ID: 1148053142

View in Genome Browser
Species Human (GRCh38)
Location 17:44779108-44779130
Sequence CCTTGCCCCAGAGCGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148053142_1148053151 -3 Left 1148053142 17:44779108-44779130 CCCGGCCCCGCTCTGGGGCAAGG 0: 1
1: 1
2: 3
3: 21
4: 253
Right 1148053151 17:44779128-44779150 AGGGGTCGCATGGCAGCCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1148053142_1148053155 21 Left 1148053142 17:44779108-44779130 CCCGGCCCCGCTCTGGGGCAAGG 0: 1
1: 1
2: 3
3: 21
4: 253
Right 1148053155 17:44779152-44779174 CCCTCCCTGAGAGAAGCAAAAGG 0: 1
1: 1
2: 1
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148053142 Original CRISPR CCTTGCCCCAGAGCGGGGCC GGG (reversed) Intronic
900148616 1:1168769-1168791 CCTTTGCCAAGAGCAGGGCCTGG + Intergenic
900418861 1:2547000-2547022 CCTAGCGCCAGGGCGGGGCGTGG + Intergenic
900475850 1:2876011-2876033 CCCTTCCCATGAGCGGGGCCCGG - Intergenic
900570642 1:3356645-3356667 GCCTGCCCCAGAGCGGCCCCAGG + Intronic
902554682 1:17240005-17240027 CATTGCCCCAGCGTGGGGCCGGG - Intronic
902618077 1:17634769-17634791 CCCTGCCCCAGGGCTGGCCCAGG - Intronic
903000689 1:20263415-20263437 AATTGACCCAGAGCTGGGCCAGG - Intergenic
903012822 1:20343179-20343201 CCTTGCCCAGCACCGGGGCCGGG - Exonic
903184717 1:21622557-21622579 GCTCGCCCCACGGCGGGGCCCGG + Intronic
905182938 1:36177931-36177953 CCCTGCCCCAGCCCAGGGCCAGG + Exonic
906565898 1:46800908-46800930 CCTTGCTCCCGAGCTGGGCGAGG + Intronic
906655901 1:47548206-47548228 CCTTGGCCCAGAACGGGGGTGGG + Intergenic
907159127 1:52358522-52358544 CCATGCCCCAGACAGGGCCCCGG - Intronic
908134451 1:61115771-61115793 CCTTGCCCCAGAGAGGGAGAAGG + Intronic
908714382 1:67054157-67054179 CCCTGCCCCTGGGCGGGGACAGG - Intergenic
912450592 1:109765340-109765362 CCTTGCCCCAGAGCCCCCCCAGG - Intronic
913347763 1:117825398-117825420 CCTGGCCCCAGAGCTGCCCCAGG - Intergenic
913699703 1:121362511-121362533 CCTAGCCCCAGAGTGGGGGATGG - Intronic
914137841 1:144917525-144917547 CCTAGCCCCAGAGTGGGGGATGG + Intronic
914941114 1:152023676-152023698 CCCTAGCCCAGAGCAGGGCCTGG - Intergenic
915064935 1:153217180-153217202 CCTTGACCCAGAGAGGCCCCAGG + Intergenic
915268078 1:154732898-154732920 CCTAGCCGCAGAGCGGGGGGTGG - Intronic
915322031 1:155061501-155061523 CCTTGGCTCAGGGCGGGCCCTGG - Intronic
915544985 1:156592012-156592034 CTCTGCCCCGGGGCGGGGCCTGG + Intronic
917920256 1:179744311-179744333 CCGCGGCCCAGAGGGGGGCCTGG + Intronic
919926684 1:202195083-202195105 CCTTGCCCCAGAGCGGGGCTGGG - Intronic
920487113 1:206381220-206381242 CCTAGCCCCAGAGTGGGGGATGG - Intronic
921932046 1:220762684-220762706 CATTGGCCCAGAGCCGGCCCTGG + Intronic
922803454 1:228374252-228374274 CCAGGCCCCAGAGCATGGCCTGG - Intronic
922898418 1:229118166-229118188 CCTGGCCCCAGGGCGGGGGCTGG - Intergenic
923520425 1:234731106-234731128 CCTTCCTCCAGACAGGGGCCTGG - Intergenic
924168003 1:241305595-241305617 GCTTTCCTCAGGGCGGGGCCGGG + Intronic
1062769094 10:85616-85638 GTCTGCCCCAGAGCTGGGCCAGG - Intergenic
1066067835 10:31775038-31775060 CCTTGCTCCAGAGTGGGGACTGG - Intergenic
1066484447 10:35830010-35830032 CCTTGCCCCAGCTCGGGGAGGGG - Intergenic
1067528194 10:47051029-47051051 CCTGGTCTCAGAGAGGGGCCGGG - Intergenic
1068495864 10:57784815-57784837 CCTGTCCCCAGATGGGGGCCTGG + Intergenic
1069864754 10:71495041-71495063 CCCTGCCCCTGAGTGGGGGCAGG + Intronic
1069951866 10:72024574-72024596 CCTGGCCCCAGAGCGAGACGTGG + Intergenic
1070153434 10:73819236-73819258 CCTTGCCTCAGCGCTGAGCCAGG - Intronic
1070769055 10:79071633-79071655 CCTGGCCCCAGTGCAGGGGCCGG + Intronic
1072267867 10:93747813-93747835 TATTGCCCTAGAGCGGGGCATGG - Intergenic
1073122540 10:101131513-101131535 CCTGGCCCCACCGGGGGGCCCGG - Exonic
1073608939 10:104924247-104924269 ACTTGCCTCAGAGCTGGGGCGGG + Intronic
1074786953 10:116849776-116849798 CGTTGCCGCAGCGCGGGGCGGGG - Intronic
1075105311 10:119536394-119536416 CCTTGGCCCTGGGCGGGGCAGGG - Intronic
1075753410 10:124791945-124791967 CCCAGCCCCAGCGCGGGGGCTGG - Intergenic
1076361822 10:129894963-129894985 CCTTGCCCCAGAAGGTGCCCAGG - Intronic
1076499841 10:130928913-130928935 CCTTCCAGCAGAGCTGGGCCTGG - Intergenic
1076810215 10:132882550-132882572 GCTGGCCCCAGGGCGGGGCCAGG + Intronic
1076833278 10:133007516-133007538 CCTTGCCTCAAAGCCTGGCCTGG - Intergenic
1076841842 10:133049722-133049744 CCTTGCCCCACAGCAGGGGTGGG + Intergenic
1077005989 11:356274-356296 CCTTCCTCCACAGCAGGGCCGGG + Intergenic
1077496934 11:2891004-2891026 CCCTGCTCCAGAACGGGACCAGG + Intronic
1081631449 11:44692682-44692704 CCTGGCCCCAGGGAGAGGCCTGG + Intergenic
1081780799 11:45710596-45710618 TCTTGCCAGAGAGCAGGGCCTGG - Intergenic
1081812635 11:45922384-45922406 CGCGGCCCCAGAGCGGGGGCAGG + Intronic
1081853744 11:46291050-46291072 GCTTGCCACAGAGGTGGGCCAGG + Intronic
1082179642 11:49102466-49102488 CCTTTGCCCTGTGCGGGGCCTGG - Intergenic
1083339148 11:61947504-61947526 CCCTGCCCCAGAGCTGAGACAGG - Intergenic
1083419636 11:62545813-62545835 CCCCGCCCCAGAGCCTGGCCCGG - Intronic
1083853823 11:65382370-65382392 CCATGCCACAGAGAGAGGCCGGG + Intronic
1084063207 11:66688949-66688971 CACTGCCCCAGAGCTGTGCCAGG + Intronic
1084296341 11:68214953-68214975 CCTTGCCACAGAGAGGAGGCGGG + Intergenic
1084966812 11:72749096-72749118 CTCTGCTCCAGAGCGGGGACTGG + Intronic
1088232945 11:107691587-107691609 ACTTGCCACAGGGCAGGGCCAGG - Intergenic
1089800762 11:121024626-121024648 CCTTGCCCCAGCGTGGGGGATGG + Intronic
1092098208 12:5861628-5861650 TCTTGCCTCACAGCAGGGCCCGG - Intronic
1096654304 12:53079146-53079168 CCTCGGCCCAGTGCAGGGCCTGG - Intronic
1104259050 12:127166115-127166137 CCTGGTCCCAGCGCGGGGCGGGG + Intergenic
1104631741 12:130408489-130408511 CTCTGCCACAGATCGGGGCCTGG + Intronic
1106091319 13:26597619-26597641 CCTTCCCCCAGAACAGGCCCCGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106511750 13:30419199-30419221 CCCTGCCCCAGAGCCAGACCTGG + Intergenic
1106558884 13:30832419-30832441 CCTTGCCCCAGAGTAGGGCTGGG - Intergenic
1111979693 13:95003109-95003131 CTCTGCCACAGAGCTGGGCCTGG - Intergenic
1113975180 13:114222696-114222718 CCTTGCCCAGGGCCGGGGCCAGG + Intergenic
1115776064 14:36716602-36716624 CAGTGCCCCAGAGTGGTGCCTGG - Intronic
1117176554 14:53152469-53152491 CCCGGCCCCAGGGCGGGGACCGG - Exonic
1119407413 14:74407330-74407352 CCCAGCCCCAGAGCAGGGCCCGG - Exonic
1119749636 14:77068202-77068224 GGGTGCCCCAGAGTGGGGCCGGG - Intergenic
1121127569 14:91417863-91417885 CCTTCCCCCAGACCCGGGCGGGG - Intergenic
1122072491 14:99213750-99213772 CAGTGCCCCAGAGAGGGGACAGG - Intronic
1122115057 14:99523414-99523436 CCCAGCCCCAGTGGGGGGCCTGG - Intronic
1122349476 14:101079079-101079101 CCTTTCCCGAGAGCAGGGCAGGG + Intergenic
1122353865 14:101112162-101112184 CTTGGCCCCAGAACGGTGCCTGG + Intergenic
1122417620 14:101557950-101557972 CACTGCCCCAGTGCGGGGCGTGG - Intergenic
1122774977 14:104113129-104113151 CCTGGCCTGAGAGGGGGGCCGGG - Exonic
1123048745 14:105530688-105530710 CCTTGCCCCAGCACGGGAGCTGG + Intergenic
1125760523 15:42093100-42093122 ACCTGCCCCAGAGCGGGACCTGG - Intronic
1126581356 15:50245156-50245178 CCTTGACCTAGAGCGGTGCAGGG - Intronic
1126780507 15:52135421-52135443 CCAAGCCCCCGAGAGGGGCCTGG + Intronic
1128249619 15:66155259-66155281 CCTTACCCCATAGCGGGGGGTGG - Intronic
1128811952 15:70579477-70579499 CCTTGCCTAAGGGCAGGGCCGGG - Intergenic
1132669361 16:1096361-1096383 CCGTGCCCATGAGCGGGGCTGGG + Intergenic
1132860707 16:2070370-2070392 CCTTGTCCCGGAGCAGGGGCCGG - Intronic
1133236115 16:4388172-4388194 ACCTGCCCCAGAGCAGGGCTTGG + Intronic
1137268359 16:46886193-46886215 CCCTGGCCCAGAGGTGGGCCGGG + Intronic
1138546396 16:57722270-57722292 CCTAGCCCCAGTGCTGGGCTGGG - Intronic
1139287351 16:65827464-65827486 CCTTCCCCCAGAGGGATGCCTGG - Intergenic
1139691704 16:68645729-68645751 CCTTTCCCCAGCGCCTGGCCGGG - Exonic
1141608847 16:85170173-85170195 CCCTGTCCCGGAGCGGGTCCCGG - Intergenic
1141642586 16:85349861-85349883 ACTTGCCCCAGAGTGCGGCCTGG + Intergenic
1141897700 16:86969110-86969132 CCCTGCCACACAGCGGCGCCTGG + Intergenic
1142138892 16:88463869-88463891 CCTTGGCCCAGAGCAGGGAAGGG - Intronic
1142191324 16:88719548-88719570 CCTGGGCCCAGGGCGGGGGCCGG - Intronic
1142233643 16:88911272-88911294 CATGGCAACAGAGCGGGGCCAGG + Intronic
1143027071 17:3947251-3947273 CCTTGGCCCAGAGCAGGTCCAGG - Intronic
1143269918 17:5667901-5667923 CCCTGCCCCAGAGAGGGGAGTGG + Intergenic
1143769925 17:9162103-9162125 CCTCTCCCCAGAGCAGGGCTGGG + Intronic
1145750160 17:27349562-27349584 CCCTGCCCCAGACCCGGCCCCGG + Intergenic
1145907733 17:28525430-28525452 TCTTTGCCCAGAGTGGGGCCTGG + Intronic
1146296604 17:31655100-31655122 CCTTGCCCCACTGCAGGGCTTGG - Intergenic
1146379076 17:32315186-32315208 ACGTGCCCCCGAGCTGGGCCTGG + Intronic
1146841059 17:36154566-36154588 CCTTTCCCCTAAGCAGGGCCCGG + Intergenic
1146853305 17:36242212-36242234 CCTTTCCCCTAAGCAGGGCCCGG + Intronic
1146869213 17:36366102-36366124 CCTTTCCCCTAAGCAGGGCCCGG + Intronic
1147072087 17:37966733-37966755 CCTTTCCCCTAAGCAGGGCCCGG + Intergenic
1147083613 17:38046265-38046287 CCTTTCCCCTAAGCAGGGCCCGG + Intronic
1147099559 17:38170232-38170254 CCTTTCCCCTAAGCAGGGCCCGG + Intergenic
1148050508 17:44767825-44767847 GCTTTCCCCAGAGTGGGGACTGG + Intronic
1148053142 17:44779108-44779130 CCTTGCCCCAGAGCGGGGCCGGG - Intronic
1151459921 17:74248373-74248395 CCTGGCCCCACAGCACGGCCTGG - Intronic
1151945060 17:77315151-77315173 CCTTGCCCCAGAACACGGCCCGG - Intronic
1152023547 17:77794580-77794602 CCTTGCCCCAGTGTCAGGCCTGG - Intergenic
1152361899 17:79836690-79836712 ACATGCCCCAGGGCGGGGGCCGG + Intronic
1152434172 17:80264919-80264941 CCCTTCCCCAGAGGGCGGCCTGG + Intronic
1152681890 17:81672722-81672744 AGTTGCCCCAGAGCGTGGCCAGG - Exonic
1152753703 17:82078187-82078209 CCATGTCCCAGAGCCGGGGCTGG - Intergenic
1152758139 17:82095634-82095656 CATGGCCCCAAAGCGGGGACTGG + Intronic
1155166772 18:23238045-23238067 CCTGGCCCATGAGCCGGGCCTGG + Intronic
1156373630 18:36493011-36493033 GCTGGCCCCAGAGCTGGGACTGG - Intronic
1156404706 18:36773051-36773073 CCTCTCTCCAGAGCAGGGCCAGG + Intronic
1158530480 18:58256047-58256069 CCTCGCCCCAGAGTGGCTCCCGG + Intronic
1159460275 18:68714870-68714892 CCCGGCCCCACGGCGGGGCCAGG + Intronic
1160565055 18:79781863-79781885 CCCTGCCAGACAGCGGGGCCTGG - Intergenic
1161124243 19:2546932-2546954 CCTTGCCCTGGCCCGGGGCCAGG - Intronic
1161607418 19:5222650-5222672 CCCTGCACCAGAGCCGGACCGGG - Intronic
1162951104 19:14072649-14072671 CCTGTCCCGAGGGCGGGGCCAGG + Intronic
1163266136 19:16223629-16223651 TCTGGCCCCAGAGCCAGGCCTGG + Intronic
1163400387 19:17088547-17088569 CCTGGCCCCTTAGCAGGGCCTGG + Intronic
1164705151 19:30314197-30314219 CCCTGCCCCAGAGGGGTCCCCGG - Intronic
1166217408 19:41344606-41344628 CCATGCCACAGAGGGGAGCCAGG + Intronic
1166732752 19:45068099-45068121 CAGTGCCCAAGAGCTGGGCCCGG + Intronic
1166807554 19:45496513-45496535 CCTCGCTCCCGGGCGGGGCCGGG + Intronic
1167001130 19:46746301-46746323 CCCTGCCCCCGGGCCGGGCCCGG - Exonic
1167593840 19:50417543-50417565 CCCCTCCCCAGGGCGGGGCCGGG + Intronic
1167648677 19:50718691-50718713 GCGTGGCCGAGAGCGGGGCCGGG + Intronic
1167734766 19:51287059-51287081 CCTGGCCCCGGAGAGAGGCCCGG - Intergenic
1167792071 19:51689236-51689258 CCCTGCCCCGGAGCTGGCCCAGG - Intergenic
1168692914 19:58387519-58387541 CTTTTCCCCATAGCGGGGCTTGG + Exonic
925161359 2:1686209-1686231 CCCTGCCCGAGGGCGGGGCTCGG + Intronic
925277803 2:2662726-2662748 CCTTTCCCCAGAGTGCGGGCAGG - Intergenic
925415999 2:3670586-3670608 GCTGGCTCCAGAGCGTGGCCTGG + Intronic
926619340 2:15033060-15033082 CCTTTCCCCAGAGCTCTGCCAGG - Intergenic
932296425 2:70626909-70626931 TCTTGTCCAAGAGCAGGGCCTGG - Intronic
932442595 2:71747214-71747236 CCTGGGCCCAGGGCGGGGCTGGG - Intergenic
934542410 2:95186835-95186857 CCCTGCCCCACAGCAGGCCCCGG + Intergenic
937904875 2:127048232-127048254 CCTGGCCGCAGGGCGGGGCTGGG - Exonic
938380046 2:130831538-130831560 CCTTGCCGCAGCACGGGCCCTGG + Intergenic
947639080 2:231696146-231696168 CCTTGCTCCAGAGTTGGGCCTGG - Intergenic
947745094 2:232503311-232503333 CCTGGCCCCAGGGAGGGGTCTGG + Intergenic
947860021 2:233352230-233352252 CCTTGCCTCAGAGCAGGGCCGGG + Intergenic
948368698 2:237474448-237474470 CTTGGCCCCAGAGCGGGGCAGGG + Intergenic
948827120 2:240578196-240578218 CCTTGCCCCGGGGCGGCACCTGG - Exonic
948869720 2:240791923-240791945 CCCAGCCCCAGTGCAGGGCCTGG - Intronic
1169437926 20:5610431-5610453 CCCTGCCCCACAGCGGCCCCCGG - Intronic
1172277082 20:33685829-33685851 CCGCACCCCAGGGCGGGGCCCGG + Intronic
1173142334 20:40495135-40495157 TCTTGCCCCAGAGCGTCTCCAGG + Intergenic
1173866793 20:46317597-46317619 CCGTGCCCCACAGCTGGTCCTGG + Intergenic
1176866438 21:14057240-14057262 TCTAGGCCCAGAGCAGGGCCAGG + Intergenic
1180076947 21:45467817-45467839 CCTTGCCCCAGCGGGGGTGCCGG + Intronic
1180594233 22:16963110-16963132 CCTTGGGCCAGAGAAGGGCCTGG - Intronic
1180859034 22:19066610-19066632 CCTTGCCTGAGATAGGGGCCTGG - Intronic
1181029741 22:20143950-20143972 CCTGTCCCCAGAGCGTGCCCAGG - Intronic
1181368058 22:22395007-22395029 CCTGGCGCCAGAGCTGGGGCTGG - Intergenic
1183468600 22:37993341-37993363 CATTGCCCCAGACCAGGGCTGGG + Intronic
1184257464 22:43295346-43295368 CCTCACCCCAGGGCGGGGACAGG - Intronic
1185235813 22:49712326-49712348 GCTGGCCCCAGAGCCGGGCCAGG + Intergenic
950119267 3:10470957-10470979 CCTTGCCTCAGAGCGATGGCTGG + Intronic
950810368 3:15645068-15645090 CCTTTCCCCAGACAGGGACCAGG - Exonic
951803590 3:26623216-26623238 CCTTGCGCCAGTCCCGGGCCGGG - Exonic
952955909 3:38557060-38557082 CCTTGCCCCAGAGCCAGGCTTGG + Intronic
953406351 3:42661792-42661814 CCTGGCCCCAGAGCCTGTCCAGG - Intronic
957078498 3:75619194-75619216 CCCAGCCCCAGAGCAGGGTCAGG - Intergenic
958878875 3:99646398-99646420 CCTTGCCCCAGAGAGAGTCAAGG - Intronic
961340440 3:126213561-126213583 CCTCGCCCCAAAGCGGCGCAAGG - Intergenic
961509360 3:127391642-127391664 CCCTGCCCCAGACCCGGTCCAGG + Intergenic
962685913 3:137847558-137847580 CCTTCTCCCTGAGTGGGGCCAGG + Intergenic
962843518 3:139255792-139255814 TGTTGCCCCAGAGCCTGGCCTGG + Intronic
963274293 3:143314826-143314848 TCTTGCCCCAAAGCAGAGCCAGG - Intronic
964876265 3:161372008-161372030 CCCAGCCCCAGAGCGGGGGAGGG - Exonic
969485821 4:7471957-7471979 CCTTTCTCCAGAGGGAGGCCAGG - Intronic
975985504 4:80198082-80198104 CCTGGGCCTAGAGCGGGGCACGG + Intronic
981660269 4:147158329-147158351 CTCTGCCCCAGAGCTGTGCCTGG + Intergenic
981768838 4:148283201-148283223 CCTTGCCTAAGAGTGGGGTCAGG + Intronic
985574811 5:669166-669188 CAGAGCCCCAGGGCGGGGCCTGG + Intronic
987055000 5:14182975-14182997 CCTTTCCTCTGAGCTGGGCCAGG + Intronic
990630391 5:57662409-57662431 CATTGCCCCAGTGAGGGCCCTGG - Intergenic
992105239 5:73444625-73444647 CCGGGCCCCGGAGCGAGGCCTGG + Intergenic
997588910 5:135061135-135061157 CCCTGCCCCAGGGCTGGGACAGG - Intronic
998004107 5:138646055-138646077 CCTTGCCCGTGGGCTGGGCCAGG + Intronic
1000667158 5:164012925-164012947 CCTTGCCCCAGAGGTGAGCGTGG - Intergenic
1002419924 5:179140128-179140150 CTGTGCCCCAGAGTGGGGCCAGG - Intronic
1002447929 5:179301537-179301559 CCCTGTCCCAGTGCGGGGCTGGG - Intronic
1002641693 5:180633491-180633513 ACATGCACCACAGCGGGGCCTGG + Intronic
1003947301 6:11087447-11087469 CCTTCCCGCGGAGCGGGGCTCGG + Intergenic
1004429789 6:15533155-15533177 CCTCTCCCCAGAGCAGGGCATGG - Intronic
1005994925 6:30925374-30925396 CCTTGCCTCACCTCGGGGCCGGG - Exonic
1006079735 6:31558367-31558389 CCCTCCCCCAGGGCAGGGCCAGG - Exonic
1006429063 6:33984064-33984086 CCTTGCCCCGTAGCTTGGCCTGG + Intergenic
1007595405 6:43048121-43048143 CCTCTCCCCAGAGCAGGGCAGGG + Intronic
1007631437 6:43275431-43275453 CCTGGCCCCGGGGCGGGGGCGGG + Intronic
1007661377 6:43488935-43488957 CCTGGCCACAGAGGTGGGCCTGG - Intronic
1008597991 6:53061956-53061978 CCTCGGCCCAGAGCTGCGCCTGG - Intronic
1008941142 6:57046900-57046922 CCAGGCCCCAGAGCTGGGCTCGG - Intronic
1008945331 6:57090398-57090420 CCAGGCCCCAGAGCTGGGCTCGG - Intronic
1011994452 6:93567421-93567443 CCTTGGCACAGAGCTGGCCCTGG - Intergenic
1013209545 6:107974374-107974396 CCAAGCCCCAGAGTGGGGCAGGG - Intergenic
1015101534 6:129487237-129487259 GCTTGCCCCAGCCCTGGGCCAGG + Intronic
1015790210 6:136957986-136958008 CCCTGCCCCAGTGCAGGCCCTGG + Intergenic
1017446192 6:154509715-154509737 CCTGGCCCCGGTGCGGTGCCCGG - Intronic
1018388026 6:163322260-163322282 CCTCCCCACAGAGCGGTGCCTGG + Intergenic
1019104826 6:169659749-169659771 CCCAGCCTCAGAGCGGAGCCTGG - Intronic
1019359326 7:596598-596620 CTGTGCCGCAGAGCGGGGGCCGG - Intronic
1019508584 7:1405706-1405728 CGTGTCCCCAGAGCGGGGCAGGG + Intergenic
1019602135 7:1890044-1890066 TCTTGCCATAGAGAGGGGCCAGG - Intronic
1020037671 7:4974468-4974490 CCGTGCACCCGAGCGCGGCCTGG + Intergenic
1020162147 7:5781156-5781178 CCGTGCACCCGAGCGCGGCCTGG - Intronic
1021640020 7:22727684-22727706 CCTTGCCCCTGCGTGTGGCCGGG + Intronic
1025078317 7:55962529-55962551 CTTTGCCCCAGAGCAGGGAAAGG - Intronic
1026141025 7:67706918-67706940 CCTTGCCTTAGAGCGGGGAATGG - Intergenic
1026805021 7:73424073-73424095 CCCTGCCCCAGCCCCGGGCCGGG - Intergenic
1026970778 7:74466194-74466216 CCCCGCCCCAGAACAGGGCCTGG - Intronic
1029185302 7:98734123-98734145 CCTTACCACAGAGGAGGGCCAGG - Intergenic
1029690029 7:102175189-102175211 CCTGGACCCAGAGTGGGGACCGG - Intronic
1030033255 7:105388316-105388338 CCTTGCCCGCGAGCTGGCCCGGG - Intronic
1033254539 7:139788774-139788796 GCCTGCCCCAGACTGGGGCCAGG + Intronic
1034339022 7:150340685-150340707 CCTCCCCCCAGAGCAGGGCGCGG - Exonic
1034350151 7:150410081-150410103 CCTAGCCCCAGAGGGGTGGCTGG + Intronic
1034497676 7:151432105-151432127 CCTGTCCCCAGAGCTGCGCCCGG + Intronic
1034498623 7:151436224-151436246 CCTTCCTCCAGAGCAGGGGCTGG - Exonic
1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG + Intronic
1035246039 7:157562391-157562413 CCTTCCCCCACAGCAGGTCCTGG - Intronic
1035274199 7:157737663-157737685 GCTTTCCCCAGAATGGGGCCTGG + Intronic
1035362453 7:158322521-158322543 CCTGGCCCCAGTGGGCGGCCAGG + Intronic
1036802542 8:11803002-11803024 CCTTGCCCCAGATCCGGGCCCGG - Intronic
1038643906 8:29348349-29348371 CCTGGCGGCTGAGCGGGGCCAGG - Intronic
1041044397 8:53877631-53877653 CCTTGCCAGAGAGCGGGGGAGGG + Intronic
1042281932 8:67064590-67064612 CGCTGCCCCGGAGCGGGGGCAGG + Intronic
1042818882 8:72908815-72908837 CCTTCCCATAGAGTGGGGCCTGG + Intronic
1044305298 8:90633091-90633113 CCTTCCCCTAGAGCGTGGGCTGG + Intronic
1047292382 8:123541472-123541494 CGTTGTCCCAGAGCGAGGCCCGG + Intergenic
1047525846 8:125633437-125633459 CCTTGCCTCACAGAGGGCCCTGG - Intergenic
1048458061 8:134596058-134596080 CCTTGCACCAGCGTGGGGCTTGG - Intronic
1049765136 8:144351709-144351731 TCCTGCCCCAGAGATGGGCCAGG + Intergenic
1051056679 9:12995316-12995338 TCTTGGCCCAGAGTGGGGCTTGG - Intergenic
1052972799 9:34387294-34387316 CCTTGGCCAAGAGAAGGGCCAGG - Intronic
1053073528 9:35114980-35115002 CCTTGCCCCAGGGCCTGGCCTGG - Intronic
1056759147 9:89402792-89402814 CCCAGCCCCACAGTGGGGCCAGG + Intronic
1057076884 9:92142523-92142545 CCTTTCCCCAGAGCGGGGCTGGG - Intergenic
1057488605 9:95506022-95506044 CCGGGCCGCGGAGCGGGGCCGGG + Intronic
1059440067 9:114301688-114301710 CCCGGCCCCAGAGGGCGGCCCGG + Exonic
1059699920 9:116765290-116765312 CCTGGCCCCAGAGTCGGGCTAGG + Intronic
1059839162 9:118192409-118192431 CCTTGGCCCAGGGCGGGTCCTGG - Intergenic
1060542735 9:124441550-124441572 GCTTGCAGCAGAGCCGGGCCAGG - Intergenic
1061217487 9:129230167-129230189 CCAGGCCCCAGTGTGGGGCCTGG + Intergenic
1061402647 9:130376753-130376775 CCTAGCCCTAGAGCTGGTCCGGG + Intronic
1061422050 9:130477873-130477895 CCGAGCGCCAGAGCCGGGCCAGG - Intronic
1062395912 9:136352734-136352756 CCTCCCTCCAGAGCTGGGCCAGG - Intronic
1062494491 9:136825395-136825417 CCGTGCCCAGGATCGGGGCCCGG + Intronic
1062494508 9:136825428-136825450 CCGTGCCCAGGATCGGGGCCGGG + Intronic
1062494538 9:136825494-136825516 CCGTGCCCAGGATCGGGGCCCGG + Intronic
1062502940 9:136858988-136859010 CCTTGTCTGAGAGCAGGGCCAGG - Exonic
1062543557 9:137052062-137052084 CCCTGCGCCTGAGTGGGGCCAGG - Intronic
1062555531 9:137112071-137112093 CCTTGCCCCCGAGTGGTTCCAGG + Intronic
1196053786 X:111333501-111333523 CCTTGCCCTAGAGTTGGGCCAGG - Intronic
1200065313 X:153501939-153501961 CGTTGCCCCACAGCTGGTCCCGG + Intronic
1200218929 X:154381095-154381117 GCTGGCCCCAGAGCGGGACCTGG - Exonic