ID: 1148081015

View in Genome Browser
Species Human (GRCh38)
Location 17:44967793-44967815
Sequence CGGCCCTCCGGGGCCTCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 494}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148081015_1148081026 -3 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081026 17:44967813-44967835 CCGGGCTTGCCGGTGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 128
1148081015_1148081024 -8 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081024 17:44967808-44967830 GAGGGCCGGGCTTGCCGGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 219
1148081015_1148081029 8 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081029 17:44967824-44967846 GGTGCGGCCCGGCTTCCCCTGGG 0: 1
1: 0
2: 3
3: 11
4: 135
1148081015_1148081031 10 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081031 17:44967826-44967848 TGCGGCCCGGCTTCCCCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 143
1148081015_1148081038 30 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081038 17:44967846-44967868 GGGCCCTGCACCAGCGTGGAAGG 0: 2
1: 0
2: 1
3: 16
4: 189
1148081015_1148081028 7 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081028 17:44967823-44967845 CGGTGCGGCCCGGCTTCCCCTGG 0: 1
1: 0
2: 2
3: 6
4: 135
1148081015_1148081030 9 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081030 17:44967825-44967847 GTGCGGCCCGGCTTCCCCTGGGG 0: 1
1: 0
2: 2
3: 8
4: 149
1148081015_1148081037 26 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081037 17:44967842-44967864 CTGGGGGCCCTGCACCAGCGTGG 0: 2
1: 0
2: 1
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148081015 Original CRISPR CGGCCCTCCGGGGCCTCCCG GGG (reversed) Exonic