ID: 1148059923

View in Genome Browser
Species Human (GRCh38)
Location 17:44829699-44829721
Sequence CGCACTCGGCGGCGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148059923_1148059928 -6 Left 1148059923 17:44829699-44829721 CCGCCGGGGCGCCGCCGAGTGCG 0: 1
1: 0
2: 2
3: 4
4: 96
Right 1148059928 17:44829716-44829738 AGTGCGCGCCGCTTCTGTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148059923_1148059934 24 Left 1148059923 17:44829699-44829721 CCGCCGGGGCGCCGCCGAGTGCG 0: 1
1: 0
2: 2
3: 4
4: 96
Right 1148059934 17:44829746-44829768 ACCGTCGCCCGACACCTCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 22
1148059923_1148059927 -7 Left 1148059923 17:44829699-44829721 CCGCCGGGGCGCCGCCGAGTGCG 0: 1
1: 0
2: 2
3: 4
4: 96
Right 1148059927 17:44829715-44829737 GAGTGCGCGCCGCTTCTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 21
1148059923_1148059936 30 Left 1148059923 17:44829699-44829721 CCGCCGGGGCGCCGCCGAGTGCG 0: 1
1: 0
2: 2
3: 4
4: 96
Right 1148059936 17:44829752-44829774 GCCCGACACCTCCGCGGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148059923 Original CRISPR CGCACTCGGCGGCGCCCCGG CGG (reversed) Intronic
905375042 1:37514491-37514513 CGCATTCTGCGGCCCGCCGGCGG - Intronic
906321510 1:44820316-44820338 CGCACCCGGCGCCGCCCACGGGG - Intronic
909585380 1:77282499-77282521 CGCACTCGCCCGCTCCCCCGAGG + Intronic
918040867 1:180913102-180913124 CCCAGTCGGCCGCGCCCCGAGGG + Intergenic
919075515 1:192808672-192808694 CGAAGTTGGCGGCGGCCCGGCGG - Intergenic
1063114741 10:3066249-3066271 CCCACTCGACGGCTCACCGGAGG - Intergenic
1067162896 10:43842341-43842363 TGCACTCGGGGGCTCCCTGGGGG + Intergenic
1073051673 10:100671173-100671195 CGCACGCGGCCGCCCCCTGGTGG - Intergenic
1073063981 10:100747895-100747917 AGGACTCGGCGGACCCCCGGCGG - Intronic
1076793238 10:132787428-132787450 CGCGCTCGGGGCTGCCCCGGCGG + Intergenic
1081700141 11:45147355-45147377 CGCCCTCGGCCCCGCGCCGGGGG + Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083997224 11:66278428-66278450 CGCGCCGGGCGGCGGCCCGGGGG - Exonic
1084546783 11:69818683-69818705 CGGACGCTGCGGGGCCCCGGGGG - Intronic
1085514706 11:77105459-77105481 AGCCCTCGGCGGCGCCCAGATGG - Intronic
1088645354 11:111912856-111912878 CGTACTCGGCGGTGGCCGGGTGG - Exonic
1091594157 12:1864634-1864656 CGCCGTCGGCGGCGCCCTGGTGG - Intronic
1096504433 12:52083577-52083599 AGCACTCGGCTGCCCCCCTGTGG + Intergenic
1100391725 12:94150044-94150066 CGCTCTCCGCGGCGCCCCGGGGG - Intronic
1121050377 14:90816092-90816114 CGCGCCCGGCCGCGCCTCGGGGG + Intronic
1122137934 14:99645402-99645424 CCCACTCGGCGGCGTCCACGCGG - Exonic
1122917313 14:104865168-104865190 CGCACCCCGCGCCGCCCCGCCGG - Intergenic
1123013874 14:105364318-105364340 CGCGGTGGGCGGCGGCCCGGGGG + Intronic
1123036767 14:105474800-105474822 CGCGGGCGGCGGCGGCCCGGAGG + Intronic
1123053178 14:105557316-105557338 CGGACTCGGGAGCCCCCCGGCGG - Intergenic
1123077753 14:105677730-105677752 CGGACTCGGGAGCCCCCCGGCGG - Intergenic
1124426889 15:29570413-29570435 CGCCCGCGGTGGCGTCCCGGCGG + Intronic
1130979463 15:88803082-88803104 CGCAGTCGGAGGGGCCCAGGAGG - Intergenic
1132600472 16:770612-770634 CCCCCCAGGCGGCGCCCCGGTGG - Exonic
1136535073 16:30894246-30894268 CGCTCTCGGCGGCGGGCAGGGGG - Exonic
1139489646 16:67279470-67279492 GGCGCTGCGCGGCGCCCCGGCGG + Exonic
1142136283 16:88453360-88453382 CGCACTCGCCGCCGCCGCCGCGG - Exonic
1143181569 17:4987227-4987249 CACTCTGGGCGGCCCCCCGGCGG + Intronic
1147683907 17:42275994-42276016 CGAACGCCGCGGCGCCGCGGGGG - Intronic
1148059923 17:44829699-44829721 CGCACTCGGCGGCGCCCCGGCGG - Intronic
1148564717 17:48626066-48626088 CGGGCTCAGCGGCGCCCAGGAGG + Exonic
1148664080 17:49361863-49361885 CGCACTCGCCACCGCCGCGGCGG - Intronic
1150108766 17:62479568-62479590 GGCTCTCGGGGGCGCCCGGGAGG - Intronic
1151884018 17:76912792-76912814 CGCACACGGCGGGGCGCGGGCGG - Intronic
1153627885 18:7038863-7038885 AGCACTCGGAGCAGCCCCGGGGG + Exonic
1156350702 18:36298536-36298558 CGTCCCCGGCGGCGCCCCCGGGG - Intronic
1157842037 18:50967949-50967971 CGCGCTCGGTGGCGCCCGCGCGG - Intergenic
1160991794 19:1863209-1863231 CGGACCCGGAGCCGCCCCGGGGG - Exonic
1160992209 19:1864418-1864440 CGCCCGCGGCGGGGCCCGGGAGG + Intergenic
1161043795 19:2123799-2123821 CGCACTGGGCGGGGCCCATGGGG - Intronic
1161080600 19:2308174-2308196 CGCGCACGGCGGAGCCCGGGAGG - Intronic
1167156312 19:47741411-47741433 CTCACTCGGCGGAGCCCTTGTGG - Exonic
927213159 2:20650974-20650996 CGCAGTCCGGGGCGCCCGGGCGG - Intronic
928093775 2:28392179-28392201 TGCACTCGGCGGCGCCGCGGAGG + Intergenic
932725686 2:74178380-74178402 CGCCCTCGGGGGCGCTCGGGCGG + Intronic
934655750 2:96116241-96116263 CGCCCTCGGCGCCGCCCGAGGGG - Exonic
936104692 2:109614317-109614339 CTCACTGGGCCGCGCCCGGGCGG - Exonic
938296462 2:130182311-130182333 CGGGGTCGGCGGCGCCCCCGGGG + Exonic
938460289 2:131492326-131492348 CGGGGTCGGCGGCGCCCCCGGGG - Exonic
938727287 2:134120129-134120151 CCCGCTCGGCGGCGGCCCTGCGG + Intronic
940316805 2:152335468-152335490 CGCCCTCCGCCGCGCCCAGGCGG - Exonic
945188951 2:207166641-207166663 CGCCCTCGGCGGCTTCCCCGCGG - Intronic
946395563 2:219442201-219442223 CGCCCTCGGCGGGGCTCGGGTGG - Intronic
947792578 2:232876557-232876579 CGCACGCCCCGGCGCCCCTGCGG - Intronic
947992379 2:234497386-234497408 CGCCCACGGCTGCGGCCCGGAGG - Intergenic
1175997187 20:62817129-62817151 CGCGCTCACCTGCGCCCCGGCGG - Exonic
1176077203 20:63254030-63254052 CGCACCCGGGGGCGCACCCGGGG + Intronic
1179495043 21:41766421-41766443 CGCAGACCGCAGCGCCCCGGTGG + Intronic
1179627015 21:42654355-42654377 GGCTCTCCGCGGGGCCCCGGAGG - Intronic
1182355492 22:29720696-29720718 CGCACCCCGGGGCGCCGCGGTGG + Intronic
1183093701 22:35540362-35540384 CGCAGACCGCGGCGCCCCGGAGG + Intergenic
1185388428 22:50546996-50547018 CGCTCCCCGCGGCGCCCAGGCGG - Intergenic
952152404 3:30606995-30607017 CGGGCTCGGCGGGGCGCCGGGGG + Intronic
964786287 3:160399896-160399918 CCCCCTCGGCCGCTCCCCGGCGG + Intronic
968835725 4:2963260-2963282 CGCTCCCGCCGGCGCCCCGGAGG + Exonic
971406009 4:26321157-26321179 CGCACGCGACGCCGCCCCCGCGG - Intronic
985895484 5:2748312-2748334 CGCGGCCGGCGGCGCCCGGGAGG - Intronic
997302141 5:132813891-132813913 CGCACCCTTCGGCCCCCCGGGGG + Exonic
998060116 5:139112691-139112713 CGCACGGGGCGGCGGCCGGGCGG - Intronic
1002021227 5:176365596-176365618 GGCGCTGGGCGGCGCCGCGGCGG + Exonic
1002901889 6:1416555-1416577 TGCACGGGGCGCCGCCCCGGAGG + Intergenic
1007390239 6:41546503-41546525 CGCAGGCGGCGGCGGCGCGGCGG + Exonic
1007631712 6:43276510-43276532 CGCACACGGCCGCGCACGGGCGG + Intronic
1007644457 6:43369520-43369542 CGCGCTCGGCCGGGCCCCCGGGG - Intergenic
1018968440 6:168507587-168507609 AGCAGTGGGGGGCGCCCCGGGGG - Intronic
1022427948 7:30285537-30285559 CGCCTCCGGCGGCGCCGCGGCGG + Exonic
1024520969 7:50304123-50304145 CGCACCCGCCGCCGCCCCGGCGG + Intronic
1025077023 7:55952170-55952192 AGCACTCGGCGGGGCCGCCGCGG - Intronic
1026776831 7:73235699-73235721 CGCAGCCGGCGGTGCCCCCGCGG + Intergenic
1027017680 7:74789069-74789091 CGCAGCCGGCGGTGCCCCCGCGG + Exonic
1027070342 7:75156863-75156885 CGCAGCCGGCGGTGCCCCCGCGG - Intergenic
1028173638 7:87628542-87628564 GGCAGTCGGCGGCGCGCCGAGGG + Exonic
1031966598 7:128031800-128031822 CGGAGCCGGCGGCGCGCCGGGGG - Intronic
1032037780 7:128532078-128532100 GGCTCTCGGGGGCGCCCGGGAGG - Intergenic
1034192693 7:149224013-149224035 CCCACCCGGCGGCGCCTCGCCGG - Exonic
1034412241 7:150947661-150947683 CCCACCCGGCGGCTCTCCGGGGG + Exonic
1038167954 8:25103152-25103174 CGCACGGGGCGGCTGCCCGGCGG - Intergenic
1043873882 8:85463937-85463959 CGTGCTCGGGGGCGGCCCGGGGG - Exonic
1048967217 8:139623876-139623898 CGCAGTCGGAGGCGCCCCTCTGG - Intronic
1049585361 8:143430418-143430440 CGCGCCCGGCCGCGCCCCGACGG + Intergenic
1050109502 9:2200215-2200237 TCCACTAGGCGGCGCCCCAGTGG + Intergenic
1051621055 9:19049634-19049656 CCCAGTCCGCGGTGCCCCGGCGG + Exonic
1059145546 9:111896672-111896694 CGCTCTCGCCGGCGCCGCAGCGG + Intergenic
1059375373 9:113876577-113876599 CGCACCCCGCAGCGCCCGGGGGG - Intronic
1062507667 9:136886455-136886477 CGCACGCGGCGGAGCGGCGGCGG + Intronic
1062656338 9:137605970-137605992 CGGGCTCGGCGGCGCCGGGGAGG + Intronic
1189044020 X:37571999-37572021 CCCACTCGGGGGCGGCGCGGAGG + Exonic
1189325707 X:40109555-40109577 CGGACTCGGCGCCGGCCCCGCGG + Intronic