ID: 1148070714

View in Genome Browser
Species Human (GRCh38)
Location 17:44907055-44907077
Sequence TTGCGTTAGAATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148070714_1148070719 11 Left 1148070714 17:44907055-44907077 CCTTCCTCCTCATTCTAACGCAA 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1148070719 17:44907089-44907111 TGCCCCTCCAGACTGCCCCTTGG 0: 1
1: 0
2: 2
3: 24
4: 219
1148070714_1148070720 12 Left 1148070714 17:44907055-44907077 CCTTCCTCCTCATTCTAACGCAA 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1148070720 17:44907090-44907112 GCCCCTCCAGACTGCCCCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 198
1148070714_1148070722 13 Left 1148070714 17:44907055-44907077 CCTTCCTCCTCATTCTAACGCAA 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1148070722 17:44907091-44907113 CCCCTCCAGACTGCCCCTTGGGG 0: 1
1: 0
2: 0
3: 25
4: 222
1148070714_1148070724 14 Left 1148070714 17:44907055-44907077 CCTTCCTCCTCATTCTAACGCAA 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1148070724 17:44907092-44907114 CCCTCCAGACTGCCCCTTGGGGG 0: 1
1: 1
2: 1
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148070714 Original CRISPR TTGCGTTAGAATGAGGAGGA AGG (reversed) Intronic
900883313 1:5397852-5397874 GAGCCTTAGAATGAGGAGGAAGG - Intergenic
904374585 1:30072384-30072406 CCGCGTTAGAAAGAAGAGGATGG + Intergenic
906272025 1:44487017-44487039 GTGTGTTAGAATTAGAAGGACGG + Intronic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
909937929 1:81575514-81575536 TTCCATTAGAATTAGGAGCAAGG + Intronic
910657282 1:89632502-89632524 GTGGGATAGAATGAGGAAGATGG - Intergenic
916728605 1:167546034-167546056 TTGCCTTAGAAGGCTGAGGATGG + Intronic
918342634 1:183580178-183580200 TTGGGTTTGAAATAGGAGGATGG + Intronic
918648600 1:186930997-186931019 TAAAGTTAGAATGAAGAGGAGGG - Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
924542231 1:244992199-244992221 TAGCTTTAGAATGAGCAGGATGG - Intronic
1065317710 10:24480330-24480352 TTGCTTTATCACGAGGAGGAGGG - Intronic
1066753033 10:38679198-38679220 TTCCGAAAAAATGAGGAGGAAGG + Intergenic
1067932576 10:50577551-50577573 TTGCATTAAAATTAAGAGGAAGG - Intronic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074502762 10:114041867-114041889 AGGCGTTAGAAAGGGGAGGAAGG - Intergenic
1075822746 10:125328743-125328765 TTGGGTTAGAATCTGGTGGAGGG + Intergenic
1077120466 11:905183-905205 TTGGGTTTGAAGGAGGAGGTGGG - Intronic
1077922885 11:6655098-6655120 ATGTGTCAGAATGTGGAGGATGG - Intronic
1084234803 11:67780364-67780386 TGGCATTAGGATGAAGAGGAAGG - Intergenic
1084312558 11:68325389-68325411 TTGTGTTAGTGTGAAGAGGAGGG + Intronic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1085509477 11:77080940-77080962 TTGGGTCAGAATGAGGGGGCTGG - Intronic
1085723838 11:78936806-78936828 GTGTGTTAGAATGAGAAGGTGGG + Intronic
1089113107 11:116072516-116072538 TTGCTGTAGAAATAGGAGGATGG + Intergenic
1090896353 11:130979311-130979333 TTGCTCTAGAATCAGGAAGAGGG - Intergenic
1092120547 12:6040716-6040738 TGGCATGGGAATGAGGAGGATGG - Intronic
1092281322 12:7099849-7099871 TTGGGTGGGAATGAGGTGGATGG + Intronic
1092808292 12:12248137-12248159 TTGCTTTAGCCTTAGGAGGAAGG - Intronic
1094131452 12:27079807-27079829 CTGTGGTTGAATGAGGAGGATGG + Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1095647940 12:44571490-44571512 TTACTTTAGAATGAGGTAGATGG - Intronic
1100144149 12:91656723-91656745 TAGCCTGGGAATGAGGAGGAGGG - Intergenic
1100717560 12:97321998-97322020 TTGCCTTAGTATTATGAGGAAGG - Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1104023363 12:125008612-125008634 CTGCATTAGAAAGAAGAGGAGGG - Intronic
1105505789 13:21008438-21008460 TAGCGTTATTATGAGAAGGAGGG - Intronic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1110202151 13:72864228-72864250 TTGCTTGAGAGTGAGGAGGATGG + Intronic
1110429047 13:75402021-75402043 TTGCATTAGATGCAGGAGGAAGG - Intronic
1111449168 13:88391340-88391362 TTGCTTTAGCAAAAGGAGGAAGG + Intergenic
1112877016 13:104054844-104054866 TTACGTGTGGATGAGGAGGAGGG - Intergenic
1113757646 13:112824610-112824632 AGGCGTTAGAAAGAGCAGGAAGG - Intronic
1114030299 14:18572896-18572918 TTGGGTTAGGGTGAGGATGAGGG + Intergenic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114559447 14:23579523-23579545 TTGCTTCTGAATGGGGAGGAGGG + Intergenic
1116317132 14:43411474-43411496 TTGCTTTAATATGAGTAGGAAGG + Intergenic
1118350018 14:64967041-64967063 TTGCTTTTGACTGAGGAGGTGGG - Intronic
1121133764 14:91475122-91475144 TTACGTAAGAATGAGTAAGAAGG - Intronic
1125142120 15:36420447-36420469 TTGTGCTAGAATTAGGATGAGGG - Intergenic
1125679820 15:41523615-41523637 TGGAGGTAGAAAGAGGAGGAAGG + Intronic
1127765218 15:62179315-62179337 GTGTGATAGAGTGAGGAGGAAGG - Intergenic
1131122056 15:89828864-89828886 TTGCCTTGGAAGGAAGAGGAAGG + Intergenic
1131143099 15:89993506-89993528 TAGGGTGGGAATGAGGAGGATGG - Intergenic
1132406511 15:101544470-101544492 GTTCGTTAAAATAAGGAGGAAGG + Intergenic
1133930111 16:10225259-10225281 TAGCGTGAGAATAAGAAGGAAGG + Intergenic
1140129078 16:72143244-72143266 TTCCTTTAAAATGAGGAGCAAGG + Intronic
1143408876 17:6696595-6696617 TGGCGTTGGCATGAGGAGGCAGG + Intronic
1143718638 17:8794824-8794846 TTGCGTTAGGAAGAGGGGGCTGG - Intergenic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1145364625 17:22248301-22248323 TTTCTTTAGATTGAGGAGGTTGG - Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1149613525 17:57977087-57977109 TTGTGTTAGAATGGGGAGAGGGG - Intronic
1151164452 17:72191977-72191999 TGGGGTTAGAATCAGGAGGGAGG - Intergenic
1151868815 17:76822641-76822663 GGGCTTTAGAATGAGGTGGAAGG + Intergenic
1152028107 17:77824757-77824779 TTGAGTCACATTGAGGAGGAGGG + Intergenic
1156487292 18:37474503-37474525 GTGCCCTAGGATGAGGAGGAAGG + Intronic
926888691 2:17620451-17620473 TTCCCTGAGAATGAGGAGGCGGG - Intronic
927979965 2:27368957-27368979 TGGCGTTATAATTAGGAGTAAGG + Intronic
930592073 2:53340015-53340037 TTTTGAGAGAATGAGGAGGATGG - Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
937469292 2:122161495-122161517 TTGCCTTAGAACGCAGAGGAAGG + Intergenic
938681054 2:133690282-133690304 TTATGTGACAATGAGGAGGAAGG - Intergenic
941033660 2:160541918-160541940 CAGCATTAGAATGTGGAGGAGGG - Intergenic
941486785 2:166091963-166091985 TTGTGTTAGAATGAGATGGGTGG - Intronic
944203944 2:197137311-197137333 TAGCCTTAGGATGATGAGGAAGG + Intronic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
947551318 2:231048678-231048700 TGGTGTGAGGATGAGGAGGACGG + Exonic
948650003 2:239436594-239436616 TCACGTTAGGATGAGAAGGAAGG - Intergenic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1171979228 20:31615680-31615702 ATGCGTTAAAAGGAGTAGGATGG + Intergenic
1172364294 20:34337123-34337145 TTTCCTTAAAATGAGGATGATGG + Intergenic
1172573410 20:35987730-35987752 TTGTGTTAGAAAGAGGACCAAGG + Intronic
1173598281 20:44274359-44274381 TTTTGCTAGAATGGGGAGGATGG - Intronic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1173937615 20:46880939-46880961 TTGCCTGAGAGTGAGGAGGTGGG + Intergenic
1174047212 20:47741956-47741978 TTCCTCTGGAATGAGGAGGAAGG - Intronic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178419527 21:32432488-32432510 TGGCATTAGGATGAAGAGGAAGG + Intronic
1178500666 21:33123442-33123464 TTGCCAGAGAATGAGGAGAACGG + Intergenic
1180454412 22:15499946-15499968 TTGGGTTAGGGTGAGGATGAGGG + Intergenic
1181974289 22:26717828-26717850 TTTCCTTAGAATGAAGAGGTAGG - Intergenic
1183694731 22:39415305-39415327 TAGCGTGAGCATGGGGAGGAGGG + Intronic
950845132 3:16008017-16008039 TTGCATTAGGATGATGTGGAGGG + Intergenic
952690102 3:36195514-36195536 TTCTGTTACAATGAGGAGTAAGG - Intergenic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954769422 3:52952770-52952792 TTGCGTTGGTATGAAGAGGTGGG - Intronic
956117020 3:65929253-65929275 TTGAGTTAGATTGAGGAGAAAGG - Intronic
956358034 3:68415478-68415500 TTGTGTTGGAGTGAGGAGGTTGG + Intronic
961869089 3:129975330-129975352 TCGCGTTGGAATGAGGACGTCGG + Intronic
961884433 3:130086899-130086921 TGGCATTAGGATGAAGAGGAAGG - Intronic
961917291 3:130390532-130390554 TTGTCTTACAATGTGGAGGAGGG + Intronic
962109695 3:132431352-132431374 ATAGGGTAGAATGAGGAGGAGGG + Intronic
962950124 3:140210756-140210778 GTGGGTTTGAAGGAGGAGGAGGG + Intronic
963478594 3:145838725-145838747 TTGCATTAGAATGTGTAGTAGGG - Intergenic
963923248 3:150925601-150925623 GTGCATTAGAATGAAGAGGAGGG - Intronic
963926702 3:150958536-150958558 ATGCGTGAGAGTGTGGAGGAGGG - Intronic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
964818497 3:160743103-160743125 TTGGGTTAGAGAGAGCAGGAAGG - Intergenic
966061624 3:175763815-175763837 GTGTGTTAGAATGGGGAGGAAGG - Intronic
966243422 3:177779771-177779793 TTCTGTTAGAAAAAGGAGGAAGG + Intergenic
967715124 3:192753833-192753855 TGGCGGTAGAGTGAGGAGAAGGG - Intronic
969820343 4:9715384-9715406 TGGCATTAGGATGAAGAGGAAGG + Intergenic
972072746 4:35041577-35041599 TTGCGTTAAGAAGAGGAGAAAGG - Intergenic
977163367 4:93664291-93664313 TTGCTTTAGAGTGAGTAGGAAGG + Intronic
978231108 4:106401097-106401119 TTGCGTTTGACAGAGGAGGATGG + Intergenic
978293323 4:107172996-107173018 TTTGGTTAAAATAAGGAGGAAGG - Intronic
978852883 4:113358889-113358911 TTGAGTTAGAATCAGAAGAAGGG + Exonic
979291561 4:118984127-118984149 TTGGGCTGGAATGAGGAAGAGGG - Intronic
980350297 4:131675401-131675423 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
982085736 4:151834419-151834441 TTGAGGTAGAATGATGGGGAGGG + Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
984624883 4:181996007-181996029 TTGAGTTTGCCTGAGGAGGAGGG - Intergenic
984711649 4:182890516-182890538 CTGCGTTGGCATGCGGAGGAGGG + Exonic
985125918 4:186694159-186694181 TTTCGTTAGAAATAGGAAGATGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987561062 5:19520619-19520641 TTCCATTCAAATGAGGAGGAAGG + Intronic
987744618 5:21953568-21953590 TGGTGCTAGAATGAGGATGAAGG + Intronic
991028894 5:62061786-62061808 ATACGTTGGAATTAGGAGGATGG + Intergenic
991490915 5:67181892-67181914 TTACGTGAAAATGAGGAAGAAGG - Intergenic
991764825 5:69963690-69963712 TGGTGCTAGAATGAGGATGAAGG + Intergenic
991782499 5:70154463-70154485 TGGTGCTAGAATGAGGATGAAGG - Intergenic
991844057 5:70838761-70838783 TGGTGCTAGAATGAGGATGAAGG + Intergenic
991874942 5:71154776-71154798 TGGTGCTAGAATGAGGATGAAGG - Intergenic
992685530 5:79195750-79195772 TTTGGTCAGATTGAGGAGGAAGG - Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993855655 5:93071271-93071293 TTTCTTGGGAATGAGGAGGAAGG + Intergenic
994337416 5:98584208-98584230 TTGCATTAGAAGGAGAAGAAGGG - Intergenic
994634893 5:102332587-102332609 TTGAGTTAGAGTGAGAAGAAGGG - Intergenic
995713394 5:115057406-115057428 TTGGGTAAGAATCAGCAGGATGG - Intergenic
997831790 5:137156728-137156750 TGGCTATAGAATGAGGATGAAGG - Intronic
999330566 5:150671323-150671345 TCTCGATAGAATGAGGATGATGG - Intronic
1000155407 5:158546380-158546402 TTGGGTTGGAATGAGAAGCATGG + Intergenic
1000207820 5:159079180-159079202 TTGAGTTAGTGTGACGAGGATGG - Intronic
1001131174 5:169064861-169064883 TTTCATTAAAATGAGGAGGTCGG - Intronic
1001653566 5:173331404-173331426 ATGCGTTAAATTGAGGAGGAGGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1007354857 6:41306810-41306832 TTCCGTTAGAATTAGCAGGCTGG + Intergenic
1007589246 6:43011628-43011650 TGGCGTTCAAATGAGGATGAAGG - Exonic
1012447591 6:99322484-99322506 GTGCTCTAGAATGAGGATGAGGG + Intronic
1012839897 6:104316856-104316878 TTGAGGTAGAATGAGGTGGGGGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014716053 6:124865576-124865598 TTGCGGTGGAATTAAGAGGACGG + Intergenic
1016806775 6:148219631-148219653 TTGCCCCAGAAGGAGGAGGAAGG - Intergenic
1018078943 6:160242261-160242283 TTTCCTTAGAATGACGAGGGTGG - Intronic
1018249872 6:161858695-161858717 ATGGGTTAGAATAAGGAGGAAGG - Intronic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1021322159 7:19225800-19225822 TTGAGTTAGAGGTAGGAGGAAGG - Intergenic
1021808202 7:24377423-24377445 TTATATTAGAATGAGGAAGAGGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1027564786 7:79777983-79778005 TTGTGTTAGAATTGGGATGAAGG - Intergenic
1028204215 7:87997651-87997673 TTGCCTTTGAAAGTGGAGGAAGG - Intronic
1029676298 7:102071412-102071434 TTGCCTTAGAATCTGGAGTAAGG + Intronic
1030865831 7:114700672-114700694 CTGAGTTGGAATGAGGAGGCTGG + Intergenic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1035477820 7:159156098-159156120 GTGCCTTAGAGTGAGAAGGAGGG - Intergenic
1038524558 8:28261848-28261870 TGGCGATAGAATGGGGATGAAGG - Intergenic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1041305541 8:56454243-56454265 TTGTGTTAGCTTGAGAAGGATGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1044222574 8:89686497-89686519 TTGTGTTAGAGTGGAGAGGAAGG - Intergenic
1044304274 8:90619765-90619787 TGGGGATAGAATGAAGAGGAGGG - Intergenic
1044421643 8:92003000-92003022 TTTCCTTAGAGTTAGGAGGAAGG - Intronic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045886372 8:107102844-107102866 TGGCTTTACAATAAGGAGGATGG - Intergenic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051138344 9:13949989-13950011 TTGCCTTAGAAGGATGAGGATGG + Intergenic
1051649651 9:19309049-19309071 TTGCCTTGGAATGAAGAGGATGG + Intronic
1053782412 9:41624310-41624332 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054170367 9:61834467-61834489 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054667170 9:67746348-67746370 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
1056509717 9:87292191-87292213 TTGCCTGAGAATAAGGTGGAAGG - Intergenic
1057415030 9:94854159-94854181 TTGCATTAGAATATGGTGGACGG + Intronic
1058083581 9:100724817-100724839 TTGCCTTAGAATGAGCAGCCCGG - Intergenic
1059927633 9:119227287-119227309 ATCGGATAGAATGAGGAGGATGG - Intronic
1060236745 9:121869136-121869158 TTGCGTTAGTTTCAGGAGGTAGG - Intronic
1060865197 9:126989695-126989717 TCTGGTTAGAATGAGGAGGTGGG + Intronic
1186315635 X:8366733-8366755 TTTCTTTAGACTGATGAGGATGG - Intergenic
1186828364 X:13364516-13364538 TTGAGCTAGGATGATGAGGATGG - Intergenic
1187195146 X:17076680-17076702 TTGCTATAGATTGAGGAAGAAGG + Intronic
1187236747 X:17474956-17474978 GTGCCTGAGAATGAGGAGTAGGG + Intronic
1188621359 X:32228803-32228825 TTGTGTTTGAATGAAGAGAAAGG - Intronic
1192007561 X:67233819-67233841 TTGGGTGAGAATGAGGCTGATGG + Intergenic
1193871361 X:86802844-86802866 TTGGGATAGATGGAGGAGGAGGG - Intronic
1195253044 X:103066550-103066572 TTGCTTTGGTATGAAGAGGATGG - Intergenic
1195404074 X:104493636-104493658 TTCCTTAAGAATGAGGAGCAGGG + Intergenic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1196804715 X:119574299-119574321 TTGCCTTAGAATTAGCAGGTGGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic