ID: 1148071499

View in Genome Browser
Species Human (GRCh38)
Location 17:44911440-44911462
Sequence CTCTCCAGGGACTCGTTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148071489_1148071499 18 Left 1148071489 17:44911399-44911421 CCGCCTCCCGCACGTGCCGCTCC 0: 1
1: 0
2: 0
3: 52
4: 444
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071491_1148071499 12 Left 1148071491 17:44911405-44911427 CCCGCACGTGCCGCTCCTCCTGC 0: 1
1: 0
2: 0
3: 38
4: 396
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071488_1148071499 30 Left 1148071488 17:44911387-44911409 CCTGATAACTGGCCGCCTCCCGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071492_1148071499 11 Left 1148071492 17:44911406-44911428 CCGCACGTGCCGCTCCTCCTGCT 0: 1
1: 0
2: 0
3: 35
4: 241
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071493_1148071499 2 Left 1148071493 17:44911415-44911437 CCGCTCCTCCTGCTCGCGCATCT 0: 1
1: 0
2: 12
3: 41
4: 356
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071494_1148071499 -3 Left 1148071494 17:44911420-44911442 CCTCCTGCTCGCGCATCTGCCTC 0: 1
1: 0
2: 1
3: 63
4: 339
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071495_1148071499 -6 Left 1148071495 17:44911423-44911445 CCTGCTCGCGCATCTGCCTCTCC 0: 1
1: 0
2: 4
3: 67
4: 725
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1148071490_1148071499 15 Left 1148071490 17:44911402-44911424 CCTCCCGCACGTGCCGCTCCTCC 0: 1
1: 0
2: 8
3: 16
4: 277
Right 1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148071499 Original CRISPR CTCTCCAGGGACTCGTTCTG TGG Exonic
900293708 1:1937655-1937677 GTCTCCAGGGATGTGTTCTGGGG - Intronic
900307093 1:2015891-2015913 CTCACCAGAGCCTCGTTCGGAGG + Intergenic
900600951 1:3502446-3502468 CCCTCCAGGGACTCGGCCCGAGG + Intronic
900818702 1:4869954-4869976 CACTCCAGAGAGTCATTCTGTGG - Intergenic
901813130 1:11778954-11778976 CTCTCCAGGGGAGCCTTCTGTGG + Exonic
901864732 1:12097234-12097256 CTCTCCAGGGCCTCCTTCTAGGG + Intronic
903444123 1:23410023-23410045 CTCCCCAGGGCCTCTGTCTGAGG + Intronic
903755182 1:25655757-25655779 TTCCTCAGGGACTTGTTCTGGGG + Intronic
903846135 1:26280759-26280781 CTCTGCTGGGACTTGATCTGGGG - Exonic
905173616 1:36123511-36123533 CTCACCAGGGTCTCTTTCTCTGG - Intronic
905581667 1:39087093-39087115 CTCTGCAGGGACTCCTTCACAGG + Intronic
905885227 1:41488195-41488217 GTCTCCTGGGCCTCCTTCTGGGG - Intergenic
905907334 1:41627751-41627773 GACTCCAGGGCCTCCTTCTGGGG - Intronic
906661142 1:47583219-47583241 CTCCCCAGTGACTAGCTCTGTGG - Intergenic
908131717 1:61081836-61081858 CTCTCCAGCGAAGCTTTCTGTGG - Intronic
916892850 1:169130013-169130035 GTCTCCAAGGACTCATTCTTGGG - Exonic
917225513 1:172777760-172777782 CTCTTCAGGGACTTCTTCAGAGG - Intergenic
917347954 1:174048283-174048305 GTCACCAGGGACTGGTTTTGTGG - Intergenic
920295639 1:204954521-204954543 CTTTCCAGGGAATCATTCTGAGG - Intronic
920689550 1:208135408-208135430 CTCTCCAGGCAGTCTTCCTGTGG - Intronic
1063196916 10:3752282-3752304 CTCTCTAGGGGATCATTCTGAGG - Intergenic
1063365957 10:5491077-5491099 CTGCCCAGGGACTGGTTTTGAGG - Intergenic
1063416212 10:5874541-5874563 CTCTGCAGGGACTCCTTAAGAGG + Intronic
1064245116 10:13661951-13661973 CACTGCAGGGTCTCTTTCTGGGG - Intronic
1066050806 10:31633179-31633201 GACTACAGGGACTCTTTCTGGGG - Intergenic
1067221155 10:44345365-44345387 CTCTCCTGTGTCTCCTTCTGTGG - Intergenic
1067433017 10:46256317-46256339 CACTCCAGGGACATGTTCCGGGG + Intergenic
1067440246 10:46305107-46305129 CACTCCAGGGACATGTTCCGGGG - Intronic
1068890639 10:62145300-62145322 CTCTCCAGGTTCTCATTGTGAGG - Intergenic
1069905618 10:71730587-71730609 CTCACCAGAGTCTCGGTCTGTGG - Intronic
1072725103 10:97807720-97807742 CTCTCCAAGGGCTGGCTCTGTGG + Intergenic
1072767091 10:98104070-98104092 CTCTCCAGGGACACTTTGTTAGG - Intergenic
1074692522 10:116019171-116019193 CTCTCAAGGGACTTGTGCAGCGG + Intergenic
1075002078 10:118806082-118806104 CTCTCCAGAGACTGGTACTGCGG - Intergenic
1075805915 10:125188733-125188755 CTCCCCAGGCACTGGTTCTTTGG - Intergenic
1077117300 11:890938-890960 CTCTCCAGGGGCACTGTCTGTGG - Intronic
1077378733 11:2217965-2217987 CTCCTCAGTGACTCGTTCTCAGG + Intergenic
1078927252 11:15885983-15886005 CTCTCCATGGACTCTCCCTGTGG - Intergenic
1080647456 11:34197367-34197389 TTCTCCATGGACTCCATCTGTGG + Exonic
1085013020 11:73154439-73154461 CTCTCCAGGGTCTGGTGCAGAGG - Intergenic
1087786611 11:102361670-102361692 GTCTCCAGGGACCTGCTCTGGGG + Intronic
1092806567 12:12228811-12228833 GGCACCAGGGACTGGTTCTGTGG - Intronic
1095656244 12:44672490-44672512 GCCTCCAGGGACTGGTTTTGTGG - Intronic
1095931619 12:47631995-47632017 CTCTCCAGGGCCTCTTTAAGGGG + Intergenic
1096084547 12:48856892-48856914 CTGTCCTGGGACCCTTTCTGTGG - Intergenic
1096088476 12:48882581-48882603 CTCTCCAGAGACTCGTCATGGGG - Intergenic
1098935631 12:76475696-76475718 ATCTCCAGGGACGGGTTCAGGGG - Intronic
1099169588 12:79347893-79347915 CTCTTTAGGGACTTTTTCTGTGG - Intronic
1101804964 12:108055672-108055694 CTCTTCAGGGATTCATTTTGGGG + Intergenic
1102098220 12:110257337-110257359 CTCTCCAGGGACTCTCTCCAGGG + Intergenic
1103125917 12:118422257-118422279 GTCTCCAGGGACCCGTTCTGTGG - Intergenic
1103944670 12:124519392-124519414 CTGTCCAGGGACACATTCTTAGG - Intronic
1105064289 12:133183191-133183213 CCAACCAGGGACTCGTTTTGTGG - Intronic
1105505749 13:21008239-21008261 CTCTCCTGGGACTCCTGCTGGGG + Intronic
1106394845 13:29369656-29369678 CTCTCCAGGGACTGGATCACAGG - Intronic
1109410663 13:61963754-61963776 GTCACCAGGGACCCGTTTTGTGG + Intergenic
1110716985 13:78716751-78716773 CTTTCCAGCGACTGGTTCTGTGG + Intergenic
1115852443 14:37598789-37598811 CTCTCCAGGGCTTCCCTCTGTGG + Intronic
1116605367 14:46986343-46986365 CTCTTCAGGAATTCTTTCTGAGG + Intronic
1117038483 14:51749830-51749852 CTTGCCTGGGACTCGTACTGTGG + Intergenic
1119042076 14:71283796-71283818 CTCTTCAAGGACTCATTTTGAGG - Intergenic
1120558269 14:85957136-85957158 GGCACCAGGGACTCGTTTTGTGG - Intergenic
1122356711 14:101127032-101127054 GTCTCCAGGGTCTCGTTTGGGGG - Intergenic
1125434145 15:39627528-39627550 CACTTCAGGGAGTCTTTCTGGGG - Intronic
1129207884 15:74048043-74048065 TGCTCCAGGGTCTCCTTCTGAGG + Intergenic
1129649605 15:77474124-77474146 CTTTCCATGGGCTCCTTCTGCGG - Intronic
1129666494 15:77582268-77582290 CTCTCCACGGTCTTCTTCTGTGG + Intergenic
1131029758 15:89176571-89176593 CCCTCCTGGGACTCATCCTGTGG - Intronic
1132827864 16:1913963-1913985 CTGCCCAGGGCCTGGTTCTGCGG - Intronic
1136089355 16:27907229-27907251 CTCTCCTGGGTTTCCTTCTGAGG - Intronic
1136287499 16:29253059-29253081 CTCTCCAGGGCCTCTTTGTAAGG - Intergenic
1136534620 16:30892617-30892639 CTCCTCAGGGACCCCTTCTGGGG + Exonic
1137627025 16:49915611-49915633 CTCTGGAGGGACGCGTTCTGTGG + Intergenic
1138875648 16:60945472-60945494 CTCTGCAGGTAACCGTTCTGTGG - Intergenic
1142093119 16:88225688-88225710 CTCTCCAGGGCCTCTTTGTAAGG - Intergenic
1142620880 17:1165198-1165220 CGCTCCAGGGCCCGGTTCTGTGG - Intronic
1142685861 17:1576597-1576619 CTCTCCAGGGAGACCCTCTGTGG - Exonic
1145760293 17:27421730-27421752 CTCTGCAGAGAGTGGTTCTGGGG - Intergenic
1146639289 17:34527782-34527804 CTGTGCTGGGACCCGTTCTGTGG - Intergenic
1147483895 17:40794030-40794052 CACTCCAGGGAGTGTTTCTGAGG + Exonic
1147771743 17:42872650-42872672 CTCTCCACGGAGCTGTTCTGGGG - Intergenic
1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG + Exonic
1149019366 17:51945454-51945476 ATCAACACGGACTCGTTCTGGGG + Intronic
1150035846 17:61796326-61796348 CTCTCCAGGACATCGGTCTGGGG - Intronic
1152504098 17:80735823-80735845 CTCTCCAGGAAGTCATTCTCAGG - Intronic
1153371340 18:4319910-4319932 CTCTCCAACCACTCATTCTGGGG + Intronic
1155165808 18:23231582-23231604 TTCTCGAGGGACCAGTTCTGTGG + Intronic
1157089401 18:44618463-44618485 CTCTCCAGGACATTGTTCTGGGG + Intergenic
1157481608 18:48058794-48058816 TTCTCCAGGAACTCTTACTGTGG + Intronic
1161509111 19:4660823-4660845 CCCGCCAGGGACTCGGGCTGGGG + Intronic
1167421291 19:49405001-49405023 CTCTTCAGGCCCTCATTCTGTGG - Intronic
1167819887 19:51917999-51918021 GGCACCAGGGACTCGTTTTGTGG + Intronic
925383261 2:3443359-3443381 CCCTTCAGGGTCTCCTTCTGGGG + Intronic
934652189 2:96099056-96099078 CTCTCCAGGGACAGGAGCTGTGG + Intergenic
934784857 2:96997645-96997667 CACTCCAGGGACTATTGCTGGGG + Intronic
935463794 2:103370272-103370294 TTCTGAAGGGACTCTTTCTGAGG - Intergenic
936445091 2:112588774-112588796 CTCTGCAGGGTCTCCCTCTGTGG + Intronic
937349960 2:121154546-121154568 CTCTCCTGGGACTCTGTCTAGGG - Intergenic
937363300 2:121243925-121243947 GGCACCAGGGACTGGTTCTGTGG - Intronic
937932796 2:127219456-127219478 GTCTCCAGGGACTGGTCCCGGGG - Intronic
940902367 2:159137475-159137497 CTGTCCAGGCACTCATTGTGTGG + Intronic
943938943 2:193965210-193965232 CTCCCTTGGGACTCCTTCTGGGG + Intergenic
944318661 2:198310826-198310848 GGCACCAGGGACTGGTTCTGTGG + Intronic
944972621 2:205011420-205011442 CTCTCGAGTCACTTGTTCTGAGG - Intronic
947072718 2:226309081-226309103 CTCTCCAGGGAACCCTCCTGAGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948738858 2:240029921-240029943 ATCTCCAGCGTCACGTTCTGTGG - Exonic
948740932 2:240045564-240045586 ATCTCCAGCGTCACGTTCTGTGG - Exonic
1171297116 20:24027537-24027559 CTCTCCAGGGCCACCTTCTCGGG - Intergenic
1173428265 20:42961664-42961686 CTCTCCAGGGAGGGGTACTGTGG + Intronic
1175991249 20:62790637-62790659 CTCTCCAGGTACTGCTTTTGTGG - Intergenic
1176161626 20:63651679-63651701 CTCTCCTGGGGCTTGTTCTGAGG - Intronic
1177881516 21:26701153-26701175 CTCTCCATGGACTTATTTTGAGG + Intergenic
1181530144 22:23512791-23512813 TTCTGCAGGGACTCATCCTGGGG + Intergenic
1182463707 22:30501109-30501131 CTCTCCCGGGCCTCATGCTGAGG - Intronic
949127542 3:464508-464530 CTCTTCAGCCACTCTTTCTGGGG - Intergenic
950020510 3:9784187-9784209 CTCTCCAGGGACTTAGTATGCGG + Exonic
950709722 3:14805627-14805649 CACACCAGGTACTGGTTCTGTGG - Intergenic
952562804 3:34615127-34615149 TTCTCCAGAGACTCGTTTTTTGG - Intergenic
953784014 3:45896945-45896967 CTTTCCAGGGCCTCCTTCTCTGG - Intronic
954206284 3:49061246-49061268 TGCACCAGGGACTCGTTTTGTGG - Intronic
954324603 3:49856551-49856573 CGCTCCAGGAAGTCGTGCTGCGG - Exonic
954590595 3:51778478-51778500 CACACCAGGGAATCTTTCTGGGG + Intergenic
957707756 3:83812547-83812569 GGCACCAGGGACTGGTTCTGTGG - Intergenic
959126586 3:102297091-102297113 GTCTCCAGAGACCAGTTCTGTGG + Intronic
960869560 3:122235002-122235024 CTCTTCAGGGGCTCTTTCTTTGG - Intronic
961458985 3:127038348-127038370 CTCTCCATGAACTCGTTCCCAGG + Intergenic
963062365 3:141235072-141235094 TTGTCCAGGGACAGGTTCTGGGG - Intronic
964114780 3:153124326-153124348 CTCTCCAGGACATTGTTCTGGGG - Intergenic
972754367 4:42029784-42029806 GTCTCCAAGGACTCATTCTCGGG - Intronic
975349537 4:73330076-73330098 CTCCCCAGGAACTGGTTCAGTGG - Intergenic
976729047 4:88244355-88244377 CCCTCCAGAAACTGGTTCTGAGG + Intergenic
979055164 4:115984277-115984299 GGCACCAGGGACCCGTTCTGTGG - Intergenic
980443595 4:132879512-132879534 CTCTCCAGGACATTGTTCTGGGG + Intergenic
985034640 4:185825971-185825993 CACTCCAGGAAGTCTTTCTGCGG + Intronic
985644597 5:1078969-1078991 CACCCCAGGGCCCCGTTCTGTGG - Intronic
985658582 5:1144365-1144387 CTCTCCAGGATCTCGTTCAAAGG - Intergenic
986606833 5:9531191-9531213 CTCTCTAGGACCTTGTTCTGGGG - Intronic
990877089 5:60498135-60498157 GTCTCCAGTCACTGGTTCTGGGG - Intronic
992021621 5:72630402-72630424 CTCTGCATGGACTCCCTCTGTGG + Intergenic
992542982 5:77782764-77782786 CTCTCCAGGGGTGTGTTCTGCGG - Intronic
993109710 5:83642155-83642177 CTCTCCAGAAACTTGTGCTGGGG - Intronic
993443247 5:87980853-87980875 ATCTCCAGGCATTCGTTCAGAGG - Intergenic
999182871 5:149682294-149682316 TTCTCCAGGGAAATGTTCTGGGG - Intergenic
999731034 5:154476879-154476901 CTCCCCATGGACTGGTTCTGAGG - Intronic
1001254266 5:170171651-170171673 GTCTCCAGGGTCTTGTTCTTTGG - Intergenic
1001425287 5:171618570-171618592 TTCACCAGGGACTGGCTCTGGGG - Intergenic
1003015194 6:2462432-2462454 CTCTTCAGGGTCTCATTTTGTGG - Intergenic
1004770112 6:18771804-18771826 GGCACCAGGGACTAGTTCTGTGG - Intergenic
1004928967 6:20443234-20443256 CTCTTCATGGAATTGTTCTGTGG + Intronic
1006481769 6:34300458-34300480 CTCTGCAGGGACTAGTTCAGAGG + Intronic
1006720134 6:36144814-36144836 AGCTCCAGGGACTGGTTTTGTGG + Intergenic
1007477026 6:42125657-42125679 ATTTCCTGGGACTGGTTCTGAGG + Intronic
1015822864 6:137281887-137281909 CTCTCCAGGGACCCATCTTGAGG - Intergenic
1016882096 6:148921526-148921548 CTCTCCAGGGACTCTCTGTCTGG + Intronic
1017235370 6:152112675-152112697 CTCTGCAGAGTTTCGTTCTGGGG - Intronic
1018830156 6:167436093-167436115 CTTTCCAGGGAGTCATTCTTGGG - Intergenic
1019356016 7:579365-579387 TTCTCCAGGGACTCTGTCGGGGG + Exonic
1023320756 7:38994998-38995020 CTTTCCAGGGATTTCTTCTGGGG - Intronic
1026383948 7:69827097-69827119 CTCTCCATGAGCTAGTTCTGGGG - Intronic
1030900647 7:115119224-115119246 GGCACCAGGGACTAGTTCTGTGG - Intergenic
1031800829 7:126242714-126242736 TTCTCCAGGGACTGGTGTTGGGG - Intergenic
1032671460 7:134086599-134086621 CTCTCAAGGCAGTGGTTCTGGGG + Intergenic
1033298272 7:140161262-140161284 CTCTCCAAGGACTGGGTTTGTGG - Intronic
1034072326 7:148198425-148198447 CTTTTAAGGGACTCCTTCTGTGG + Intronic
1035315282 7:157993671-157993693 CTCTCCAGGACCTAGCTCTGTGG - Intronic
1035779618 8:2217233-2217255 CTCTGCAGGGGCACGTCCTGCGG + Intergenic
1044574974 8:93758333-93758355 CTCTCCAGGGAATTTTTATGTGG + Intronic
1045413678 8:101945115-101945137 CTCTCCAGAGAGTCTTGCTGGGG - Intronic
1045549258 8:103155564-103155586 CTCTCCAGGCACTGCTCCTGTGG - Intronic
1045895906 8:107216462-107216484 CTCTCCAGAGCCACTTTCTGGGG - Intergenic
1048323083 8:133417142-133417164 CTCTCCAGGCGCTCTTGCTGTGG + Intergenic
1049082412 8:140453740-140453762 CTCTTTAGGGAATCGTTGTGGGG - Intronic
1051308793 9:15746946-15746968 CTCTCCAGTGACTGGCTCGGCGG + Intronic
1054804575 9:69385462-69385484 TTCTCCAGGGAAGCATTCTGGGG - Intronic
1055075311 9:72208653-72208675 CTCTCCATGAACTCTTTCTTAGG - Intronic
1057597137 9:96424116-96424138 GGCACCAGGGACTCGTTTTGTGG - Intergenic
1057778769 9:98033290-98033312 ATCTCCAGGGAATCATGCTGAGG + Intergenic
1057942063 9:99293824-99293846 ACCTCCAGGAACTGGTTCTGTGG - Intergenic
1058416838 9:104797792-104797814 ATATCCAGGGACTTGTTCGGTGG + Intronic
1061912017 9:133729976-133729998 CTCTGCAGGGCTTCTTTCTGGGG - Intronic
1062454393 9:136628894-136628916 CTCTCCCGGGACTCCTCCTGGGG + Intergenic
1062607514 9:137354816-137354838 CTCACCACGGCCTCCTTCTGGGG + Intronic
1187029609 X:15472084-15472106 TTCTCCAGGAACTCTTGCTGAGG - Intronic
1188443624 X:30234833-30234855 CTGTCTAGGGTCTTGTTCTGAGG + Intronic
1188723560 X:33552093-33552115 CTCTCCAGGAACTCTGTCTCAGG + Intergenic
1192211526 X:69130876-69130898 CCCACCAGTGACTAGTTCTGTGG + Intergenic
1198662025 X:138979694-138979716 CTCTCCAGGGACTCTTTTTCAGG - Intronic
1200216880 X:154371877-154371899 CTCTCCAGGGGTTCGCTCTTAGG - Intronic