ID: 1148063308

View in Genome Browser
Species Human (GRCh38)
Location 17:44851259-44851281
Sequence CAGGAGTCCACGCACTCACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148063303_1148063308 1 Left 1148063303 17:44851235-44851257 CCCACTGTAGGGAGCAGGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1148063304_1148063308 0 Left 1148063304 17:44851236-44851258 CCACTGTAGGGAGCAGGAGCTCC 0: 1
1: 0
2: 0
3: 22
4: 185
Right 1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG 0: 1
1: 0
2: 1
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148063308 Original CRISPR CAGGAGTCCACGCACTCACA TGG Exonic
901063571 1:6484911-6484933 CAGGCGTCCACCCTCACACAAGG + Intronic
902246506 1:15124442-15124464 CACCACTCCACACACTCACAGGG + Intergenic
903012667 1:20342563-20342585 CAGAAGTCCGCTCTCTCACAGGG - Exonic
906065173 1:42975374-42975396 CAGGGCTCCACACTCTCACATGG - Intergenic
911725938 1:101240532-101240554 CAGAAGTGCACACACTCACTTGG - Exonic
924362165 1:243254132-243254154 CTGGAGTCCAAGCACTGCCAAGG - Intronic
1065047396 10:21756890-21756912 CTGGAGTCCAGTCGCTCACAAGG + Intronic
1065478268 10:26164637-26164659 CAGGAATCCACACATCCACAGGG + Intronic
1066212556 10:33254057-33254079 CGGGAGTCCACCCATTCTCAGGG + Exonic
1066464908 10:35642381-35642403 GCGGAGTCCACGCGCTCCCAGGG + Intergenic
1067837538 10:49650947-49650969 AAGGAGTCCACTCACTTCCAGGG + Intronic
1069158185 10:65054392-65054414 CAGGAGCCCACGGCCTCAGATGG + Intergenic
1072606522 10:96988174-96988196 CAGGAGACCACTCCCTCACTTGG + Intergenic
1076382966 10:130037642-130037664 CAGGAGGCTGTGCACTCACAGGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1084238744 11:67805101-67805123 CGGGAGCCCAGGCACTCACGTGG + Intergenic
1084716518 11:70877687-70877709 CAGGAGTCCAGCCAATGACATGG - Intronic
1085156686 11:74301977-74301999 CAGGAGTTCATGCACTGGCAGGG + Intronic
1085738949 11:79063187-79063209 CAGGAGACCACGCACGGTCAGGG - Intronic
1088020356 11:105111562-105111584 CAGGAGTCCATCCACTCCCATGG + Intergenic
1090300165 11:125629080-125629102 CAGGAGTCCACTAACACATATGG - Intronic
1091283564 11:134395850-134395872 CAGGAGTCCAGGGTCTCAGAAGG + Intronic
1113806283 13:113111410-113111432 CAGGACACCTCACACTCACAGGG + Intronic
1113806298 13:113111532-113111554 CAGGACACCTCACACTCACAGGG + Intronic
1116084303 14:40216533-40216555 CTGGAGACCACGAACTCACCTGG - Intergenic
1118155741 14:63239540-63239562 CAAGAATCCACATACTCACATGG + Intronic
1122100824 14:99408466-99408488 AGGGAGTCCAGGCACTCCCAGGG + Intronic
1122820540 14:104342667-104342689 CAGGATTGCACGCACCCACACGG - Intergenic
1125984224 15:44034051-44034073 CAGGAGTCTGCCCAGTCACATGG + Intronic
1129162883 15:73756876-73756898 GAGGAGTTCACAGACTCACATGG - Intergenic
1130756599 15:86770946-86770968 CAGGACTGCACTCAGTCACATGG - Intronic
1130851558 15:87799644-87799666 CAGGAGGCCACCCCATCACAGGG + Intergenic
1132495371 16:260652-260674 AAGGAGCCCACACACACACATGG - Intronic
1144496477 17:15749350-15749372 CAGGAGCCCACGGCCTCAGATGG - Intergenic
1144606061 17:16666754-16666776 CAGGAGCCCACGGCCTCAGATGG - Intergenic
1144905105 17:18635349-18635371 CAGGAGCCCACGGCCTCAGATGG + Exonic
1147920342 17:43912429-43912451 CAGGACTCCCCCCACTCCCAGGG - Intergenic
1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG + Exonic
1148617312 17:49010807-49010829 CAGGAGTCCACGCACTAAAATGG + Intronic
1149476656 17:56966602-56966624 CAGGAGTGGATGCACTCAAAGGG + Intergenic
1152335052 17:79695913-79695935 CAGGATGCAACCCACTCACAGGG + Intergenic
1159835712 18:73332725-73332747 CAGGACTCCAAGCACTAGCAGGG - Intergenic
1160244461 18:77145843-77145865 CAGGAGGCCCGGCCCTCACACGG - Intergenic
1160261624 18:77299520-77299542 CATGAGTCAAAGCAGTCACAGGG - Intergenic
925667791 2:6279480-6279502 CGTGAGTGCACACACTCACAGGG - Intergenic
926139749 2:10361166-10361188 CAGGAGCCCACGGACTCGCCTGG - Intronic
941004813 2:160237176-160237198 CAGGAGTCCCTGCTCTCAAAGGG + Intronic
943562874 2:189484137-189484159 AAGGAGTCCATGGACTCACCTGG + Intergenic
944471245 2:200055583-200055605 CAGGAGGTCAAGCGCTCACAAGG - Intergenic
946164235 2:217854125-217854147 CAGGGGTCCTGGCACACACATGG + Intronic
947856283 2:233326726-233326748 CAGAGGTACAGGCACTCACAGGG - Intronic
948988940 2:241542054-241542076 CAGGTGTCCGCGCACACACCGGG - Intergenic
1168771160 20:417801-417823 CAGGAGACCCTGCACTCCCATGG + Exonic
1171534092 20:25870918-25870940 CAGACGTCCACGCACAAACAAGG - Intergenic
1172894571 20:38291459-38291481 CAGGAGTCCAGGCAGAGACAAGG - Intronic
1178098188 21:29237719-29237741 CAGGAGTCCACACACAGTCAGGG - Intronic
1181764722 22:25083247-25083269 CAGGAGCCCACACACGCAGAGGG - Intronic
1183316730 22:37141204-37141226 CAGGTGTCCCTGCACTCTCAGGG + Intronic
1183398785 22:37588913-37588935 CAGGAGCACACCCACTCCCAAGG + Intergenic
1183830696 22:40417163-40417185 CAGGAGTCCGGGCACGCCCATGG - Intronic
1184973815 22:48046820-48046842 CATCAGTCCACGCATACACACGG + Intergenic
951131888 3:19056371-19056393 CAAGAGTCTAGGCACTTACATGG - Intergenic
954320576 3:49829747-49829769 CAGGAGTCCCAGCTCTCACTGGG - Exonic
954413979 3:50383941-50383963 CAGGAGACCATGCATGCACAGGG + Intronic
955418199 3:58712257-58712279 TAGGGGACCACACACTCACAAGG + Intergenic
960149524 3:114236743-114236765 CCGCACTCCACGCACTTACAGGG + Exonic
961300153 3:125916814-125916836 CGGGAGCCCAGGCACTCACGTGG - Intergenic
962373476 3:134840329-134840351 CAGGAGTTCACCTATTCACAGGG - Intronic
968849040 4:3065751-3065773 CAGGCAGCCACGCAGTCACAAGG - Intergenic
968997505 4:3955207-3955229 CGGGAGCCCAGGCACTCACGTGG + Intergenic
978795049 4:112700510-112700532 CAGGAGTCCACACACTGTCTTGG - Intergenic
983656896 4:170092315-170092337 GTGGAGACCACGCACCCACAGGG + Intergenic
985036919 4:185849660-185849682 CAGCAGGCCACACTCTCACAGGG + Intronic
985529190 5:423974-423996 CAGGGACCCACGCACTCACCAGG - Exonic
985716434 5:1465054-1465076 CACAAGTGCACGCACACACACGG + Intronic
985721099 5:1489606-1489628 CCTGAGTTCACGCACTCACTAGG + Intronic
986461386 5:7975974-7975996 CAGGAATCCAGGCACTCAGTTGG - Intergenic
987048898 5:14132858-14132880 CAGTAGTACAGGCTCTCACACGG - Intergenic
987316338 5:16728213-16728235 CAGTAGTCCATGCACACGCAGGG - Intronic
992030321 5:72714513-72714535 CAGAAGTTCAGACACTCACATGG - Intergenic
997988912 5:138527634-138527656 CAGGGGTCCACTCATGCACAGGG + Intronic
1002917001 6:1537471-1537493 CAGGAGTCCACGCACTTGGGTGG + Intergenic
1002933990 6:1656226-1656248 CAGGAGACCACTGACTCATAAGG - Intronic
1012617531 6:101294891-101294913 CAAGAGTCCAATGACTCACAGGG - Intergenic
1017798541 6:157870373-157870395 GAGGGGTACATGCACTCACACGG - Intronic
1019431366 7:1001319-1001341 CAGGACTCCACTCACCCACATGG - Intronic
1019431609 7:1002131-1002153 CAGGACTCCACTCACCCACAGGG - Intronic
1019431645 7:1002271-1002293 CAGGATTCCACTCACCCACAGGG - Intronic
1019431726 7:1002541-1002563 CAGGACTCCACTCACCCACAGGG - Intronic
1019431740 7:1002595-1002617 CAGGACTCCACTCACCCACAGGG - Intronic
1019431769 7:1002699-1002721 CAGGGCTCCACTCACCCACAGGG - Intronic
1019431774 7:1002717-1002739 CAGGATTCCACTCACCCACAGGG - Intronic
1025858329 7:65303781-65303803 CAGGAGTGGATGCACTCAAAGGG + Intergenic
1027924745 7:84446966-84446988 CAGGCATCCCCGCACTCTCAAGG + Intronic
1034401009 7:150861417-150861439 CAGACGTGCACGCACTCACACGG + Intronic
1034892328 7:154852301-154852323 CAGGATGCCATGGACTCACAAGG - Intronic
1035319239 7:158017808-158017830 CAGGATTTCACACACGCACAAGG + Intronic
1037521541 8:19684685-19684707 CAGAACTCCATGCACTCCCAGGG - Intronic
1037850521 8:22323860-22323882 CAGGAGTCCTCTCAGTAACATGG + Intronic
1047151135 8:122264460-122264482 CAGGACACCATGCCCTCACAGGG + Intergenic
1051029563 9:12658245-12658267 CAGGAGAGCAAGGACTCACAGGG - Intergenic
1053643009 9:40106288-40106310 CAGCAGCCCACGCGCACACAGGG + Intergenic
1055733553 9:79304137-79304159 CAGGAGTCAACGCTATCTCATGG - Intergenic
1057210330 9:93197842-93197864 CAGGAATGCACGACCTCACACGG - Intronic
1060995537 9:127873361-127873383 CCGGGGTCCAGGCACCCACAGGG - Intronic
1062581432 9:137230797-137230819 CAGGAGCCCAGGCCCTCACGGGG - Exonic
1185699688 X:2221282-2221304 CAGGAGTCTCAGGACTCACATGG + Intronic
1191108896 X:56789683-56789705 CTGGAGCCCAGGCACTCATAGGG + Intergenic
1195992807 X:110699400-110699422 CAGGAGTCCAGGGAATTACAGGG - Intronic