 TAGGTGGGCACTGGGCAGAGGGG - Intergenic
929489710 2:42385370-42385392 AAGGCAGGGACTGTGGAAAGAGG + Intronic
935682460 2:105649796-105649818 TGGGCGGGCACTGGGTAGATGGG + Intergenic
937316105 2:120933042-120933064 AGGGCGGGAACTGTGGTGAGAGG + Intronic
938470326 2:131553859-131553881 TAGGCAGGCACTGCAGGGAGTGG - Intergenic
938734421 2:134173366-134173388 TAGGCTGGCACTGGGGAGGGTGG + Intronic
941755081 2:169176374-169176396 TAGAGAGGCACTGAGGAGAGGGG + Intronic
942297196 2:174529064-174529086 TAGGAAGGCAGTGTAGAGAGAGG + Intergenic
946305522 2:218855028-218855050 GAGGCGGGTGCGGTGGAGAGTGG - Intergenic
946729148 2:222691690-222691712 TGGGCAGGCACAGTGGAGAGGGG - Intronic
947117905 2:226791541-226791563 TCGGCGGGCGCGGTGCAGAGGGG + Intronic
947344038 2:229172537-229172559 TAGACGTGCACTGAGGAAAGAGG - Intronic
947987991 2:234465273-234465295 TAGGTGGCCACTGTGGGCAGTGG + Intergenic
1169660452 20:7973040-7973062 TAGAAGGGAACTGTGGAGAAAGG + Intergenic
1171227452 20:23453216-23453238 GGGGTGGGCACTGTGGGGAGGGG + Intergenic
1176238465 20:64065041-64065063 GAGGCGGGCGCTGTGCAGTGGGG + Intronic
1180115136 21:45698228-45698250 GAGGTGGGCACTTTGGAGAAGGG - Intronic
1180470756 22:15652918-15652940 TAGGCAGGCACTGCAGGGAGTGG - Intergenic
1180725776 22:17945656-17945678 TATGGGGGCTGTGTGGAGAGGGG - Intronic
1180957991 22:19749768-19749790 TGGGTGGGCACTGCAGAGAGGGG + Intergenic
1181110388 22:20599285-20599307 GAGGCTGGCACTTTGGAGGGTGG - Intergenic
1181949651 22:26544704-26544726 GGGATGGGCACTGTGGAGAGGGG + Intronic
1183463426 22:37966963-37966985 TAGGCAGGCACAGTAGGGAGTGG - Intronic
1184161132 22:42697931-42697953 TAGGCAGGAAGTGAGGAGAGAGG + Intronic
949961299 3:9314660-9314682 GAGGAGGGCAGGGTGGAGAGAGG - Intronic
950576868 3:13837327-13837349 ATGCGGGGCACTGTGGAGAGGGG - Intronic
952976668 3:38702356-38702378 TAGGAGGGCATTGTGAATAGAGG - Intronic
954132665 3:48568340-48568362 TAGGCGGCTACTGTGGAGGTGGG + Intronic
955626678 3:60926987-60927009 GAGGGGGGCACCGTGGAAAGCGG - Intronic
956093594 3:65693395-65693417 TATGGGGGCACTGTGGACAAGGG - Intronic
956773969 3:72549861-72549883 TAGGCTGGCACTGGGGACAGGGG - Intergenic
957592955 3:82224802-82224824 TAGGCTGGCCCTGTGGAGGAAGG + Intergenic
962274270 3:134000335-134000357 GAGGAGGTCACTGAGGAGAGGGG + Intronic
962661559 3:137606237-137606259 GAGGTGGGGACTGGGGAGAGAGG - Intergenic
966371094 3:179251554-179251576 TTTGCAGGCACAGTGGAGAGAGG - Exonic
968830354 4:2930424-2930446 CAGGCTGCCACTGTGCAGAGGGG + Intergenic
970616298 4:17771304-17771326 TTTGGGGGCACTGTGGAAAGTGG + Intronic
976215427 4:82711271-82711293 TAGGGGGTCACAGTGGGGAGGGG - Intronic
979252901 4:118583934-118583956 TAGGCGGGCATGGTGGCGGGTGG + Intergenic
982303719 4:153906516-153906538 TCTGGGAGCACTGTGGAGAGTGG - Intergenic
984766205 4:183402391-183402413 GAGGCAGGCACTGGGCAGAGAGG - Intergenic
985636185 5:1036941-1036963 CAGGCGGGCAGTGTGGACGGCGG + Intronic
985773357 5:1826707-1826729 TCAGCGGGCACTGTGGACACTGG - Intergenic
985863805 5:2495631-2495653 CAGGTGGTCTCTGTGGAGAGAGG + Intergenic
986022976 5:3822001-3822023 GAGGAGGGCATTGTGGAGGGGGG + Intergenic
986295209 5:6431921-6431943 TAGGAGGACACTAAGGAGAGAGG - Intergenic
992267846 5:75035424-75035446 TTGTGGGGCACTGGGGAGAGAGG + Intergenic
995503698 5:112836174-112836196 TAGCCGGGCACGGTGGCGGGGGG - Intronic
998331588 5:141332419-141332441 TAGCCGGGCTCTGCGGAGAGGGG - Exonic
998332414 5:141340706-141340728 TAGCCGGGCTCTGCGGAGCGGGG - Exonic
998332971 5:141345768-141345790 TAGCCGGGCTCTGCGGAGCGAGG - Exonic
998336381 5:141375818-141375840 TAGCCGGGCTCTGCGGAGCGGGG - Exonic
998337325 5:141384634-141384656 TAGCCGGGCTCTGCGGAGCGGGG - Exonic
998340672 5:141414922-141414944 TAGCCGGGCTCTGCGGAGCGGGG - Exonic
998342758 5:141432494-141432516 TAGCCGGGCTCTGCGGAGCGGGG - Exonic
999735056 5:154506670-154506692 TAGGCTGGCACTTGAGAGAGGGG + Intergenic
1002630776 5:180575125-180575147 TAGGCAGGCACAGTGGAGATAGG - Exonic
1003603778 6:7541892-7541914 TCGGCGGGCAATCGGGAGAGCGG - Exonic
1003875881 6:10436186-10436208 TAGCCGGGCGCGGTGGCGAGTGG - Intergenic
1007732328 6:43954711-43954733 TCGGCAGGCACTGTGGGGTGGGG - Intergenic
1007790572 6:44306072-44306094 TAGCTGGGCACTGTGGACATGGG + Intronic
1012130606 6:95486989-95487011 TAGCCGGGCACGGTGGAGGGTGG - Intergenic
1018057896 6:160068373-160068395 CAGGCTGGCACTGGTGAGAGAGG + Exonic
1018057921 6:160068493-160068515 CAGGCTGGCACTGGTGAGAGAGG + Intronic
1018057943 6:160068613-160068635 AAGGCTGGCACTGGTGAGAGAGG + Intronic
1018057963 6:160068733-160068755 AAGGCTGGCACTGGTGAGAGAGG + Intronic
1018198514 6:161375460-161375482 CTGTCAGGCACTGTGGAGAGAGG - Intronic
1022127884 7:27375588-27375610 TAGGAGGGCTCTGTGGGGGGTGG - Intergenic
1024189354 7:46989766-46989788 TAGGAAGTCAGTGTGGAGAGAGG + Intergenic
1024359959 7:48458148-48458170 TAAGAGGGCACTTTTGAGAGTGG - Intronic
1029178870 7:98685063-98685085 TGGGAGGGCTCTGTGGAGGGAGG + Intergenic
1031493131 7:122413504-122413526 TAAACTGCCACTGTGGAGAGAGG + Intronic
1033589701 7:142798821-142798843 TAGGAGGTCACTGGGGAGACAGG + Intergenic
1034384401 7:150726904-150726926 TAGATAGGCAATGTGGAGAGAGG + Intronic
1034990135 7:155542867-155542889 TGGGAGGGCAGTGTGGACAGGGG - Intergenic
1035603431 8:912850-912872 AAGGCGGGCACCGTGGTGCGGGG - Intergenic
1037963069 8:23114198-23114220 CAGGGGGCCACTGTGGTGAGTGG + Intronic
1038489879 8:27963172-27963194 TAGGCAGTCACTGTGGTGACTGG - Intronic
1041107223 8:54455031-54455053 TCGGGGGGCAGTGTGGAGGGCGG - Intergenic
1042568580 8:70137685-70137707 TAGGCGCACACTGTGTAGACAGG - Intronic
1043270307 8:78324972-78324994 TAGTCTGGCACAGTGGACAGTGG + Intergenic
1044242972 8:89908235-89908257 TAGGCTTGCACTGTGAGGAGGGG + Intronic
1044944952 8:97381132-97381154 TAAGGGGGCTCAGTGGAGAGAGG - Intergenic
1048896594 8:138997822-138997844 CAGGAGGGCACTATGGGGAGAGG - Intergenic
1049300743 8:141868100-141868122 GAGTCGGGCACAGGGGAGAGAGG - Intergenic
1049389332 8:142360037-142360059 CAGCCGGGCACTGTGGGGTGCGG + Intronic
1049705576 8:144040570-144040592 TGGGGGGGCTCAGTGGAGAGTGG - Exonic
1051194150 9:14545119-14545141 TACGCAGGCACTGGGGAGAATGG + Intergenic
1053272510 9:36760139-36760161 TCGGCAGGCACTGGGGAGATAGG + Intergenic
1055681198 9:78717340-78717362 TTGGTGTGCACTGTGGAGTGAGG + Intergenic
1056862464 9:90198868-90198890 TAGGGGGCCACTGAGAAGAGAGG - Intergenic
1057310981 9:93943162-93943184 TAGAGGGCCACTGTGGGGAGGGG - Intergenic
1060553902 9:124498720-124498742 GAGGCGGGCAGTGTTGAGAAGGG + Intronic
1061563628 9:131422703-131422725 CAGGCGGGCACTGTCTGGAGAGG + Intronic
1061749663 9:132769088-132769110 TGGGCGGGCACTGTGGGGAGGGG + Intronic
1061779571 9:132987659-132987681 GAGGTGGGCACTGTGGAGTGAGG + Intronic
1190315954 X:49151125-49151147 TAGCCGGGCACAGTGGCTAGCGG - Intergenic
1192443531 X:71193039-71193061 TAGCCGGGCATGGTGGAGCGCGG - Intergenic
1192561177 X:72129046-72129068 CAGGAGGGCAATGTGGTGAGAGG + Exonic
1193251787 X:79299308-79299330 TAGACCAGCACTGTGGAGGGAGG - Intergenic