ID: 1148067965

View in Genome Browser
Species Human (GRCh38)
Location 17:44886966-44886988
Sequence CCAGTGGCCCACATTCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148067965_1148067970 -2 Left 1148067965 17:44886966-44886988 CCTTTCTGAATGTGGGCCACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1148067970 17:44886987-44887009 GGTCACAAGTGGGTTGAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1148067965_1148067972 30 Left 1148067965 17:44886966-44886988 CCTTTCTGAATGTGGGCCACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1148067972 17:44887019-44887041 ATCACAGCACAGCCCTTTACGGG 0: 1
1: 0
2: 1
3: 7
4: 141
1148067965_1148067971 29 Left 1148067965 17:44886966-44886988 CCTTTCTGAATGTGGGCCACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1148067971 17:44887018-44887040 AATCACAGCACAGCCCTTTACGG 0: 1
1: 0
2: 6
3: 24
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148067965 Original CRISPR CCAGTGGCCCACATTCAGAA AGG (reversed) Intronic
900387584 1:2417570-2417592 CCAGATGCCCACATCCAGAGTGG - Intergenic
900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG + Intergenic
900525252 1:3125367-3125389 ACAGAGGCCCACTTCCAGAAAGG - Intronic
903018152 1:20375284-20375306 GCAGAGGCCAAGATTCAGAAAGG - Intergenic
905856823 1:41319962-41319984 CCAGTGGCCCAGAGGCAGGACGG + Intergenic
907571837 1:55491079-55491101 ACAGGGCCCCACTTTCAGAAAGG - Intergenic
911067397 1:93802771-93802793 CTTGTGGCCCACCTTCTGAATGG + Intronic
912452063 1:109773355-109773377 CCAGAGGGCCACATTCTGAGAGG - Intronic
915280937 1:154821716-154821738 TGAGTGGCCCAAGTTCAGAAAGG + Intronic
916697851 1:167258339-167258361 ACAGTGTGGCACATTCAGAAGGG - Intronic
919825488 1:201500380-201500402 TCAGGGGCCCACATCCAGCAGGG + Intronic
921730388 1:218571541-218571563 CAAATGGCCCACATTCAAGAAGG + Intergenic
922189465 1:223304579-223304601 CCAGTGGGTCACAGTCAAAAAGG + Intronic
924033304 1:239909022-239909044 CCAGTAGCCCAGATTCCAAAAGG - Exonic
1062977145 10:1692476-1692498 CCACTGTCCCAAATTCAGCAGGG + Intronic
1063853906 10:10224844-10224866 CATGTGGCCCACTTTCAAAATGG + Intergenic
1068475249 10:57516140-57516162 CTTAAGGCCCACATTCAGAAAGG - Intergenic
1069043042 10:63714157-63714179 CCAGTGACCCACATTCCCAGTGG - Intergenic
1070365559 10:75733510-75733532 CCTGTGGCACTCATACAGAAAGG - Intronic
1070750338 10:78960342-78960364 CCAGGGGCCCACAGCCAGCACGG - Intergenic
1072732063 10:97852918-97852940 CCAGTGACACACATTCACAGAGG - Intronic
1073800935 10:107040579-107040601 TCACTGGCCTAAATTCAGAAAGG - Intronic
1074747957 10:116554227-116554249 CCATTGACCGACATTCACAAAGG + Intronic
1077340212 11:2023099-2023121 CCTGTGGCCCACGCTCAGAGGGG - Intergenic
1078308850 11:10218720-10218742 CCAGTTTCTCACATTTAGAATGG - Intronic
1082794575 11:57370007-57370029 CCAGGGCCCCACACTCACAAAGG + Exonic
1084459895 11:69290896-69290918 CCAGTTGCTCACAGGCAGAAGGG + Intergenic
1084521336 11:69664851-69664873 ACAGTGGCCCACTCTTAGAATGG - Intronic
1086044163 11:82512931-82512953 CCAGTGTCTGACATACAGAAAGG - Intergenic
1088447874 11:109951733-109951755 CCAGTCCCCAACATTCGGAAGGG + Intergenic
1090715111 11:129423475-129423497 CCAGGGGGCCACATGCAGAAAGG + Intronic
1202823197 11_KI270721v1_random:78288-78310 CCTGTGGCCCACGCTCAGAGGGG - Intergenic
1096070345 12:48771996-48772018 CCATTGCCCGACATTCACAAGGG + Intronic
1099286671 12:80721392-80721414 CCAGTGGTTCAGATCCAGAAAGG + Intergenic
1101212094 12:102544714-102544736 CCTGTGGCCCAAAATGAGAAGGG + Intergenic
1105290012 13:19047655-19047677 CCAGGGCCCCACATTCCCAATGG + Intergenic
1108168872 13:47720798-47720820 CCTGTGGACCACATTTTGAAGGG + Intergenic
1109275455 13:60298893-60298915 CCAGGAGCCCACATCCAGAATGG + Intergenic
1109820011 13:67640525-67640547 CCAGTGACCGAAATTCAGTAAGG + Intergenic
1114229911 14:20771796-20771818 CCAGTGCCCCAAAATCTGAATGG - Intergenic
1120836312 14:89041058-89041080 CCACTGGCCTACTTTCAGCATGG + Intergenic
1121653413 14:95576604-95576626 CCTGGAGCCCACCTTCAGAAAGG + Intergenic
1124042160 15:26115700-26115722 CTAGTGGCCTACATTCCGATAGG - Intergenic
1124649254 15:31462927-31462949 CTGGTGACCCACAATCAGAAAGG - Intergenic
1125502262 15:40247084-40247106 CCAGTGGCTGACTTTCAGGAAGG - Intronic
1126343459 15:47668760-47668782 GCAGGCACCCACATTCAGAATGG - Intronic
1128504410 15:68256621-68256643 ACAGGGCCCCACGTTCAGAAGGG + Intronic
1129524384 15:76204583-76204605 CCTGTGGCCCAGCTTCAGCAGGG + Exonic
1129905157 15:79182168-79182190 ACAGTGGCCTAGAATCAGAAAGG - Intergenic
1134236029 16:12467138-12467160 CCAGTGGCTCAGACTCAGTAAGG + Intronic
1137411577 16:48232732-48232754 CCAGGGCCCCACACTCAGAAGGG + Intronic
1137502137 16:49019712-49019734 CCAGTGGCCCTGACTCTGAATGG + Intergenic
1138615761 16:58164763-58164785 CCTGTGGCCCATATGCATAAGGG - Intronic
1139327114 16:66161152-66161174 ACATTGGCCCAGATTGAGAAAGG - Intergenic
1139331551 16:66196160-66196182 CCACTGGCCCACATCCATCAGGG + Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146482505 17:33216379-33216401 CAAGTGGCCCACAGTCTGGAAGG + Intronic
1148067965 17:44886966-44886988 CCAGTGGCCCACATTCAGAAAGG - Intronic
1149216127 17:54357048-54357070 CCAGTTTCTCCCATTCAGAATGG - Intergenic
1149329520 17:55566976-55566998 CTGGTGGCCCACAATCTGAAAGG - Intergenic
1152450688 17:80377697-80377719 CCAATGACCCACATTGAAAAGGG - Intronic
1153103179 18:1497519-1497541 GCAGTGGCCCACAACCAGTATGG + Intergenic
1155179490 18:23331480-23331502 CCAGTGGCCAACAAACAGGAGGG + Intronic
1156833210 18:41520796-41520818 CCAGCAGCCCACACTCAGGAGGG + Intergenic
1159060818 18:63512173-63512195 CTAGTGGCCCACACACAGCAAGG + Intergenic
1161920563 19:7262554-7262576 GCAGTGGCCCTGATTCACAATGG + Intronic
1163728257 19:18934612-18934634 ACATTGGGCCACATTGAGAAAGG + Intronic
1166258053 19:41619924-41619946 TCAGAGGCCCACATTAACAAGGG - Intronic
1166283638 19:41810621-41810643 TCAGGGGCCCACATTAACAAGGG + Intronic
1166410698 19:42554075-42554097 TCAGGGGCCCACATTAACAAGGG - Intronic
1167689774 19:50978190-50978212 ACAGAGCCCCACACTCAGAAGGG - Intronic
1167753997 19:51399492-51399514 GCATTGGCCCTTATTCAGAATGG + Intergenic
1168225902 19:54995000-54995022 CCAGCACCCCACATTCAGAGAGG + Intronic
928799724 2:35072866-35072888 CCCGTGGCTGATATTCAGAATGG - Intergenic
930485119 2:52001728-52001750 CCAATGCTCCACATTCAGAAGGG - Intergenic
932177097 2:69613072-69613094 CCAATGGCCCACTTTAAGACAGG + Intronic
932185735 2:69693879-69693901 CCAGAGGTCTGCATTCAGAAGGG - Intronic
933136025 2:78736830-78736852 CCAGGGCCCCACATTCAGTTGGG - Intergenic
935481516 2:103595339-103595361 CCAGTTTCTCCCATTCAGAATGG + Intergenic
935804871 2:106735364-106735386 CCTGTGGTACCCATTCAGAATGG + Intergenic
941695981 2:168551139-168551161 ACAGGGACCCCCATTCAGAAGGG - Intronic
948611927 2:239175413-239175435 CCAGCAGCCCACAGTCAGCAGGG + Intronic
1170123785 20:12939136-12939158 CTTATGGCCCACAATCAGAAAGG + Intergenic
1170255135 20:14333862-14333884 CCAGTGGCACACTTTAAAAATGG + Intronic
1173260757 20:41432817-41432839 ACAGTGGGCCATGTTCAGAATGG - Intronic
1175016977 20:55802031-55802053 TCAGTGGCTCAAATCCAGAAGGG + Intergenic
1176004738 20:62854629-62854651 CAAGGGGCCCTGATTCAGAAAGG + Intronic
1176305743 21:5122232-5122254 CCTGAGACCCACAGTCAGAAAGG - Intronic
1176987857 21:15458250-15458272 CGTGTGTCCCACGTTCAGAAAGG + Intergenic
1177273928 21:18882315-18882337 CCAGTGATCTACATTTAGAAAGG + Intergenic
1177303856 21:19287228-19287250 CCAGTGACTCACTTTTAGAAAGG + Intergenic
1178134541 21:29612291-29612313 CCAGTGGTCAACAAACAGAATGG - Intronic
1178320683 21:31602860-31602882 ACAGGGCCCCACATTCAGAAGGG + Intergenic
1179851315 21:44139799-44139821 CCTGAGACCCACAGTCAGAAAGG + Intronic
1184390917 22:44202704-44202726 GCAGAGGCCCACCTTCAGCAAGG - Intronic
1184660373 22:45962906-45962928 CCATTGGCCCATAGCCAGAATGG + Intronic
951436008 3:22665672-22665694 ACAGTGCCTCACACTCAGAAGGG + Intergenic
954292361 3:49656368-49656390 CCAGTGTTCCACCTGCAGAAGGG + Exonic
954391685 3:50270981-50271003 CCGGTGGCCCACTTCCACAAAGG - Exonic
957349340 3:79002854-79002876 ACAGTGGGCCACATTGAGAGAGG - Intronic
960073262 3:113455514-113455536 CCAGTGGCCACCATTCTGGATGG + Intronic
960969463 3:123129359-123129381 CCAGTGGGGCCCAGTCAGAAGGG + Intronic
961759636 3:129156632-129156654 AAAGTGGCTCAGATTCAGAATGG - Exonic
962655232 3:137537193-137537215 CCAGGGGCCTATATCCAGAATGG + Intergenic
962850845 3:139307233-139307255 CCAGAAGCCCACATTCAGCTGGG - Intronic
963068002 3:141279190-141279212 TCAGTGGCCCCCATCCAGAATGG + Intronic
963176985 3:142309072-142309094 CCTCAGGCCCACATTTAGAATGG + Exonic
963273573 3:143308637-143308659 CTAGAGACCCCCATTCAGAAGGG - Intronic
968204660 3:196788787-196788809 TCAGTGGCCCACCTACAGGAGGG + Intronic
969202515 4:5617149-5617171 CCACTGGTTTACATTCAGAAAGG + Intronic
971455550 4:26840691-26840713 CCTGAGCCCCACATTCAGAAGGG + Intergenic
979500408 4:121433971-121433993 CCAGTGTCTCACATTTGGAATGG - Intergenic
980685972 4:136228846-136228868 CCACTGACCTACATTCAGAGGGG + Intergenic
984232046 4:177111771-177111793 CCAATGTCTCCCATTCAGAATGG - Intergenic
984887627 4:184464755-184464777 CAAGTGTCTCACATTCTGAAAGG + Intronic
985841104 5:2306558-2306580 CCAGGGGCCCACATGCAGTAGGG + Intergenic
986069759 5:4270410-4270432 CCAGTTTCCCACATGCAGAATGG - Intergenic
989456721 5:41652575-41652597 CCACTTGCCCACATACAAAATGG + Intergenic
997357842 5:133275624-133275646 ACAGGGGTCCACACTCAGAAGGG - Intronic
997378810 5:133420791-133420813 ACAGGGTCCCACACTCAGAAGGG + Intronic
997491799 5:134283878-134283900 CCAATGTCTCCCATTCAGAATGG - Intergenic
998267645 5:140678055-140678077 CCAGAGTCCCCCCTTCAGAAAGG - Intronic
1003172292 6:3729410-3729432 CCAGTGGCCCTTCTCCAGAAAGG - Intronic
1003806741 6:9734040-9734062 TCAGTGGACCAATTTCAGAATGG - Intronic
1005271844 6:24174042-24174064 CCAATGGCGCACACTCAGGAAGG - Exonic
1016208908 6:141504953-141504975 CCAGTTTCTCACATTTAGAATGG - Intergenic
1017934504 6:158992986-158993008 CCAGAGGCCCACATTTTGAGTGG - Intronic
1018459230 6:163981623-163981645 CCAGGAGCCCACATGCAGACGGG - Intergenic
1018472854 6:164112008-164112030 CATGAGGCCCACACTCAGAAGGG - Intergenic
1018554658 6:165036911-165036933 CCAGTGTCTCCTATTCAGAATGG + Intergenic
1022221901 7:28321846-28321868 ACAGGGTCCCACACTCAGAAGGG - Intronic
1024253933 7:47525936-47525958 GCAGTTGCACACACTCAGAAGGG - Intronic
1024268783 7:47626613-47626635 CCAGGGCCCCACATTCAATATGG + Intergenic
1032168995 7:129568544-129568566 CCTGTGACCCACAGTCACAATGG + Intergenic
1035253204 7:157610611-157610633 CCAGCGGCTCACACACAGAAAGG + Intronic
1036182542 8:6597777-6597799 ACAGTAGACCATATTCAGAAAGG - Intronic
1036450548 8:8863471-8863493 CCAGTTGACCTCATCCAGAATGG + Intronic
1037921069 8:22806132-22806154 TCAGTTGCACACATACAGAAGGG - Intronic
1039878656 8:41609412-41609434 CCAGTGGGCTACCTTGAGAATGG + Exonic
1040577380 8:48665809-48665831 TTAGAGGCCCACATTCAGAGGGG + Intergenic
1042118402 8:65457709-65457731 CCAGAGCCCCACACTCAGAAGGG + Intergenic
1043626490 8:82267138-82267160 ACAGGGTCCCACATTCAGAAGGG - Intergenic
1044193978 8:89352899-89352921 CCAGTTTCTCCCATTCAGAATGG - Intergenic
1044831046 8:96249526-96249548 CCAGTGTCTCACATATAGAAGGG + Intronic
1048361594 8:133701785-133701807 CCAAAGGCCCACATTCTGATTGG + Intergenic
1048953893 8:139518196-139518218 ACAGGAGCCCACATTTAGAAAGG - Intergenic
1049307691 8:141914563-141914585 CCAGTGGCTGACAGTCAGCAAGG + Intergenic
1049502932 8:142977391-142977413 CCAGTGGCCTGCATTCTGAGGGG - Intergenic
1052336601 9:27326422-27326444 CTAGTGTCCCACTTTTAGAAAGG - Exonic
1055433300 9:76267047-76267069 CCAGGGGCCTTCATTCAGATTGG - Intronic
1057129203 9:92641370-92641392 CCACAAGCACACATTCAGAAAGG + Intronic
1057976543 9:99611170-99611192 CCCGGGGCCCTCATTCAAAAAGG - Intergenic
1058150296 9:101456366-101456388 ACAGAGCCCCACAATCAGAAGGG - Intergenic
1061052684 9:128205480-128205502 CCAAGGTCACACATTCAGAAAGG + Intronic
1186342900 X:8662260-8662282 GCAGGGCCCCACATTTAGAAGGG + Intronic
1186411396 X:9347535-9347557 CCAGTGGCCCTCAGCCAGCAGGG + Intergenic
1188377613 X:29451744-29451766 ACAGTGGCCCACATTAAAAACGG + Intronic
1188662266 X:32775006-32775028 CCAGTTTCCCCCATTTAGAATGG - Intronic
1190513203 X:51195201-51195223 CCAGTGTCTCACATTTGGAATGG - Intergenic
1199539712 X:148945517-148945539 CCAGTGGACCACATTGAGCATGG - Intronic
1199972245 X:152870029-152870051 CCAGTGTCCCACATTAGGAGAGG - Intergenic
1200817974 Y:7553544-7553566 GCAGGGGCCCACATTCTGCATGG + Intergenic