ID: 1148054586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:44786629-44786651 |
Sequence | CTGGGCCACCACTGGGTGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148054577_1148054586 | 5 | Left | 1148054577 | 17:44786601-44786623 | CCCATCTGACTACAGGAGGAGAC | No data | ||
Right | 1148054586 | 17:44786629-44786651 | CTGGGCCACCACTGGGTGCAGGG | No data | ||||
1148054578_1148054586 | 4 | Left | 1148054578 | 17:44786602-44786624 | CCATCTGACTACAGGAGGAGACC | No data | ||
Right | 1148054586 | 17:44786629-44786651 | CTGGGCCACCACTGGGTGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148054586 | Original CRISPR | CTGGGCCACCACTGGGTGCA GGG | Intergenic | ||
No off target data available for this crispr |