ID: 1148078464

View in Genome Browser
Species Human (GRCh38)
Location 17:44953801-44953823
Sequence CATTCTGCAGGCAACAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148078461_1148078464 27 Left 1148078461 17:44953751-44953773 CCATCTCAACAACAACAACAACA 0: 449
1: 1000
2: 942
3: 2768
4: 7033
Right 1148078464 17:44953801-44953823 CATTCTGCAGGCAACAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148078464 Original CRISPR CATTCTGCAGGCAACAGAGT AGG Intergenic
No off target data available for this crispr