ID: 1148070852

View in Genome Browser
Species Human (GRCh38)
Location 17:44907717-44907739
Sequence TAGCAGACACAGTTGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148070852_1148070858 24 Left 1148070852 17:44907717-44907739 CCCATCCCCAACTGTGTCTGCTA 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1148070858 17:44907764-44907786 TTTAATTCTCTTTCTCTCCCTGG 0: 1
1: 1
2: 5
3: 77
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148070852 Original CRISPR TAGCAGACACAGTTGGGGAT GGG (reversed) Intronic
900294932 1:1944060-1944082 TAGCAGACATGGTTGGGGAGAGG - Intronic
900736013 1:4299964-4299986 TGGGTGACACAGTTGGGGACAGG + Intergenic
901611790 1:10504559-10504581 TGGCAGACACAGCTGGGTAAAGG - Intronic
903538304 1:24082002-24082024 TTGCAGACCCGGGTGGGGATGGG + Exonic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
904936812 1:34136694-34136716 AAGCAAACTCATTTGGGGATTGG - Intronic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
912713037 1:111963087-111963109 TTGGAGACCCAGCTGGGGATGGG - Intronic
915384858 1:155481177-155481199 TAACAGATACAGTAGGTGATGGG + Exonic
916679642 1:167092658-167092680 TAGCAGATATAGTAGGGGAAGGG - Intergenic
917429744 1:174953746-174953768 CAGCAGACACTGTGGGAGATCGG + Intronic
918833519 1:189429859-189429881 TAGCAGACACACTTTTGAATTGG + Intergenic
920896404 1:210054947-210054969 TAGAGGACACAGTTTGGGGTGGG + Intronic
922601991 1:226863473-226863495 TAGCAGACAGCGTGGGGGAACGG - Intergenic
924048047 1:240052506-240052528 GTGCTGACACTGTTGGGGATGGG + Intronic
1067287075 10:44914520-44914542 AAGCAGACACAGCTGGGAAATGG + Intronic
1069589942 10:69635409-69635431 TAGCAGGCAGAGTTGGTGGTGGG - Intergenic
1071743633 10:88390437-88390459 TTGCAGACACTTTGGGGGATTGG - Intronic
1072629280 10:97134417-97134439 AAGCACACACAGTTTGGGAAAGG + Intronic
1074610518 10:115016895-115016917 TAGAAATCACAGTTGGGGACAGG + Intergenic
1077598741 11:3557552-3557574 TAGCCGAGAAAGTTGGGGAATGG - Intergenic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1078970324 11:16402839-16402861 TAGGAGAGACCATTGGGGATAGG - Intronic
1079100623 11:17539355-17539377 GAGCAGACCCAGTTGGGGAAGGG - Intronic
1079311491 11:19370515-19370537 TAGCAGAAACATTTGAGGAGTGG - Intronic
1080026850 11:27624251-27624273 TAGGGGACACAGTTGAGGAATGG + Intergenic
1080657740 11:34270998-34271020 TAGCAGCCAGAGGTGGGGATGGG + Intronic
1083388985 11:62334253-62334275 TAGCTGAGACTGGTGGGGATGGG + Intergenic
1084254812 11:67933424-67933446 TAGCCGAGAAAGTTGGGGAACGG - Intergenic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1088076125 11:105850696-105850718 TACCAGAGACATTTGGGGAGGGG + Intronic
1089410446 11:118237204-118237226 CAGCAGGCACATTTCGGGATCGG - Exonic
1089535272 11:119157037-119157059 GAGCAGGCATAGTTGGGGAGGGG + Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1091064229 11:132493552-132493574 TAGCAGACACAGAAAGGGAGAGG - Intronic
1092081852 12:5723179-5723201 TAGCAGAGGCAGTTAGGGAATGG - Intronic
1095710093 12:45279036-45279058 TACTAGGCACAGTTGAGGATGGG - Intronic
1098466877 12:70797325-70797347 TTGAGAACACAGTTGGGGATGGG - Intronic
1102796336 12:115691948-115691970 GAGCAGACACAGAGGGGGAGAGG - Intergenic
1103204654 12:119119002-119119024 TAGCTGACACTTTTGGAGATGGG + Intronic
1108478194 13:50842302-50842324 TAGCAGAAGGAGTTGGGGAGGGG - Intronic
1109248535 13:59988254-59988276 TGGCAGAAATATTTGGGGATGGG - Intronic
1110392168 13:74986600-74986622 GAGCAGACAGGGTTGGGGACAGG + Intergenic
1111285150 13:86081367-86081389 AAGCAGAGATTGTTGGGGATGGG + Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122388860 14:101366687-101366709 TTGCAGACACAGAGGGCGATTGG + Intergenic
1124186524 15:27534684-27534706 TACCAGACACAGAAGAGGATGGG + Exonic
1124349378 15:28943967-28943989 CAGCAGACACAGTAGGGAGTTGG - Intronic
1128288287 15:66456802-66456824 TAGCAGAAACAGTTGATGCTGGG + Intronic
1130056776 15:80533092-80533114 GAGCAGCCACTGTTGGGGAGGGG + Intronic
1134686162 16:16160029-16160051 TGGGAGACAAGGTTGGGGATGGG - Intronic
1134818601 16:17227284-17227306 AGGCAGACACACTTGGGGAAGGG + Intronic
1135488607 16:22887613-22887635 TAGCAGACACGATTGGTGCTTGG + Intronic
1138066237 16:53944366-53944388 TAGCCAACACAATTGGGGAATGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1140027146 16:71301052-71301074 AAGCAGACAAAGTTGGGAATAGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1143141979 17:4745900-4745922 GAGCAGAGGGAGTTGGGGATGGG - Exonic
1144034057 17:11349595-11349617 GAGCAGCCACAGTTGGGGATGGG + Intronic
1145947392 17:28787217-28787239 TAGAAGATACAGTGGGGGCTGGG - Intronic
1147262615 17:39217426-39217448 TAAGAGGCACAGTTGGGGGTGGG + Intronic
1147442185 17:40454018-40454040 TTGCGGTCGCAGTTGGGGATGGG - Exonic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1148944619 17:51249234-51249256 TGGGAGACAGAGTTGGGGGTGGG + Intronic
1150211175 17:63442359-63442381 CAGCAGACACATTTGTGGGTGGG - Intronic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151047707 17:70941127-70941149 TAACTGACAGAGTTGGGCATGGG - Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1154415878 18:14174973-14174995 TAGCAGACACCACTGGGGACAGG - Intergenic
1156362142 18:36392501-36392523 TAGCAGACACAGTTCAGCTTTGG - Intronic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1156621489 18:38857005-38857027 TAGAATACACAGTTGGGGATGGG - Intergenic
1158528061 18:58233172-58233194 TAGCATCCCCAGTAGGGGATGGG - Intronic
1161475039 19:4480018-4480040 TAGCAGTGACAGTTGGGGCCAGG + Intronic
1162130088 19:8521181-8521203 TGCCAGGCACAGTTGGGGAGGGG - Exonic
1163282770 19:16327091-16327113 TACCAGTCACAGTTTGGGAGGGG - Exonic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1165602557 19:37068240-37068262 TAGCAGAAAAGGTTGGGGAGGGG + Intronic
1168115750 19:54220679-54220701 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168118736 19:54240425-54240447 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168185735 19:54698324-54698346 TCTCAGACACAGCAGGGGATGGG - Intronic
927029588 2:19106583-19106605 TAACAGACACAGATGGGTAATGG - Intergenic
927887700 2:26728700-26728722 AAGCAGGCACAGTCGGAGATGGG - Exonic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
930186238 2:48415072-48415094 TAGAGGACACAGATTGGGATAGG + Intergenic
931017152 2:57996182-57996204 AAGGAGACAGAGTTGAGGATGGG + Intronic
932835378 2:75031052-75031074 TAACAGAAAGAGTTGAGGATTGG + Intergenic
933107479 2:78350160-78350182 TAGCAGATATAATTGGGTATGGG + Intergenic
935709655 2:105886755-105886777 TAGGAAATACATTTGGGGATAGG + Intronic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
936707565 2:115092521-115092543 TACCAGATACAGTAGGAGATGGG - Intronic
937305099 2:120866178-120866200 TAGCAGAGGGTGTTGGGGATAGG + Intronic
938277435 2:130038454-130038476 TACCAGTCACAGTTTGGGAGGGG - Intergenic
938328406 2:130429257-130429279 TACCAGTCACAGTTTGGGAGGGG - Intergenic
938361541 2:130692237-130692259 TACCAGTCACAGTTTGGGAGGGG + Intergenic
938437950 2:131298926-131298948 TACCAGTCACAGTTTGGGAGGGG + Intronic
939858515 2:147390014-147390036 TAACAGACACTGTGGGGGCTGGG - Intergenic
943170015 2:184386191-184386213 TAGCCAACACAGCTGGGGATGGG - Intergenic
946277443 2:218642265-218642287 TGGCAGCCTCAGATGGGGATGGG - Exonic
946337452 2:219047936-219047958 TTGCAGACAGAGCTGGGAATGGG - Intergenic
947121597 2:226821007-226821029 TGGCAGACACAGGAGAGGATGGG - Intergenic
1169268372 20:4181370-4181392 AAGCAGACACACTTGGGCAGGGG + Intronic
1170738152 20:19028268-19028290 TAGCAGACACTGATGCGGACAGG + Intergenic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171792036 20:29536190-29536212 TAGAAGACACAGCTGGGGGCCGG + Intergenic
1177002651 21:15633697-15633719 TGGCAGAGAGACTTGGGGATTGG - Intergenic
1181830373 22:25555695-25555717 TGGAAGACTTAGTTGGGGATTGG - Intergenic
1182043167 22:27254148-27254170 CAGAAGAGAGAGTTGGGGATTGG + Intergenic
1185403411 22:50630639-50630661 TAGTTGACCCAGTTGAGGATTGG - Intergenic
950751717 3:15134298-15134320 TAGCCGAGAAAGTTGGGGAATGG + Intergenic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
953239745 3:41138126-41138148 AAGGACACACAGTTGGGGAATGG + Intergenic
958069405 3:88590586-88590608 TAATAGAGACAGCTGGGGATGGG - Intergenic
961235853 3:125366388-125366410 TAGGAGAGTCAGTTGGGGTTGGG - Intronic
964957952 3:162384633-162384655 TAGCAGGCACAGTAGGGATTTGG + Intergenic
965810504 3:172587283-172587305 TAACAGACGCACTTGGAGATTGG + Intergenic
966012492 3:175098155-175098177 CAGCAGACACAGAAGGGTATAGG - Intronic
966239602 3:177741946-177741968 AAGCTGATACAGTTGGGGGTGGG - Intergenic
969740620 4:9023248-9023270 TAGCCGAGAAAGTTGGGGAATGG + Intergenic
969799964 4:9556084-9556106 TAGCTGAGAAAGTTGGGGAATGG + Intergenic
973947959 4:55979501-55979523 AAGCTGAGACAGTTGGGGGTTGG + Intronic
978399377 4:108314565-108314587 TAGCAGCCAGATTTGGGGAGTGG - Intergenic
979758657 4:124373526-124373548 TGGAACACTCAGTTGGGGATGGG + Intergenic
981915000 4:150024007-150024029 TAGCAGAAATAGTTGGGAATAGG - Intergenic
983751738 4:171282343-171282365 TTACAGACAAAATTGGGGATGGG + Intergenic
984361031 4:178732576-178732598 TAGCAGATACTGATGGGAATTGG + Intergenic
986774912 5:11005515-11005537 TGGGAGACATAGTTGGGTATGGG + Intronic
987199011 5:15555742-15555764 TACCTGACAAAATTGGGGATTGG + Intronic
987952831 5:24698023-24698045 TAGCAAACACTGGTGAGGATGGG - Intergenic
989669987 5:43905532-43905554 TAGCAGACACAGGAGGAGAAAGG - Intergenic
990735058 5:58851328-58851350 TAGCAGGCACAGTTGGGCTGCGG - Exonic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
996235768 5:121127819-121127841 TAGCAGAGACAGTGGGGAAAAGG + Intergenic
997708301 5:135979677-135979699 TAGCATACACAGTTGGACAACGG + Intergenic
998513136 5:142730272-142730294 GAGCAGACACATATGGGAATGGG - Intergenic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
1000094611 5:157960355-157960377 TAGCAGAGATAGTGGGGGATGGG - Intergenic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1001308546 5:170594112-170594134 TAGGAGACACAGCTAGAGATTGG + Intronic
1002852399 6:1008083-1008105 TAGCACTGACAGTTGAGGATGGG - Intergenic
1008786830 6:55178007-55178029 TAGAAGACATAGTTAGGAATAGG - Intronic
1011948002 6:92931377-92931399 TAACAGTCACATTTGGGGTTAGG + Intergenic
1015966106 6:138696583-138696605 TAGGAGACCCTGTTGGGGAAGGG - Intergenic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1026287184 7:68973619-68973641 GGGCAGACACAGTTGGGAAAGGG - Intergenic
1026833256 7:73622879-73622901 GAGCAGCCAAAGTTGGGGTTGGG + Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1034514743 7:151567081-151567103 TAGCAGAAATAGTTTGGGCTTGG + Intronic
1036362520 8:8088857-8088879 TAGCTGAGAAAGTTGGGGAATGG + Intergenic
1036896039 8:12636314-12636336 TAGCTGAGAAAGTTGGGGAATGG - Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038453191 8:27652972-27652994 TAGCAGACACAGGTGGTGATGGG - Intronic
1039424815 8:37477198-37477220 CAGCATACAAATTTGGGGATGGG + Intergenic
1045422884 8:102034145-102034167 TAACAGACACACTTGGGGAAAGG - Intronic
1046482932 8:114846858-114846880 TAGCAGACACTGTTGTGGCCTGG - Intergenic
1047078902 8:121437327-121437349 TGGGAGAGAAAGTTGGGGATAGG - Intergenic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1048705712 8:137150700-137150722 TGGCAGACACAGTTTGGCTTTGG + Intergenic
1048898463 8:139015868-139015890 TGGCGCACACAGTTTGGGATGGG + Intergenic
1049837677 8:144748874-144748896 TAGAAAACACAGTTGGGGCCAGG + Intronic
1056769133 9:89464382-89464404 AGGCAGCCACAGTTGGGGGTGGG + Intronic
1057226198 9:93294576-93294598 TAGCAGCCACAGCTGGGGTGTGG - Intronic
1057734454 9:97641991-97642013 TACCAGACAAATTTGGGAATTGG + Intronic
1187256545 X:17648256-17648278 TAGCAGACCAAGATGGGGGTAGG + Intronic
1193255372 X:79342519-79342541 TGGCAGCCACTGTGGGGGATGGG - Intergenic
1193318465 X:80092525-80092547 GAGCAGACACAATTGCAGATTGG + Intergenic
1195470492 X:105224155-105224177 TAGCAGATACCTTTAGGGATAGG + Intronic
1197971300 X:132118150-132118172 TAGGGGAGAGAGTTGGGGATTGG + Intronic
1199610025 X:149605156-149605178 TAGCAGACCCAGCTGTGCATAGG + Intronic