ID: 1148076816

View in Genome Browser
Species Human (GRCh38)
Location 17:44941888-44941910
Sequence CAGCCACACTGGCCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 337}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148076816_1148076822 26 Left 1148076816 17:44941888-44941910 CCTCCTGAGGGCCAGTGTGGCTG 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1148076822 17:44941937-44941959 CCTTCTTGCTGAGATGGTGCTGG 0: 1
1: 1
2: 1
3: 21
4: 178
1148076816_1148076825 29 Left 1148076816 17:44941888-44941910 CCTCCTGAGGGCCAGTGTGGCTG 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1148076825 17:44941940-44941962 TCTTGCTGAGATGGTGCTGGGGG 0: 1
1: 0
2: 1
3: 24
4: 267
1148076816_1148076823 27 Left 1148076816 17:44941888-44941910 CCTCCTGAGGGCCAGTGTGGCTG 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1148076823 17:44941938-44941960 CTTCTTGCTGAGATGGTGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 226
1148076816_1148076820 20 Left 1148076816 17:44941888-44941910 CCTCCTGAGGGCCAGTGTGGCTG 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1148076820 17:44941931-44941953 TGTTTTCCTTCTTGCTGAGATGG 0: 1
1: 0
2: 2
3: 71
4: 1173
1148076816_1148076824 28 Left 1148076816 17:44941888-44941910 CCTCCTGAGGGCCAGTGTGGCTG 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1148076824 17:44941939-44941961 TTCTTGCTGAGATGGTGCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148076816 Original CRISPR CAGCCACACTGGCCCTCAGG AGG (reversed) Intronic
900154112 1:1197290-1197312 CTGCCACACAGGCCCTCGGGAGG - Intronic
900587566 1:3440480-3440502 CAGCCACTCCAGCCCCCAGGGGG + Intergenic
900978901 1:6035205-6035227 CTGCCACACTGGCTCCCTGGGGG - Intronic
901114325 1:6829468-6829490 CACCAATACTGGTCCTCAGGTGG + Intronic
901142468 1:7044029-7044051 CAGCCCTAATGGCCCTCTGGAGG - Intronic
901219812 1:7577145-7577167 CAAGCACACTGGGCCTCCGGGGG - Intronic
901702483 1:11053110-11053132 CAGCCACGCAGGCCCTCTGCCGG - Intergenic
901932107 1:12602436-12602458 CTGCCACAGAAGCCCTCAGGGGG - Intronic
902205197 1:14863342-14863364 CAGACACTCTGTCCCTCCGGGGG + Intronic
902489118 1:16767950-16767972 CGGCCCCACTGGCTCTCTGGGGG + Intronic
904841726 1:33376354-33376376 AAGACACACTTGCCCTCAGAAGG + Intronic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
909287656 1:73840107-73840129 CAGAAACACTGGCCGCCAGGTGG + Intergenic
910596984 1:88991808-88991830 CAGCCCCAGTCCCCCTCAGGTGG + Intronic
913161862 1:116152307-116152329 CGCCCACGCTGGCCCTCGGGAGG + Intergenic
915298013 1:154935352-154935374 CCACCACACTGGCCTTCAAGAGG + Intronic
915510100 1:156382148-156382170 CAGCCACAAGGACCCCCAGGAGG - Exonic
915894233 1:159798963-159798985 GAACCACACTTGCCCTAAGGAGG - Intergenic
919883005 1:201913087-201913109 CAGCCTCACTGGGCCAGAGGTGG + Intronic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
923531319 1:234814575-234814597 CGGCCCCACTGGCTCTCTGGGGG - Intergenic
924093733 1:240528975-240528997 CAGCCAGAGTCGCCCTAAGGTGG + Intronic
1065882192 10:30046406-30046428 CACGCACACTGGCCCTAATGTGG - Intronic
1067040853 10:42952434-42952456 GAGCCACATGGGCCCACAGGCGG + Intergenic
1067538511 10:47135069-47135091 CAGCCAAACTGGCCCTCACCTGG - Intergenic
1069633359 10:69911034-69911056 GAGCCCCACTGGCCTCCAGGAGG - Intronic
1070669322 10:78367065-78367087 GAGCCCCACTGGGCCTGAGGAGG - Intergenic
1071258122 10:83892910-83892932 CAGACACCCTGGGCCTCAGCTGG + Intergenic
1071427829 10:85577016-85577038 CAGCCACACTGGTCTTTTGGTGG - Intergenic
1071500845 10:86203383-86203405 CAGCCACACTTGCACTCCGAGGG + Intronic
1072723724 10:97798096-97798118 CAGTCACCCTGACCCTCAGTTGG - Intergenic
1073045295 10:100634224-100634246 TGGCCATCCTGGCCCTCAGGTGG - Intergenic
1073642085 10:105263101-105263123 CTCCCACACTAGCCCACAGGTGG - Intronic
1073740939 10:106406181-106406203 CAGCCACACTGGCTTTCCTGTGG - Intergenic
1074444143 10:113504570-113504592 GAGCTCCACTGGCCCTCAGCGGG - Intergenic
1075827372 10:125370726-125370748 CAGCAGCACGGGCCCTCAGAAGG - Intergenic
1076530479 10:131141360-131141382 CACTCACACTGGACCCCAGGAGG - Intronic
1076717113 10:132371798-132371820 CAGCCACCTCAGCCCTCAGGTGG + Intronic
1077009682 11:374599-374621 CATCCAGCCTGGCCCTTAGGGGG + Intronic
1077044874 11:540336-540358 CAGCCCCTGTGGGCCTCAGGTGG + Intronic
1077095103 11:795848-795870 CAGCCACAGGGGGCCTCAGAAGG - Intronic
1077183611 11:1227046-1227068 CAGCCGCACTGGCCTCCTGGTGG + Exonic
1077555321 11:3223230-3223252 CTGCTCCACTGGGCCTCAGGTGG + Intergenic
1078139660 11:8682933-8682955 CGGCCACCCTGCCCCGCAGGCGG - Intronic
1078447364 11:11414407-11414429 CAGCCACACTGGACTTCTTGTGG + Intronic
1079860931 11:25670134-25670156 CAGCCACACAGGGCCACATGGGG + Intergenic
1081157444 11:39712327-39712349 CAGTCACATTGGCCCTCAATGGG - Intergenic
1083377710 11:62239397-62239419 CAGCCACTGTTGCCCTCAGCTGG + Intergenic
1083620694 11:64048051-64048073 GAGCCAGGCTGGGCCTCAGGCGG - Intronic
1083662968 11:64260329-64260351 CACCCACACTGAGCCCCAGGAGG - Intronic
1083764612 11:64835935-64835957 CAGCCACAGTGGACATGAGGAGG + Intronic
1083986766 11:66220726-66220748 CAGCGACAGTGGCCCTGAGATGG + Exonic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084460252 11:69293112-69293134 CAGACCCACAGGGCCTCAGGGGG - Intergenic
1084625378 11:70302279-70302301 CAGCCACACTGGTCCTTAGAGGG + Intronic
1084654201 11:70505756-70505778 CAGCCCGACGAGCCCTCAGGAGG - Intronic
1084656777 11:70524226-70524248 CAGCTGCACTGCCCCCCAGGGGG - Intronic
1085260091 11:75199661-75199683 CAGCCACACAGGGCCTCAGATGG - Intronic
1088194762 11:107262246-107262268 CAGCCAAAAGGGCCATCAGGAGG + Intergenic
1088437516 11:109831660-109831682 CAGACTCTCTGGGCCTCAGGTGG - Intergenic
1090354398 11:126130147-126130169 CAGCCCCACTTGTCCCCAGGTGG - Intergenic
1090408395 11:126491222-126491244 CAGCCTTCCTGACCCTCAGGTGG - Intronic
1090796520 11:130140300-130140322 GGGGCTCACTGGCCCTCAGGAGG + Intronic
1091105408 11:132914629-132914651 CAGTCACACTGCCCCTCAACAGG + Intronic
1091224302 11:133948503-133948525 CAGCCCCAGGGGCCCTCAGCAGG + Intronic
1091645668 12:2270621-2270643 CAGCCAGACAGGAACTCAGGAGG + Intronic
1092141662 12:6188129-6188151 CACACACACTGGCCCTCTAGGGG + Intergenic
1096896096 12:54821800-54821822 CAGCCTCTCTGGCCCTGTGGGGG + Intergenic
1099089636 12:78289388-78289410 CACCCACACTGACCCTAAGTGGG + Intergenic
1101461061 12:104894238-104894260 CAGCTACTCGGGCACTCAGGTGG + Intronic
1104391769 12:128397111-128397133 CAGCCTCACTGGCCCCAGGGTGG + Intronic
1105213652 13:18272328-18272350 CAGACACACTGTCCCAGAGGTGG + Intergenic
1107028095 13:35824095-35824117 CAGCCACACATGCCCTGTGGTGG - Intronic
1108160309 13:47632222-47632244 CAGCCCCTGTGGCTCTCAGGTGG - Intergenic
1110887671 13:80658786-80658808 CAGGCACTCTGGCGCTCAGAGGG + Intergenic
1113742466 13:112721061-112721083 CAGCAACTGTGGCCCTCAGCTGG - Intronic
1116620817 14:47201032-47201054 TAGCCACAATGGCCGCCAGGCGG + Intronic
1119095124 14:71823039-71823061 CAGCCACACTGGCTTTCTTGGGG + Intergenic
1119549375 14:75497247-75497269 CAGCCACCCTGGGCCTCTGGAGG + Intergenic
1119921529 14:78450855-78450877 CAGCCACACAGGGGCTCAGCTGG + Intronic
1121630019 14:95415143-95415165 TGGCCACCATGGCCCTCAGGTGG - Intronic
1122779751 14:104138666-104138688 CGGCCACGCTGGCTCTCCGGGGG - Intergenic
1122789083 14:104176844-104176866 CCGCCCCACTGGGCCTCGGGAGG - Exonic
1122981151 14:105192912-105192934 CAGCCAAACAGGCCCACAGCAGG + Intergenic
1122981715 14:105195161-105195183 CAGGCACAGTGGGCCCCAGGTGG - Intergenic
1122981748 14:105195261-105195283 CAGGCACAGTGGGCCCCAGGTGG - Intergenic
1123008197 14:105334443-105334465 CGCACACACTGGGCCTCAGGTGG - Intronic
1123008220 14:105334563-105334585 CGCACATACTGGCCCTCAGGTGG - Intronic
1123008237 14:105334654-105334676 CACAGACACTGGCCCTCAGGTGG - Intronic
1123008242 14:105334684-105334706 AGCACACACTGGCCCTCAGGTGG - Intronic
1124250122 15:28101541-28101563 CAGCCAAACTTGCCTTCAAGGGG + Intergenic
1124875290 15:33586286-33586308 CAGCCACACTGGACTTCGGATGG + Intronic
1125139594 15:36389041-36389063 ATGCTACAGTGGCCCTCAGGAGG + Intergenic
1127377444 15:58398043-58398065 CAGCCACGCTGGACCCCATGTGG + Intronic
1128524416 15:68402815-68402837 CTGCCCCACTGGCCCTCACATGG - Intronic
1129152917 15:73700217-73700239 CAGCCGCTCTGGCCCTGAGATGG - Intronic
1129691764 15:77717845-77717867 CAGCCAGGCTGGACCTCAGAGGG + Intronic
1129694993 15:77735435-77735457 AAGCCACACGTGGCCTCAGGAGG - Intronic
1130054166 15:80508041-80508063 CAGCCACACTTGTCCTCATTTGG + Intronic
1130101044 15:80894227-80894249 CATCCACTCTTGCCCTAAGGTGG - Intronic
1130728623 15:86467071-86467093 GAGCCACCCTTTCCCTCAGGGGG + Intronic
1131060400 15:89400483-89400505 CAGCCCCGCTGGGCCTCCGGTGG + Intergenic
1132032934 15:98453105-98453127 CAGGTACACTGGACCCCAGGAGG - Intronic
1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG + Intronic
1132586553 16:708079-708101 CAGCCACACTGGCCTTCTTCTGG + Intronic
1132704640 16:1237810-1237832 CAGCCACACTGGCCCAGAGTGGG + Intergenic
1132706873 16:1248615-1248637 CAGCCACACTGGCCCAGAGTGGG - Intergenic
1133061198 16:3175448-3175470 CAGTCACCCTGACACTCAGGAGG + Intergenic
1133747974 16:8701895-8701917 CAGCCACACTGGCCCCCTCGTGG - Intronic
1133763515 16:8819179-8819201 CAGCCCCGCTGCTCCTCAGGAGG + Intronic
1134219457 16:12342271-12342293 CATACACTCTTGCCCTCAGGAGG - Intronic
1134768195 16:16780931-16780953 CAGGCACACTGGCCCTCCTGAGG - Intergenic
1134856515 16:17524452-17524474 CAGCCAGGCTGGCCCTAAGGAGG + Intergenic
1134907118 16:17989526-17989548 CAGCCTCACTGACCATCAGTTGG + Intergenic
1135587038 16:23679331-23679353 CAGCGACACTCACCCTCCGGCGG - Exonic
1137521921 16:49201966-49201988 CAGCTAGCCTGGCCTTCAGGTGG - Intergenic
1137560254 16:49497674-49497696 CAGCCACAGTGGCTCTCACAAGG + Intronic
1137705890 16:50535655-50535677 CAGCCTGACAGCCCCTCAGGGGG + Intergenic
1139198028 16:64944017-64944039 CAGCCACACTGGCCATCTTTCGG - Exonic
1139561181 16:67743411-67743433 TGGCCACATTGGCCCTGAGGTGG - Intronic
1139955645 16:70691777-70691799 CACCCAGACTGGCCCTCGGATGG - Intronic
1141029550 16:80575581-80575603 CAGTCACACTGGGCCTGAGGTGG - Intergenic
1141595178 16:85092952-85092974 CCTCCATACAGGCCCTCAGGGGG + Exonic
1141698510 16:85631947-85631969 CAGCCACGCTGCCCCCAAGGCGG - Intronic
1142250496 16:88989681-88989703 CAGCTGCCCTGGCCCTGAGGAGG + Intergenic
1142291503 16:89195506-89195528 CTGCCACACTGACCATGAGGGGG + Intergenic
1142609148 17:1098703-1098725 CTGCCACACTGCCCCTCACTTGG + Intronic
1142710383 17:1720100-1720122 CTGCCACACTGGTCCGCAGCTGG + Intronic
1143670702 17:8393745-8393767 CAGTCACACTGGACCCCAGGAGG + Intronic
1144874573 17:18390653-18390675 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1144874822 17:18391916-18391938 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1144944649 17:18963719-18963741 CAGGGGCACTGGCCCACAGGAGG + Intronic
1145157403 17:20552505-20552527 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1145157656 17:20553768-20553790 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1145759166 17:27416174-27416196 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1145799817 17:27675853-27675875 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1146594078 17:34154838-34154860 CAGCCACACTGGACTTCTGGAGG + Intronic
1146845179 17:36178044-36178066 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146857490 17:36265987-36266009 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146863128 17:36322388-36322410 CAGCCACACAGGCCTGCAGTAGG - Intronic
1146873400 17:36389893-36389915 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146880754 17:36440975-36440997 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1147065992 17:37922980-37923002 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1147076283 17:37990523-37990545 CAGCCACACAGGCCTGCAGTAGG + Intronic
1147077520 17:38002536-38002558 CAGCCACACAGGCCTGCAGTAGG - Intronic
1147087808 17:38070068-38070090 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1147093457 17:38126471-38126493 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1147103750 17:38194017-38194039 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1147589053 17:41669533-41669555 CAGCCACACCAGCCCCCAGCTGG - Intergenic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1149848330 17:60020558-60020580 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1149861839 17:60125966-60125988 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1150086679 17:62277125-62277147 CAGCCACACAGGCCTGCAGTAGG + Intronic
1151716747 17:75834970-75834992 CAGCCACACTGCCCGGCAGCTGG - Exonic
1152008148 17:77695224-77695246 CAACCACACCGGGCCCCAGGAGG + Intergenic
1152575217 17:81136908-81136930 CAGCCGCTCTGACCCTCAGATGG - Intronic
1153107184 18:1541327-1541349 CAGCCCCACAGACCCACAGGTGG - Intergenic
1153799524 18:8657233-8657255 CACCCCCACTGGCCCTCTGAAGG + Intergenic
1154343741 18:13525636-13525658 CAGCCTCACTGGGCTTGAGGAGG + Intronic
1155067460 18:22280075-22280097 CTGCCACTCTGGCCCTGAAGGGG + Intergenic
1155235832 18:23817744-23817766 CAGCCGCACTTTCCCTCAGTTGG + Intronic
1155819975 18:30362480-30362502 CAGCCGCAGAGGTCCTCAGGTGG + Intergenic
1156586180 18:38433682-38433704 CAGCCACCCGGGCTCCCAGGAGG + Intergenic
1157107334 18:44786790-44786812 GAGCCACACGGGACCTAAGGAGG + Intronic
1158395289 18:57074764-57074786 CAGCCACAGTGGCTCCCAGGAGG - Intergenic
1160147761 18:76378780-76378802 CAGCAGCCCTGGCCCTCCGGGGG + Intronic
1160458902 18:79022701-79022723 CAGCCACACTGGCTTTCTCGTGG - Intergenic
1160496647 18:79379996-79380018 CAGCCCCAGAGGCCTTCAGGAGG + Intergenic
1160803861 19:982880-982902 CAGCCCCGCTGGCCGCCAGGTGG - Intergenic
1161084260 19:2327044-2327066 CAGCCTCAAGGGCTCTCAGGAGG - Intronic
1161776163 19:6263391-6263413 CAGCCACAAAGGCCCACAGCAGG + Intronic
1164669215 19:30063339-30063361 CAGCCTCACCTGCCCACAGGCGG + Intergenic
1167379473 19:49130145-49130167 CATCCTCACTGGCCCTAAGACGG + Intronic
1167709691 19:51102762-51102784 CAGCCACACTGGACTTCTTGGGG + Intronic
1168506666 19:56940937-56940959 CAGCCAGAATGCCCCTCAAGAGG - Intergenic
1168529831 19:57119006-57119028 CAGCCGCTCAGGCCCTCAGAGGG + Intergenic
1202647008 1_KI270706v1_random:152466-152488 CGGCCAGACGGACCCTCAGGCGG - Intergenic
925716833 2:6791821-6791843 GACCCACACTGGCCCACAGGTGG + Intergenic
927070543 2:19524387-19524409 CAGCCTTCCTGGCACTCAGGTGG + Intergenic
927295327 2:21446560-21446582 CAGCCACACTGACCTTCTCGAGG + Intergenic
929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG + Intergenic
930104344 2:47628352-47628374 CAGCCACACTGCCTCTGAGGAGG - Intergenic
930186261 2:48415178-48415200 AAACCACACTGGCCATCTGGGGG + Intergenic
931494982 2:62795791-62795813 CAGGAACACTGACCCACAGGGGG - Intronic
931913969 2:66932908-66932930 CAGCCACAATGGCCCTCCTTTGG - Intergenic
932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG + Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
935329685 2:101967833-101967855 CAGCCACAGTGCCCCTGAGCAGG + Intergenic
937055033 2:118927415-118927437 CAGCAATTCAGGCCCTCAGGAGG - Intergenic
937973302 2:127566174-127566196 CAGCCCCACTGCCCCTCAGGGGG - Intronic
938548232 2:132353656-132353678 CGGCCAGGCGGGCCCTCAGGAGG + Intergenic
939576413 2:143900741-143900763 CAGAGACCCAGGCCCTCAGGAGG - Intergenic
939796703 2:146654594-146654616 CAGCTACTCTGGAGCTCAGGTGG + Intergenic
940044278 2:149392529-149392551 CAGCTTCCCTGGTCCTCAGGGGG - Intronic
941653084 2:168114565-168114587 CAGCCTCACTGGCCCTGGGCTGG - Intronic
943483633 2:188454005-188454027 CAGCCATACGGGTCCCCAGGTGG - Intronic
944271145 2:197786110-197786132 CAGCCACCCTCGCCGCCAGGGGG - Exonic
945141106 2:206686940-206686962 CATCCACTCTGCTCCTCAGGAGG - Intronic
948284912 2:236776472-236776494 CAGCTACACTTGCCCTTATGAGG - Intergenic
948368633 2:237474181-237474203 CAGCCACAGTGGCCCCAAGTTGG + Intergenic
948626047 2:239268671-239268693 CAGGGACACAGCCCCTCAGGAGG + Intronic
1169088832 20:2844824-2844846 CAGCCACACTGGCTCTCTTTAGG - Intronic
1169955645 20:11099791-11099813 CAGCCACACTGGGGCTTATGGGG - Intergenic
1170612379 20:17925316-17925338 CAGCCTCAATGTCCCACAGGAGG - Intergenic
1170927304 20:20737169-20737191 CAGCTTCCCTGCCCCTCAGGAGG - Intergenic
1172273121 20:33665638-33665660 CAACCAAACTGGTCCTCAGGAGG + Intronic
1172665087 20:36593533-36593555 CTTCCCCACTGGGCCTCAGGAGG - Exonic
1173792232 20:45834970-45834992 CTGCCCCACTGCCCATCAGGTGG - Exonic
1174181670 20:48679009-48679031 CAGGCACAAAGGCCCTAAGGTGG + Intronic
1175092534 20:56516868-56516890 CAGCCACACTGACGCTGAAGTGG + Intronic
1175593121 20:60209207-60209229 GAGCCACCCTGGCTCTCTGGAGG - Intergenic
1175753917 20:61517306-61517328 CAGCTACACAGCCCCACAGGAGG - Intronic
1175828652 20:61950608-61950630 CAGCCACCCTGGACCTGTGGAGG + Intergenic
1176261786 20:64185702-64185724 CAGCCACGGTCGCCCGCAGGGGG + Intronic
1177703844 21:24674543-24674565 CAGTGAAACTGGCCCTCAGCAGG - Intergenic
1178294060 21:31394096-31394118 CAGCCACAATGTCCTTCAGCAGG + Intronic
1178690205 21:34744127-34744149 CAAGCTCACTGGCCCACAGGAGG + Intergenic
1179412479 21:41172869-41172891 CAGAAACACTGTCCCTCCGGAGG + Intronic
1179910675 21:44446147-44446169 CGGCCACGCAGGCCTTCAGGTGG + Intergenic
1179910688 21:44446213-44446235 CGGCCACGCAGGCCTTCAGGTGG + Intergenic
1179925490 21:44531865-44531887 TAGCCACGCTGTCCCTCAGCGGG - Intronic
1180354901 22:11830003-11830025 CGGCCAGGCGGGCCCTCAGGCGG + Intergenic
1180383350 22:12162328-12162350 CGGCCAGGCGGGCCCTCAGGCGG - Intergenic
1180595429 22:16969952-16969974 CAGCCTCACAGGCTCTGAGGCGG - Exonic
1180816483 22:18792719-18792741 CAGACACACTGTCCCAGAGGTGG + Intergenic
1180960962 22:19762162-19762184 CAGGCACACAGGCCCTCCTGAGG + Intronic
1180983041 22:19888308-19888330 CAGCCAGCCTGGCCCCAAGGAGG + Intronic
1181038224 22:20179964-20179986 CAGCCAAACTGGTCCCCAGCTGG + Intergenic
1181202670 22:21227051-21227073 CAGACACACTGTCCCAGAGGTGG + Intronic
1181335222 22:22124125-22124147 GAGCCACAGTGGCCCACAGCGGG + Intergenic
1181363775 22:22358178-22358200 CAGCCTCCCTGGCCATCAGTGGG + Intergenic
1181366589 22:22381263-22381285 CAGCCTCCCTGGCCATCAGTGGG + Intergenic
1181372950 22:22432381-22432403 CAGCCTCCCTGGCCATCAGTGGG + Intergenic
1181430932 22:22881313-22881335 CAGCCACTCTGACCATCAGCGGG + Intronic
1181699031 22:24609554-24609576 CAGACACACTGTCCCAGAGGTGG - Intronic
1182049791 22:27303931-27303953 CAGCCACACTGGCACTTTGTTGG - Intergenic
1182083242 22:27543713-27543735 CAGCCACACTGGTGTCCAGGTGG + Intergenic
1183700792 22:39449881-39449903 CAGCACCCCTGGCCCTCATGGGG + Intergenic
1183999313 22:41660698-41660720 CAGGCACACTGGAACACAGGAGG - Intronic
1184161495 22:42700040-42700062 CACCAACACTGGCCCGCAGTGGG + Intronic
1185272960 22:49937050-49937072 CAGCCACACTGACCCTGAGGAGG - Intergenic
1185293309 22:50039766-50039788 CATCCACACTGGCACACATGAGG - Intronic
1185376815 22:50486515-50486537 CTGCCCCACTGGATCTCAGGAGG - Intergenic
1203224243 22_KI270731v1_random:68362-68384 CAGACACACTGTCCCAGAGGTGG - Intergenic
1203266583 22_KI270734v1_random:18430-18452 CAGACACACTGTCCCAGAGGTGG + Intergenic
949700199 3:6747563-6747585 CTGCCTCACTGTCCCTGAGGAGG + Intergenic
950032527 3:9862258-9862280 CAGACACGCTGGCCCCCGGGTGG - Intergenic
950124151 3:10501311-10501333 AAGCCACACTGCCCAGCAGGAGG + Intronic
950415633 3:12867578-12867600 CAGACACGCTGGCCCCCGGGTGG - Intronic
950454261 3:13083342-13083364 CTGCCACACTGCCTCTCAGTGGG - Intergenic
951843250 3:27057977-27057999 CAGCTGCACTTGCCCTCAGTGGG + Intergenic
951864940 3:27297805-27297827 CTGCCACAGTGGCTGTCAGGAGG - Intronic
954008203 3:47610182-47610204 CAGGCACACCAGCACTCAGGAGG - Exonic
954713810 3:52517372-52517394 CATCCCCACTGGCCCCCAGCAGG + Exonic
955059810 3:55485096-55485118 CAGCGAAACTGGTCCTCTGGGGG + Intronic
956682099 3:71790451-71790473 CTGCCACACTGCCCCCCTGGAGG + Intergenic
958722852 3:97866892-97866914 CAGTCAAACTGGCAGTCAGGTGG - Intronic
960416918 3:117396538-117396560 CAGCCACAGAGGCTCTGAGGTGG - Intergenic
961509369 3:127391666-127391688 CAGCTACAGGGGCTCTCAGGAGG - Intergenic
961609801 3:128127593-128127615 CACACACAGTAGCCCTCAGGAGG - Intronic
961713949 3:128846343-128846365 CAGACACGCTGGCCCCCTGGTGG + Intergenic
961741152 3:129033899-129033921 CAGCCACAGTGGCCTCCTGGCGG - Intronic
961785254 3:129343583-129343605 CAGACACGCTGGCCCCCAGTGGG - Intergenic
962146298 3:132843526-132843548 CTGCCACACTAGCACTCAGAGGG - Intergenic
966922134 3:184619403-184619425 CAGCCTCTCTGAACCTCAGGAGG - Intronic
967010936 3:185432886-185432908 CAGCAACACCAGCCCTCAGTAGG - Intronic
967219085 3:187234354-187234376 CAGCCTCTCTGGCCCTCACAGGG - Exonic
968739330 4:2319448-2319470 CAGCACCTCTGGCCCTCATGGGG + Intronic
968928983 4:3566102-3566124 TGGCCACACTGCCCCTGAGGTGG + Intergenic
969102137 4:4777219-4777241 CAGCCACACTGGCCTTCAAGTGG - Intergenic
969442466 4:7225620-7225642 CAACCACACTGGAGCTCAAGTGG - Intronic
973373260 4:49270629-49270651 CGGCCAGGCGGGCCCTCAGGCGG - Intergenic
973387746 4:49524579-49524601 CGGCCAGGCGGGCCCTCAGGCGG + Intergenic
974072024 4:57132581-57132603 CAGACCCATTGGCCCACAGGTGG - Intergenic
979596932 4:122544478-122544500 CAGCCATACTGGCCTTGAGAAGG - Intergenic
982203038 4:152976624-152976646 CAGCCCCTCTGGCCTTCAGAGGG - Exonic
984172858 4:176381526-176381548 AAGCCACCCTGGGCCTCATGTGG - Intergenic
985393376 4:189514947-189514969 CAGGGACACAGGCCCTCAGGAGG - Intergenic
985590265 5:760927-760949 CAACCACACAGACCCCCAGGTGG + Intronic
987092661 5:14521903-14521925 CAGCCACGCTGGGCCCCATGAGG - Intronic
994774687 5:104027087-104027109 CAGCCACAGTGTCCCAAAGGAGG - Intergenic
998040068 5:138946117-138946139 CAGCCCCTCCGGCCCCCAGGTGG - Intergenic
1000550551 5:162657322-162657344 GAGTCACACTGCTCCTCAGGTGG - Intergenic
1001568086 5:172713389-172713411 CAGACACCCTGCCTCTCAGGGGG + Intergenic
1001571420 5:172732822-172732844 CTGCCTCACTGGCTTTCAGGTGG + Intergenic
1001754559 5:174158675-174158697 GAGCAACACTGGCCCTCAGCTGG + Intronic
1002274271 5:178094290-178094312 CAGTCACACTGGCCCACCGCAGG - Intergenic
1002461671 5:179376890-179376912 GAGCCACGGTGACCCTCAGGTGG + Intergenic
1002704260 5:181149450-181149472 CAGCCCCACTGGCCATCTGGGGG + Intergenic
1004516715 6:16327398-16327420 CAGCCACTTTGTCCCTCGGGAGG - Exonic
1005934013 6:30506301-30506323 CAGTAACAGAGGCCCTCAGGAGG + Intergenic
1006509355 6:34513529-34513551 CACCCACACTGTCCCTCCTGGGG + Intronic
1006604724 6:35247985-35248007 GAGCCACACTGGCCTTCTGGAGG - Intronic
1006643689 6:35501948-35501970 CAGCCACACTGGTCACCTGGTGG + Intronic
1006749057 6:36365226-36365248 CAGAGGCTCTGGCCCTCAGGAGG + Intronic
1007725498 6:43913444-43913466 CAGCCCCTCTGACCCTCTGGGGG - Intergenic
1013819420 6:114136613-114136635 CAGACAAACTGGCCCTTCGGGGG - Intronic
1017423501 6:154296927-154296949 CAGCCACAGTGGAAGTCAGGAGG + Intronic
1018229393 6:161661359-161661381 CAGACACACAGGCCCTGAGATGG - Intronic
1019522889 7:1468558-1468580 GAGGCAGCCTGGCCCTCAGGAGG + Intergenic
1019772404 7:2891800-2891822 CAGCCACACTGGCCCCCTGTTGG - Intergenic
1020107239 7:5427822-5427844 CAGCCACACGGCCTCTCAGCTGG - Intergenic
1022271135 7:28809229-28809251 CAGCCACCCCAGCCCACAGGGGG + Exonic
1023855794 7:44182990-44183012 CCTCCCCACTGGCCCTCAGCTGG + Intronic
1024036125 7:45509063-45509085 CAGCCTCAATGGCCCACATGGGG - Intergenic
1024764556 7:52641718-52641740 CAGCTACACTGCCTCTCGGGTGG + Intergenic
1026760797 7:73124306-73124328 CATCCAGGCTGGCCATCAGGGGG + Intergenic
1026850733 7:73721684-73721706 CAGACACACTGGGCAGCAGGGGG - Intergenic
1026910760 7:74090553-74090575 CAGCCAGGCTGGCTCTCAGTGGG + Intronic
1026933601 7:74238855-74238877 CAGCCCCACTGGCCCCCACAGGG + Intronic
1027037140 7:74933101-74933123 CATCCAGGCTGGCCATCAGGGGG + Intergenic
1027086423 7:75268350-75268372 CATCCAGGCTGGCCATCAGGGGG - Intergenic
1027270524 7:76516130-76516152 CATGCACACTGGCCGTGAGGCGG - Intronic
1027706311 7:81537575-81537597 CAGCCAAAATGGCCTTCAGTAGG - Intergenic
1028453051 7:91007174-91007196 CAGTAACACTGGCACTAAGGTGG - Intronic
1028802299 7:94980260-94980282 AAGCCACCCTGGGCCTCATGCGG + Intronic
1029392725 7:100286373-100286395 CATCCAGGCTGGCCATCAGGGGG - Intergenic
1032223049 7:130008727-130008749 GTGCCCCACTGGTCCTCAGGGGG - Intergenic
1033549291 7:142431950-142431972 CAGTGACACTGGCCATCAGAAGG + Intergenic
1034699320 7:153082972-153082994 CAGCCACACTGCCGCGCAGCAGG + Intergenic
1035202884 7:157278331-157278353 CAGACAGACAGGCCCACAGGTGG + Intergenic
1035372506 7:158388325-158388347 CATCTGCACTGGCCCTCATGGGG - Intronic
1035697869 8:1614027-1614049 CAGCGAAAATGGGCCTCAGGAGG + Intronic
1036110874 8:5900587-5900609 CAGTCTCACTGTCCCCCAGGCGG - Intergenic
1037605124 8:20431786-20431808 CAGCCACACTGGCCTTCTTCTGG + Intergenic
1037946678 8:22994004-22994026 CAGCCATGCTGGCCATCAGCTGG + Intronic
1038395552 8:27243150-27243172 CAGACACACGGGCCCCAAGGCGG - Intronic
1039899561 8:41741390-41741412 CAGACACACTGGCCCACACTTGG + Intronic
1042242038 8:66673795-66673817 CAGCCACACTGGCCTCCTTGTGG + Intronic
1042687813 8:71461782-71461804 CAGCCAGGGTGTCCCTCAGGGGG + Intronic
1044866062 8:96572338-96572360 CAGACTCACTGGTCCTCAGCAGG - Intronic
1045935874 8:107678132-107678154 CAGCCACACTAGCCTTCTTGTGG - Intergenic
1046238490 8:111459272-111459294 CACCCACACTGTCCCTCTGCTGG - Intergenic
1047083081 8:121485948-121485970 CAGCCACTCTAGCCTTCAGGAGG - Intergenic
1047721557 8:127644877-127644899 CATCCACAATGGCCCTGGGGTGG - Intergenic
1048564584 8:135581955-135581977 CCGACTCACTGGCCCTCGGGTGG - Exonic
1049213448 8:141397111-141397133 GAGCCGCTCTGGCCCTGAGGAGG - Intronic
1049229956 8:141476827-141476849 CTGCCACCCTGGCCCTCTGCGGG + Intergenic
1049299692 8:141862978-141863000 CAGCCCAACTGGGCCTCAGCTGG - Intergenic
1052840575 9:33288932-33288954 CAGCCCCGCTGGCCCACTGGGGG + Intergenic
1053483718 9:38436228-38436250 CAGCCCCACTGTCCATAAGGTGG + Intergenic
1053752648 9:41273032-41273054 CGGCCAGGCAGGCCCTCAGGCGG - Intergenic
1053803691 9:41779686-41779708 TGGCCACACTGCCCCTGAGGTGG + Intergenic
1054141579 9:61535437-61535459 TGGCCACACTGCCCCTGAGGTGG - Intergenic
1054191990 9:61991078-61991100 TGGCCACACTGCCCCTGAGGTGG + Intergenic
1054258176 9:62837384-62837406 CGGCCAGGCAGGCCCTCAGGCGG - Intergenic
1054351624 9:64021413-64021435 CGGCCAGGCGGGCCCTCAGGCGG + Intergenic
1054461276 9:65466160-65466182 TGGCCACACTGCCCCTGAGGTGG - Intergenic
1054646389 9:67596712-67596734 TGGCCACACTGCCCCTGAGGTGG - Intergenic
1056292698 9:85159928-85159950 CTGCAACACTGTCCTTCAGGTGG - Intergenic
1056756634 9:89385844-89385866 CATCCACGCTGGCCTTTAGGGGG - Intronic
1057684687 9:97221747-97221769 CGGCCAGGCGGGCCCTCAGGCGG - Intergenic
1058641192 9:107087209-107087231 CAGCAACAGTTGTCCTCAGGGGG + Intergenic
1059829889 9:118083453-118083475 CAGCCAGGGTGGCGCTCAGGGGG + Intergenic
1060035574 9:120252766-120252788 CAGCCACACTGGCATTCTGTTGG - Intergenic
1060216467 9:121741420-121741442 AAGCCACACAGGCTGTCAGGAGG - Intronic
1060530937 9:124346696-124346718 GGGCCACAGTGGCCCTGAGGCGG - Intronic
1062036274 9:134384062-134384084 CCTCCACACTGTCACTCAGGTGG + Intronic
1062194041 9:135263545-135263567 CAGCCTCGCTGGCCCTCACTGGG + Intergenic
1062440363 9:136566917-136566939 CAGCCACTCAGGCCCCAAGGAGG + Intergenic
1062611197 9:137374382-137374404 CAGCCTCCCTGGGCCTCTGGGGG - Intronic
1203696972 Un_GL000214v1:108632-108654 CGGCCAGGCGGGCCCTCAGGCGG - Intergenic
1203552241 Un_KI270743v1:172397-172419 CGGCCAGGCGGGCCCTCAGGCGG + Intergenic
1188991095 X:36822007-36822029 CAGCTACTCTGGAGCTCAGGAGG - Intergenic
1191190954 X:57666645-57666667 CAGTGACCATGGCCCTCAGGAGG - Intergenic
1192502776 X:71664512-71664534 CAGCCACACTGGCCCTCCGAGGG - Intergenic
1192529109 X:71871016-71871038 CAGCCACACTGGCCCTCCCAGGG - Intergenic
1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG + Intergenic
1200067158 X:153509430-153509452 CACCCCCACTGGCCCACTGGTGG + Exonic