ID: 1148078464 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:44953801-44953823 |
Sequence | CATTCTGCAGGCAACAGAGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148078461_1148078464 | 27 | Left | 1148078461 | 17:44953751-44953773 | CCATCTCAACAACAACAACAACA | 0: 449 1: 1000 2: 942 3: 2768 4: 7033 |
||
Right | 1148078464 | 17:44953801-44953823 | CATTCTGCAGGCAACAGAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148078464 | Original CRISPR | CATTCTGCAGGCAACAGAGT AGG | Intergenic | ||
No off target data available for this crispr |