ID: 1148054586

View in Genome Browser
Species Human (GRCh38)
Location 17:44786629-44786651
Sequence CTGGGCCACCACTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148054577_1148054586 5 Left 1148054577 17:44786601-44786623 CCCATCTGACTACAGGAGGAGAC No data
Right 1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG No data
1148054578_1148054586 4 Left 1148054578 17:44786602-44786624 CCATCTGACTACAGGAGGAGACC No data
Right 1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148054586 Original CRISPR CTGGGCCACCACTGGGTGCA GGG Intergenic
No off target data available for this crispr