ID: 1148069687

View in Genome Browser
Species Human (GRCh38)
Location 17:44901007-44901029
Sequence GAATGACATCATCAACTTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148069680_1148069687 9 Left 1148069680 17:44900975-44900997 CCTTTGCCTTCCCAGGCACAGGC 0: 1
1: 0
2: 8
3: 52
4: 512
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250
1148069676_1148069687 25 Left 1148069676 17:44900959-44900981 CCACTGACATGTATTCCCTTTGC 0: 1
1: 0
2: 3
3: 23
4: 247
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250
1148069683_1148069687 -1 Left 1148069683 17:44900985-44901007 CCCAGGCACAGGCCATGGAAAGG 0: 1
1: 1
2: 3
3: 22
4: 322
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250
1148069685_1148069687 -2 Left 1148069685 17:44900986-44901008 CCAGGCACAGGCCATGGAAAGGA 0: 1
1: 0
2: 2
3: 30
4: 279
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250
1148069682_1148069687 3 Left 1148069682 17:44900981-44901003 CCTTCCCAGGCACAGGCCATGGA 0: 1
1: 0
2: 5
3: 47
4: 341
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250
1148069678_1148069687 10 Left 1148069678 17:44900974-44900996 CCCTTTGCCTTCCCAGGCACAGG 0: 1
1: 0
2: 1
3: 24
4: 429
Right 1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148069687 Original CRISPR GAATGACATCATCAACTTCA AGG Exonic
900008666 1:86237-86259 GAATGACATAATCAAACTTAAGG + Intergenic
900024906 1:263532-263554 TTAAGAAATCATCAACTTCATGG - Intergenic
900028508 1:352926-352948 TTAAGAAATCATCAACTTCATGG - Intergenic
900036899 1:420248-420270 GAATGACATAATCAAACTTAAGG + Intergenic
900058526 1:655987-656009 GAATGACATAATCAAACTTAAGG + Intergenic
901612812 1:10512503-10512525 GAATCCCAGCATTAACTTCAGGG + Intronic
902757747 1:18560276-18560298 GAATAACATTATCTCCTTCATGG - Intergenic
904394649 1:30211212-30211234 GAATGACATCAATAACATAAAGG - Intergenic
905051339 1:35053593-35053615 CAATGACATCACCAAGTTAATGG + Intergenic
907662086 1:56402519-56402541 GAAAGAGATCATGAACTTCCTGG + Intergenic
908106434 1:60848047-60848069 GAATGACATCATCAAGATGGGGG + Intergenic
908540019 1:65113481-65113503 CAATGACATCAGCAACTTTTGGG - Intergenic
909126670 1:71681196-71681218 CAATAACATAATCAACTTTAAGG + Intronic
910476810 1:87616261-87616283 AAATGACAGCACCAACTTCCTGG - Intergenic
913214605 1:116609997-116610019 AAACCACATCATCAACTCCAGGG + Intronic
915614403 1:157025618-157025640 GACTGTCATCATCAATCTCACGG - Intronic
915677835 1:157548090-157548112 GCAGGACATCTTCAACTCCATGG - Intronic
915686981 1:157643645-157643667 GCAGGACATCTTCAACTCCATGG - Intergenic
917132424 1:171756350-171756372 GCAATATATCATCAACTTCAGGG - Intergenic
918072278 1:181141717-181141739 CCATGACATCATCACCTTCCAGG - Intergenic
918164822 1:181935139-181935161 AAATGTCATCATCCAATTCATGG - Intergenic
918767493 1:188506117-188506139 AAATGTCATCATCAAACTCAAGG + Intergenic
919122252 1:193355965-193355987 AGATGACACCATCAATTTCAGGG - Intergenic
922225245 1:223640413-223640435 GAAGGACACCAGCAACTTCCTGG - Intronic
922442587 1:225668425-225668447 AAATGACATCATCAACATTTAGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063840397 10:10065299-10065321 GCATGACATCATCTGCTTCTGGG + Intergenic
1064394476 10:14970212-14970234 GAATGAGATCCTCAAGTTCAAGG - Intronic
1065388928 10:25162199-25162221 GAATAGCATCAACAACTGCATGG - Intergenic
1067373542 10:45706811-45706833 GAATGAGATCATGAAGTACAAGG + Intergenic
1067700448 10:48567678-48567700 GAGTGACAGCATCCACTTCCAGG + Intronic
1068310699 10:55270964-55270986 GAATGAAATCATGTGCTTCACGG + Intronic
1072198039 10:93133605-93133627 GTATGCCCTCATCAGCTTCATGG + Intergenic
1073593526 10:104778510-104778532 GAATGATCACATCCACTTCATGG + Intronic
1074100694 10:110352850-110352872 GCATGACACCATCTACTGCAGGG - Intergenic
1075209170 10:120476394-120476416 AAATGACAGCATCTACATCATGG - Intronic
1076212512 10:128659678-128659700 AAAGCCCATCATCAACTTCATGG - Intergenic
1078841396 11:15078707-15078729 GAATAATAGCATCTACTTCATGG - Intronic
1078928564 11:15895786-15895808 GATTGAGATCTTCAAGTTCAGGG - Intergenic
1080330527 11:31131966-31131988 AAATGACATCATCAATTGTATGG - Intronic
1082636885 11:55607107-55607129 GGGCGACATCATCACCTTCATGG + Intergenic
1083537719 11:63486628-63486650 GAATGATGTAATCAACTTTAGGG + Intronic
1084578890 11:70009944-70009966 GAATGACATCATAGACTCTAGGG - Intergenic
1086768560 11:90730778-90730800 GAATGACATGATTAACAGCATGG + Intergenic
1087704429 11:101473603-101473625 CAAAGACATCTTCAAGTTCATGG - Exonic
1087993247 11:104771792-104771814 GAAAGACAACACCAACTGCAGGG + Intergenic
1088413019 11:109556404-109556426 GAATGACATAATGGACTTTAGGG - Intergenic
1090802065 11:130179204-130179226 GCATGACATCAGCACCTCCAGGG + Intronic
1092363329 12:7856697-7856719 GAATGACATCAGTATCTTCAGGG + Intronic
1092380578 12:7993511-7993533 GACTGACATCAGCATCTTCAGGG - Intergenic
1092697224 12:11186221-11186243 GAAAGACATCACCATTTTCATGG + Exonic
1094233306 12:28134034-28134056 AAATGACAATATCAACGTCAAGG + Intronic
1096407029 12:51351345-51351367 GAGTTACATCATGAATTTCAGGG - Exonic
1097423334 12:59409668-59409690 CAATGACATTATAAACTACAAGG - Intergenic
1097759611 12:63447715-63447737 GAATGACAACATCTGCTCCATGG - Intergenic
1098043446 12:66376461-66376483 GAATACCATCAGCAAATTCATGG + Intronic
1098303067 12:69074158-69074180 GAATGATATAATGAACTTCGGGG + Intergenic
1099204079 12:79708509-79708531 GAATGATAGCTCCAACTTCAAGG + Intergenic
1099476676 12:83116096-83116118 GAATGACACAATGGACTTCAGGG - Intronic
1101543960 12:105692471-105692493 GAATGACATCGATAACTTAATGG + Intergenic
1101682228 12:106980405-106980427 GAATAACATCCTTAACCTCAAGG - Intronic
1102024516 12:109706564-109706586 GAATGACGGCACCAACCTCATGG - Intergenic
1102116141 12:110404343-110404365 GAATGACAACTTCAACTTTATGG - Intergenic
1107267854 13:38578988-38579010 CAATGACAACAACAACTTGATGG - Intergenic
1107354348 13:39550559-39550581 GAATGACATCATGAATTCAAAGG - Intronic
1108287277 13:48920932-48920954 GAATTGCATCATCAACTTTCCGG + Intergenic
1108300857 13:49074257-49074279 GAATGACACAATCAACTTTCGGG - Intronic
1108432646 13:50369764-50369786 GAATGACAACCTGAACTTCAGGG + Intronic
1109978914 13:69879871-69879893 GAATAACAGTATCAACTACATGG + Intronic
1110614085 13:77521812-77521834 GAATGCCAGCATCTGCTTCACGG + Intergenic
1111174510 13:84576889-84576911 GAATGATATAATCAACTTTGGGG + Intergenic
1114997297 14:28371413-28371435 GAATTACATTATCCACTTCTAGG - Intergenic
1115246027 14:31296028-31296050 GACTGACTTCATCAAGTTCTTGG + Exonic
1116494190 14:45540682-45540704 GAATGACATAATGAACTTTGGGG + Intergenic
1117070564 14:52052219-52052241 AATTTACATCTTCAACTTCATGG + Intronic
1118293706 14:64549721-64549743 GAATAACTTCATGAAGTTCAAGG + Intergenic
1118375045 14:65169657-65169679 AGATGACATCATCAACATCTGGG - Intergenic
1119252769 14:73171102-73171124 GCATGTCATCATCACCTTGAAGG + Intronic
1119661691 14:76456791-76456813 GAATGAGATCATCCAGCTCATGG + Intronic
1121033913 14:90683256-90683278 TAATGACAACATCAACTCTAAGG + Intronic
1121944799 14:98109599-98109621 TAAAGACATCATCAATTTCCTGG - Intergenic
1125829592 15:42704785-42704807 GAAAGACACCATCTACTTTAGGG - Intronic
1126345376 15:47688249-47688271 GCATGACCTGATCAGCTTCAAGG - Intronic
1128594996 15:68936895-68936917 AAATAACATCATAAACATCATGG - Intronic
1130514853 15:84618511-84618533 CAATGTCATCAACAACTTCCTGG + Intronic
1131364154 15:91823524-91823546 GCATGGCAGCATCAGCTTCAGGG - Intergenic
1133815982 16:9197771-9197793 GAATGACATAATCAACTTTGGGG - Intergenic
1134178451 16:12028052-12028074 ACATGACATGATCCACTTCAAGG - Intronic
1134896728 16:17894765-17894787 GAATGAATACATAAACTTCAGGG - Intergenic
1137364302 16:47847421-47847443 GAATTACATCATCATTCTCAAGG + Intergenic
1137639754 16:50018312-50018334 GAATGACACGATGGACTTCAGGG + Intergenic
1139241801 16:65400463-65400485 AAATCAAATCATGAACTTCACGG - Intergenic
1140340363 16:74153102-74153124 GAATGACATAATGAACTTTGGGG + Intergenic
1141406330 16:83796967-83796989 GAATGACCCTATCAAGTTCAAGG - Intronic
1141875493 16:86821247-86821269 GAAAGACATCTCCAACCTCAGGG - Intergenic
1142456248 16:90225846-90225868 TTAAGAAATCATCAACTTCATGG + Intergenic
1144408805 17:14979069-14979091 GAGAGAAATGATCAACTTCATGG + Intergenic
1146555728 17:33822098-33822120 GAATGACATAACCTACTTCCTGG + Intronic
1147757489 17:42778657-42778679 GAATGACACCATCTGCTTCAGGG - Intronic
1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG + Exonic
1151067918 17:71172978-71173000 GAATGATATATTCAACTTCGGGG - Intergenic
1151560854 17:74868826-74868848 GAAAGTCATCAGCAAGTTCAGGG - Intronic
1152521948 17:80861808-80861830 TAAAGACATCATCAATTTCCAGG - Intronic
1152951254 17:83233631-83233653 TTAAGAAATCATCAACTTCATGG + Intergenic
1153370362 18:4308461-4308483 CAGTGACATTTTCAACTTCATGG + Intronic
1153861660 18:9216280-9216302 AAAGGTCATCATCATCTTCACGG - Intronic
1156368060 18:36447749-36447771 TAAGTACATTATCAACTTCATGG + Intronic
1157732105 18:50012934-50012956 CAAAGACATAATCAACCTCACGG + Intronic
1159312570 18:66728355-66728377 AAATGTCAACATCAACTTCATGG - Intergenic
1159750200 18:72291548-72291570 GAATGAAAACATGCACTTCAAGG - Intergenic
1160640429 19:127797-127819 GAATGACATAATCAAACTTAAGG + Intergenic
1164677898 19:30114132-30114154 GAATGACACAATGGACTTCAGGG - Intergenic
1165948641 19:39460013-39460035 GAAGAACATTGTCAACTTCAGGG + Intronic
1167893522 19:52561954-52561976 GCATGCCATCATCAACATCAGGG - Intronic
1167911417 19:52705709-52705731 GTATGCCATCATAGACTTCATGG - Exonic
1167919014 19:52766614-52766636 GTATGCCATCATAGACTTCATGG - Exonic
925612363 2:5712457-5712479 GCATGACAGCATCAGCTTCTGGG + Intergenic
926275114 2:11397612-11397634 GAAAGATGTCATCAATTTCATGG + Intergenic
927982390 2:27382191-27382213 GAATGAAATCTACAACTTCCTGG + Exonic
928175329 2:29029768-29029790 GAATGACATAATGGACTTTAGGG + Intronic
930191734 2:48466725-48466747 GAATGACATGAACAAAATCATGG + Intronic
930896789 2:56455786-56455808 CAAGGACAGCATCATCTTCAGGG - Intergenic
931544456 2:63366203-63366225 GAAGGGCAGCATCACCTTCAAGG + Intronic
931595906 2:63943202-63943224 GACAGAAATCATTAACTTCAAGG + Intronic
932279659 2:70479493-70479515 GATTGAAAGCATTAACTTCAGGG - Intronic
932334439 2:70922013-70922035 GAATGACATCATCTGCTTCTTGG - Intronic
933082729 2:78013521-78013543 CAATTACATCACCACCTTCATGG - Intergenic
933687424 2:85154225-85154247 GAATTACATTAGCAACTCCAAGG + Intronic
933946688 2:87292737-87292759 CAATAACAACAACAACTTCATGG - Intergenic
936333502 2:111568806-111568828 CAATAACAACAACAACTTCATGG + Intergenic
937750222 2:125467787-125467809 GCATGTCATCATCAACATGATGG + Intergenic
937816134 2:126252564-126252586 TACTGACATCAGCAAGTTCATGG - Intergenic
938869470 2:135459752-135459774 GAATGACAACATAAATTTCTGGG + Intronic
939391925 2:141579325-141579347 AAATGAAATCATCAACTAAAGGG + Intronic
941133463 2:161683539-161683561 CAATGCCATCTGCAACTTCAAGG - Intronic
944457094 2:199906814-199906836 AAATGACATAATCATCTTAATGG - Intergenic
945749782 2:213767094-213767116 GAATGACATGATGACCTACATGG - Intronic
948152985 2:235759142-235759164 GAATGACATCAACAACCCTAGGG - Intronic
949087742 2:242170644-242170666 TTAAGAAATCATCAACTTCATGG + Intergenic
1168801071 20:643426-643448 GAAGGAGATCATCAAATACAGGG + Intergenic
1169739053 20:8870053-8870075 GCATGACCACATCATCTTCAAGG + Intronic
1172230011 20:33330267-33330289 GAATTACAGCATCAACTTCATGG - Intergenic
1175366154 20:58457688-58457710 CAATGAAATTATCAACTGCATGG + Intergenic
1175412559 20:58780379-58780401 AAGTGACATCTTCAACTTCATGG + Intergenic
1175479000 20:59298626-59298648 TCCTGACATCATCACCTTCATGG - Intergenic
1178366653 21:31993979-31994001 GGTTGACAACATCAACTTCAGGG + Intronic
1179629909 21:42669941-42669963 GCATGCCAGCATCACCTTCAAGG + Intronic
1179967195 21:44814065-44814087 GAATGACCACATCAACCTGAAGG - Exonic
1181913583 22:26260309-26260331 GAATGATACCATAGACTTCAGGG - Intronic
1184802705 22:46771536-46771558 GAATGACACAATAGACTTCAGGG - Intronic
949285301 3:2395755-2395777 GAATGACATCATGTCATTCATGG - Intronic
949881970 3:8668542-8668564 CAAAGACATCATCAACTTAAGGG + Intronic
949927140 3:9050330-9050352 GGATTACATCTTCAACTTCTTGG - Intronic
952870866 3:37899973-37899995 GAATGACATGACCTACTTCATGG - Intronic
952994272 3:38862710-38862732 GAATGATATAATGGACTTCAGGG + Intronic
953542370 3:43833206-43833228 GATTGGTATCATCAAATTCAGGG + Intergenic
954834646 3:53455003-53455025 GAATGACAACATAAATTCCACGG - Intergenic
955224510 3:57049928-57049950 GATTGACAGCAACAACTGCAGGG + Intronic
955636137 3:61031729-61031751 AAATGCCATCATCAGCTTCAAGG + Intronic
956148556 3:66217261-66217283 GAATTACATCAAAAACTTCCAGG + Intronic
956888705 3:73587806-73587828 GAATGACATCATGTCATTCAAGG - Intronic
958007871 3:87835524-87835546 GACAGATATCATCAACTACATGG - Intergenic
958129980 3:89406001-89406023 GAATGACATGGTCAAATTCATGG + Intronic
958537362 3:95421132-95421154 GAAAGACATCATAATCCTCAAGG - Intergenic
959131816 3:102365420-102365442 GAATGATATAATGAACTTCAGGG - Intronic
959286565 3:104419878-104419900 GAAAGACATCCTCATGTTCAGGG - Intergenic
964571616 3:158112956-158112978 GAATGAGATCATCATTTGCACGG - Intronic
966186318 3:177230154-177230176 TAATGCCATCTTCATCTTCATGG - Intergenic
967472309 3:189876222-189876244 GATTGACATCATTCAGTTCAGGG + Intronic
967488928 3:190066455-190066477 GGATGACACAATAAACTTCAGGG + Intronic
970345095 4:15145539-15145561 CAATAACATCATCATCATCACGG - Intergenic
970399759 4:15705917-15705939 GAATGGCAACATCTACTTCTGGG + Intronic
971146511 4:23982444-23982466 GCATGACATTTTCAACTTCCAGG - Intergenic
971688199 4:29798402-29798424 GAGTCACATAATCAAGTTCATGG - Intergenic
971856356 4:32049229-32049251 GAGTGACATCAGCAACATTATGG - Intergenic
972938224 4:44166591-44166613 TAATACCATCATCATCTTCAAGG - Intergenic
973121719 4:46529180-46529202 AAATGTCATTATCAACTACAAGG + Intergenic
974459497 4:62168825-62168847 GAGTGACATCACCATCATCAAGG - Intergenic
975820469 4:78266055-78266077 TAATGGCATCTTCAACTACAAGG + Intronic
976979073 4:91202639-91202661 GAAGGTCAACATCAAATTCAAGG - Intronic
976979083 4:91203007-91203029 GAAGGTCAACATCAAATTCAAGG - Intronic
977661089 4:99587027-99587049 GAATGAAGTAATCAACTTTATGG + Intronic
980764620 4:137285398-137285420 GAATGAAATAATCACCCTCAGGG - Intergenic
980800818 4:137747294-137747316 AAATGTCATCACCAATTTCAAGG + Intergenic
982503563 4:156190646-156190668 GTAAGACATCATCAGCTTCTTGG + Intergenic
983465636 4:168085048-168085070 TTATGACATAATCATCTTCAAGG + Intergenic
987601433 5:20077064-20077086 GAATGTCAACATCAGTTTCAAGG - Intronic
989165587 5:38430838-38430860 GACTTACATCATCAGCTTCCTGG - Intronic
989404811 5:41048481-41048503 GAAGGAGCTCATCAATTTCAGGG + Intronic
989496982 5:42121086-42121108 AAATGTCATTAACAACTTCAAGG - Intergenic
990025585 5:51183604-51183626 GAAAGAGAACAGCAACTTCAAGG + Intergenic
990104594 5:52243137-52243159 GAATGACATAATGAACTTTGGGG - Intergenic
990742955 5:58930906-58930928 GGATGACTTATTCAACTTCATGG + Intergenic
992438637 5:76779198-76779220 GAACCACATCTTCAACTTCAGGG - Intergenic
992599366 5:78382591-78382613 GAATGATACAATGAACTTCAGGG - Intronic
992936876 5:81716690-81716712 GCATCACTTCTTCAACTTCAGGG + Intronic
994370557 5:98962625-98962647 GAATGATAACATCACCTGCAGGG - Intergenic
995533415 5:113112673-113112695 GAATGAAATCATCAACTTTTAGG - Intronic
997054781 5:130428765-130428787 GAATAACATTAACAACTTTAGGG + Intergenic
997740334 5:136247565-136247587 GAAAGATATCTTCAAGTTCATGG - Exonic
998523169 5:142818652-142818674 AAATGACATTACCACCTTCATGG + Intronic
1001371051 5:171202370-171202392 TCATGACATCATCAGTTTCAAGG + Intronic
1002070786 5:176677929-176677951 GGGTGACATCATAAACATCAGGG - Intergenic
1002523248 5:179802788-179802810 GAATGAGATCAACAACCTCCTGG + Exonic
1002736922 5:181398618-181398640 GAATGACATAATCAAACTTAAGG - Intergenic
1002745482 5:181467445-181467467 TTAAGAAATCATCAACTTCATGG + Intergenic
1002747778 6:76200-76222 GAATGACATAATCAAACTTAAGG + Intergenic
1004132838 6:12937298-12937320 GAATGACTGCATTATCTTCAAGG - Intronic
1004780507 6:18903221-18903243 GAATGAGGTCATCAAATACATGG - Intergenic
1004915650 6:20329442-20329464 GAAACACATCATCAAATACACGG - Intergenic
1005757028 6:28934104-28934126 GAATGGCATCACAAACTGCAAGG + Intergenic
1006571819 6:35011878-35011900 CAATGACATAATCAACATAAAGG - Intronic
1006669503 6:35720850-35720872 AAATGAGATCATCCACATCAGGG - Intronic
1007628089 6:43257804-43257826 CACTGACATGATCAACTGCAGGG - Exonic
1008118287 6:47579187-47579209 GAATGCAATCATAAACTTCTGGG - Intronic
1008340907 6:50362849-50362871 GAATGACATACTCATCATCATGG - Intergenic
1008449247 6:51631159-51631181 GAATCAAATCACCTACTTCACGG + Intronic
1012794280 6:103740253-103740275 GAATGAGATAATCAACTTTGGGG + Intergenic
1013757871 6:113482127-113482149 TAGTGGCATCATCACCTTCAGGG - Intergenic
1014501146 6:122190862-122190884 GAAAGACATCATCAGTTCCAGGG + Intergenic
1014563495 6:122918967-122918989 GAATGACATCAGCAACATGGAGG - Intergenic
1016276371 6:142358067-142358089 TAATGACATCATTGCCTTCATGG + Intronic
1019158808 6:170056135-170056157 GAATGAAATAATCCACTTTAAGG - Intergenic
1019242018 6:170674152-170674174 GAATGACATAATCAAACTTAAGG - Intergenic
1019250395 6:170740988-170741010 TTAAGAAATCATCAACTTCATGG + Intergenic
1020665175 7:11032186-11032208 GAATGAAATCTTGAACTTCTGGG - Intronic
1020984738 7:15119290-15119312 GCATGGCAGCATCAACTTCTGGG - Intergenic
1021349005 7:19566577-19566599 GACTGACACTAACAACTTCAAGG - Intergenic
1021362064 7:19727748-19727770 GAATGACATCAGCAAAGACATGG - Intronic
1022974046 7:35541020-35541042 GAATGAGAAAATGAACTTCAAGG - Intergenic
1028063766 7:86354923-86354945 AAATAACATCATACACTTCATGG - Intergenic
1030766045 7:113411059-113411081 GAATGTCATTATCAAATTCCTGG + Intergenic
1031094523 7:117402965-117402987 GCATGATATCATCAATTTAATGG + Intronic
1035302898 7:157908642-157908664 TCATGACATCAGCAACTGCAGGG + Intronic
1035496983 8:60694-60716 TTAAGAAATCATCAACTTCATGG - Intergenic
1035506097 8:133949-133971 GAATGACATAATCAAACTTAAGG + Intergenic
1036746235 8:11412121-11412143 GGGTGACATCCTCCACTTCAAGG - Intronic
1038201324 8:25415739-25415761 GAATGATTTCATCAACTTAAGGG - Intronic
1039262840 8:35791055-35791077 GTATGACTTCAACAACGTCAAGG + Intronic
1039970299 8:42316318-42316340 GGATGACATCTTAAACTTAAAGG + Exonic
1041367775 8:57127179-57127201 GAATGACATAATGGACTTTAGGG - Intergenic
1043389273 8:79776457-79776479 CAATGACATCTTCATCTTGAAGG - Intergenic
1044059930 8:87623826-87623848 GAATGACTTCGAGAACTTCAAGG - Intergenic
1047290285 8:123523858-123523880 TACTGTCATCATCAACTTTAGGG - Intronic
1047860225 8:128957865-128957887 GAAGGACATCAACCATTTCACGG - Intergenic
1048239902 8:132731272-132731294 AAATGTGATAATCAACTTCATGG + Intronic
1049929615 9:443795-443817 GAATGACAAAATCTACTTCCAGG - Intronic
1049934344 9:486309-486331 GAAAGACAGGATCAAATTCAGGG - Intronic
1050795865 9:9540768-9540790 AAATGAAATCATCTACTTAAAGG + Intronic
1052619806 9:30891724-30891746 CAAAGATATCATTAACTTCAGGG - Intergenic
1056202850 9:84293410-84293432 GAATGACAGCAAGAACTCCAGGG - Intronic
1057454383 9:95194317-95194339 TAATGATATCTTCAAATTCATGG - Intronic
1058201789 9:102052102-102052124 AGATGACATAATCATCTTCATGG - Intergenic
1058235194 9:102481225-102481247 GAATGACACCATCAACCAAATGG + Intergenic
1058754283 9:108070155-108070177 GAATGACTTCTTCAATTTCTTGG - Intergenic
1203579950 Un_KI270745v1:33588-33610 TTAAGAAATCATCAACTTCATGG + Intergenic
1203602209 Un_KI270748v1:23386-23408 GAATGACATAATCAAACTTAAGG - Intergenic
1185935796 X:4256485-4256507 GCATGACATCATCTCCTTCTGGG + Intergenic
1186158712 X:6753146-6753168 GAATGACACAATCAACTTTGGGG - Intergenic
1186413824 X:9366191-9366213 GAATGACAGCATTCCCTTCAAGG - Intergenic
1186621806 X:11249240-11249262 GAATGACACAATAGACTTCAGGG + Intronic
1186944940 X:14555442-14555464 GAAGAAAATCATAAACTTCAGGG - Intronic
1188665410 X:32813494-32813516 AAATGACAGCATCTACGTCATGG + Intronic
1190404471 X:50073034-50073056 GAATGAGATCATAAGCTTCTTGG - Intronic
1190975152 X:55392024-55392046 GAATGACATAATGAACTTCGGGG + Intergenic
1192855419 X:75005099-75005121 GAATGACATCAAGCAATTCATGG + Intergenic
1193053921 X:77129484-77129506 GAATGAGCTCAAAAACTTCAGGG - Intergenic
1193257883 X:79370844-79370866 AAATGACATAATCAATTTAAAGG - Intergenic
1193536651 X:82725108-82725130 CAATAAAATCATCCACTTCATGG + Intergenic
1194262661 X:91716522-91716544 GACTGACCTCAACAACTGCATGG + Intergenic
1194394616 X:93366807-93366829 GAATGAACTCATCAAATTTATGG + Intergenic
1195621280 X:106958079-106958101 GAATGACACTATCAAAGTCATGG + Intronic
1201250727 Y:12054946-12054968 GAATGATATAATGGACTTCAAGG + Intergenic