ID: 1148052661

View in Genome Browser
Species Human (GRCh38)
Location 17:44776751-44776773
Sequence CCTAACCTGCACAAGCTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148052652_1148052661 1 Left 1148052652 17:44776727-44776749 CCACCCCTCTCTCCACAGTGCCC 0: 1
1: 0
2: 5
3: 101
4: 1061
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052650_1148052661 3 Left 1148052650 17:44776725-44776747 CCCCACCCCTCTCTCCACAGTGC 0: 1
1: 0
2: 2
3: 55
4: 654
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052647_1148052661 28 Left 1148052647 17:44776700-44776722 CCAGTCCTGGGACTGCTCCGCTC 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052649_1148052661 11 Left 1148052649 17:44776717-44776739 CCGCTCAACCCCACCCCTCTCTC 0: 1
1: 2
2: 4
3: 145
4: 1356
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052655_1148052661 -4 Left 1148052655 17:44776732-44776754 CCTCTCTCCACAGTGCCCGCCTA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052653_1148052661 -2 Left 1148052653 17:44776730-44776752 CCCCTCTCTCCACAGTGCCCGCC 0: 1
1: 0
2: 0
3: 31
4: 386
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052648_1148052661 23 Left 1148052648 17:44776705-44776727 CCTGGGACTGCTCCGCTCAACCC 0: 1
1: 1
2: 0
3: 7
4: 129
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052654_1148052661 -3 Left 1148052654 17:44776731-44776753 CCCTCTCTCCACAGTGCCCGCCT 0: 1
1: 0
2: 0
3: 26
4: 316
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97
1148052651_1148052661 2 Left 1148052651 17:44776726-44776748 CCCACCCCTCTCTCCACAGTGCC 0: 1
1: 0
2: 3
3: 58
4: 588
Right 1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148052661 Original CRISPR CCTAACCTGCACAAGCTGGA CGG Exonic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
907701243 1:56790227-56790249 GCTCTCCTCCACAAGCTGGAAGG + Intronic
909741843 1:79038628-79038650 CCTACCCAGCCCAAGTTGGAAGG - Intergenic
910113738 1:83709958-83709980 ATTACCCTGCACAGGCTGGAAGG + Intergenic
913192666 1:116426596-116426618 CCTACCCAGCACCAGCTGGGAGG - Intergenic
913364256 1:118018188-118018210 CAGAACCTGCACAATCTGGATGG + Intronic
915127754 1:153678127-153678149 GCTAATCTGCACAGTCTGGAAGG + Intergenic
917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG + Intergenic
918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG + Intergenic
920195985 1:204227778-204227800 CCTGACCTGCCCAAGCAGAATGG + Intronic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG + Intronic
1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG + Intergenic
1064369174 10:14736166-14736188 CTTAAACTGGACAAGCTGAAAGG + Intronic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1067275238 10:44828022-44828044 CCTGACCTACCCAGGCTGGAGGG - Intergenic
1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG + Intergenic
1068326222 10:55491348-55491370 CCTTACGTGGACAAGCTGGGTGG - Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1071697134 10:87888164-87888186 CCTAACCTGTGAAAGCTGCATGG + Intronic
1073245322 10:102086324-102086346 CCTACCCTGCACACCCAGGAAGG + Intergenic
1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG + Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077895862 11:6452775-6452797 CCTGAGCTGCTCAAACTGGAGGG - Intronic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1096327600 12:50678693-50678715 CCCAACCAGCCCAAGCCGGAGGG + Exonic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104364097 12:128161456-128161478 CCTAACCTGCCCAAGATACATGG - Intergenic
1104616626 12:130275783-130275805 CATAACCTGCCCAAGAAGGATGG - Intergenic
1104684673 12:130777084-130777106 ACTATCCTGCCCAGGCTGGAGGG + Intergenic
1106278766 13:28243117-28243139 CCTAGCCAGCACAAGATGGCAGG - Intronic
1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG + Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1119315323 14:73689494-73689516 CCCAAACTGAAAAAGCTGGATGG + Exonic
1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG + Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG + Exonic
1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG + Intergenic
1135526118 16:23214971-23214993 CCGACCCTGCACAGGCTGGGAGG - Intronic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1141778113 16:86137963-86137985 CCTGACCTGCAAAGGATGGAGGG + Intergenic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148544173 17:48504281-48504303 CCTAACCTGGCCAAGGTGAAAGG - Intergenic
1149118926 17:53137345-53137367 CCTCACCTGTACAAACTGGGGGG - Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1155949436 18:31893898-31893920 ACTAAACTGCAAAACCTGGATGG + Intronic
1157162214 18:45324507-45324529 CCTATCCTGCAGAAGCTAGGAGG - Intronic
1166343444 19:42151591-42151613 CCGACCTTGCCCAAGCTGGAAGG - Intronic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG + Intronic
939727547 2:145741585-145741607 CATAACCTGTAAAAACTGGATGG - Intergenic
941670099 2:168283946-168283968 TCTACCATGCTCAAGCTGGAGGG + Intergenic
944955013 2:204798632-204798654 CCCAACCTCCTCAAGCAGGATGG - Intronic
1172239785 20:33405203-33405225 ACTACCCTCCACAATCTGGATGG + Intergenic
1174299137 20:49568964-49568986 CCTAACGTGCACCAGGTAGAGGG - Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178498933 21:33109989-33110011 CCTAACAAGCCCAAGCTTGATGG - Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179566527 21:42252494-42252516 CCTAACCTGCCCCAGCTGCCCGG - Intronic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1185103547 22:48854532-48854554 CCTAACATGCACAGGCTCAAAGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
962412209 3:135151243-135151265 TCTACCCTGAGCAAGCTGGAGGG - Intronic
963101424 3:141609502-141609524 CTTAAGCTGCAGAAGATGGAAGG + Exonic
967508274 3:190279177-190279199 CCTAACATGCCCAGACTGGAAGG + Intergenic
969387770 4:6867261-6867283 CTCAACCTTCACAGGCTGGAAGG - Intronic
970229860 4:13898542-13898564 CATAAACTGGACAAACTGGATGG - Intergenic
973973594 4:56240272-56240294 CCTAACCTCCACATGCTACAGGG - Intronic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
975905892 4:79211622-79211644 CCCACCCCCCACAAGCTGGAGGG + Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG + Intronic
988614692 5:32764163-32764185 CCTAAACTGCACATGCACGAAGG - Intronic
990243701 5:53840548-53840570 CTGAAGCTGCACAAGCTAGAAGG + Intergenic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
999977322 5:156924580-156924602 TCTGACCTGCACAAACTCGATGG - Intronic
1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG + Intergenic
1013055784 6:106581587-106581609 CCTCTCCTGCACAAGCTGTTTGG - Intronic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1038771407 8:30485189-30485211 CCTAACTTGCACAGGCTGTCAGG - Intronic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1042380872 8:68112708-68112730 TCTAACTTGCACACTCTGGAGGG - Intronic
1044238941 8:89866202-89866224 CCTAATTTGCACAAGATGAAAGG - Intergenic
1047325286 8:123830020-123830042 TTGAACCTGCACAATCTGGAGGG - Intergenic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1049940859 9:544941-544963 CCTCACATACCCAAGCTGGAGGG - Intronic
1052260661 9:26512840-26512862 CCTAACATGCACAACCAGCATGG + Intergenic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060271689 9:122147585-122147607 ACAAACCTGCACATGCTAGAAGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1200136528 X:153877762-153877784 CCTAACCTGGAGCATCTGGAAGG - Intronic