ID: 1148081015

View in Genome Browser
Species Human (GRCh38)
Location 17:44967793-44967815
Sequence CGGCCCTCCGGGGCCTCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 494}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148081015_1148081028 7 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081028 17:44967823-44967845 CGGTGCGGCCCGGCTTCCCCTGG 0: 1
1: 0
2: 2
3: 6
4: 135
1148081015_1148081029 8 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081029 17:44967824-44967846 GGTGCGGCCCGGCTTCCCCTGGG 0: 1
1: 0
2: 3
3: 11
4: 135
1148081015_1148081031 10 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081031 17:44967826-44967848 TGCGGCCCGGCTTCCCCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 143
1148081015_1148081026 -3 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081026 17:44967813-44967835 CCGGGCTTGCCGGTGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 128
1148081015_1148081038 30 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081038 17:44967846-44967868 GGGCCCTGCACCAGCGTGGAAGG 0: 2
1: 0
2: 1
3: 16
4: 189
1148081015_1148081024 -8 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081024 17:44967808-44967830 GAGGGCCGGGCTTGCCGGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 219
1148081015_1148081030 9 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081030 17:44967825-44967847 GTGCGGCCCGGCTTCCCCTGGGG 0: 1
1: 0
2: 2
3: 8
4: 149
1148081015_1148081037 26 Left 1148081015 17:44967793-44967815 CCCCGGGAGGCCCCGGAGGGCCG 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1148081037 17:44967842-44967864 CTGGGGGCCCTGCACCAGCGTGG 0: 2
1: 0
2: 1
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148081015 Original CRISPR CGGCCCTCCGGGGCCTCCCG GGG (reversed) Exonic
900387678 1:2417943-2417965 GTGCCCTCCGGGGCCTGCCTCGG + Intergenic
900545100 1:3224389-3224411 GGGCGCACCGGGGCCTCCAGAGG - Intronic
901202030 1:7472525-7472547 CTGCCCTCCGCTGCCTCCCCTGG + Intronic
901227682 1:7623739-7623761 CCGCCCGCCTCGGCCTCCCGAGG + Intronic
901628205 1:10635296-10635318 AGGCCCTGGTGGGCCTCCCGTGG - Intergenic
901734942 1:11306331-11306353 CCGCCATCCTCGGCCTCCCGAGG - Intergenic
901770388 1:11527304-11527326 CCGCCCACCTCGGCCTCCCGAGG - Intronic
903792702 1:25905901-25905923 CGGCGCTCCCGGGCCCCACGAGG - Intronic
904317291 1:29673720-29673742 TGGCCCTCCTGGGCATCCTGGGG + Intergenic
904574416 1:31494409-31494431 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
904831774 1:33310056-33310078 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
904930178 1:34081661-34081683 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
905039906 1:34947670-34947692 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
905653558 1:39672001-39672023 CGGGGCTCCTGGGGCTCCCGGGG + Exonic
905995889 1:42380553-42380575 CGGGTGTCCGGGGCCTGCCGGGG + Intergenic
906805553 1:48776534-48776556 CGGGCCCCCGGCCCCTCCCGGGG + Intronic
908147354 1:61260821-61260843 CTGCCCACCTCGGCCTCCCGAGG + Intronic
910374632 1:86554506-86554528 CTGCCCACCGCGGCCTCCCAAGG + Intronic
912140559 1:106720518-106720540 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
912355643 1:109052893-109052915 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
912358300 1:109073608-109073630 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
912802444 1:112728587-112728609 CTGCCCGCCTTGGCCTCCCGAGG + Intergenic
913451896 1:118998268-118998290 GAGCCCTCAGGGGCCTCCCAGGG - Intergenic
913661801 1:121011193-121011215 AGGTCCTCCCGGTCCTCCCGTGG + Intergenic
914013174 1:143794373-143794395 AGGTCCTCCCGGTCCTCCCGTGG + Intergenic
914164652 1:145166812-145166834 AGGTCCTCCCGGTCCTCCCGTGG - Intergenic
914651798 1:149702982-149703004 AGGTCCTCCCGGTCCTCCCGTGG + Exonic
915680938 1:157581592-157581614 CAGCCCTCCAGTGGCTCCCGCGG + Exonic
915992487 1:160531649-160531671 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
916107710 1:161443036-161443058 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916109294 1:161450409-161450431 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916110881 1:161457840-161457862 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916112467 1:161465200-161465222 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916114052 1:161472617-161472639 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916717258 1:167455957-167455979 CGTCTCTCCGGGGCTTCCCAAGG - Intronic
918172362 1:182010469-182010491 CTGCCCACCTGGGCCTCCCGAGG + Intergenic
918304756 1:183235734-183235756 CGTTCCTACGGGTCCTCCCGTGG + Intronic
918601980 1:186375157-186375179 CCGCCCGCCGGAGACTCCCGCGG + Exonic
919992471 1:202718051-202718073 CTGCCCTCAGGGGCCTGCTGGGG - Intergenic
921109036 1:212014786-212014808 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
921142811 1:212321940-212321962 CCGCCAGCCTGGGCCTCCCGAGG - Intronic
921192663 1:212724488-212724510 CTGCCCACCTCGGCCTCCCGAGG + Intergenic
921265692 1:213418910-213418932 CGGCTCACCGGGGTCTCCTGGGG + Intergenic
922505154 1:226121926-226121948 CGCCCCTCCGCGGGCTCCCCAGG - Intergenic
922644769 1:227275845-227275867 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
922950906 1:229558226-229558248 CGGGCCGGCGGCGCCTCCCGGGG - Exonic
923631587 1:235652102-235652124 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
924554160 1:245104258-245104280 CTGCCCGCCTGGGCCTCCCAAGG - Intronic
924800926 1:247329391-247329413 AGGCGCTGCAGGGCCTCCCGGGG + Exonic
1062855635 10:778246-778268 TGGGCCTGTGGGGCCTCCCGGGG - Intergenic
1063079276 10:2749893-2749915 CAGCCCTCCTCGGCCTCCCAAGG - Intergenic
1063974067 10:11401507-11401529 CGGCCCTCCCTGGCTCCCCGGGG + Intergenic
1064208831 10:13347403-13347425 CGGGCCTGCTGGGCCTTCCGAGG - Intronic
1064221105 10:13440611-13440633 CTGCCCCCCGCCGCCTCCCGCGG - Intronic
1064999089 10:21320890-21320912 CGGCCCTCCTCGGCCTCCCAGGG - Intergenic
1066115351 10:32234026-32234048 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1066141355 10:32506606-32506628 CTGCCCCCCTCGGCCTCCCGAGG - Intronic
1066325249 10:34352588-34352610 CTGCCCACCTGGGCCTCCCGAGG + Intronic
1066572742 10:36791120-36791142 CCGCCCGCCTGGGCCTCCCAAGG - Intergenic
1066599046 10:37084318-37084340 CCGCCCGCCTCGGCCTCCCGCGG - Intergenic
1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG + Intronic
1069651606 10:70053444-70053466 CGGCCCTCCCCGGGCTCCCTCGG - Intronic
1070132773 10:73666334-73666356 CGGCCCTCTTGGGCCTACTGTGG - Intergenic
1071608905 10:87017740-87017762 CGGCCCTCTTGGGCCCACCGTGG + Intergenic
1072591818 10:96833336-96833358 CGGCCGCCCGGCCCCTCCCGGGG - Intronic
1072656110 10:97331628-97331650 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
1073176751 10:101561540-101561562 TGGGCCTCCGGGGGCTCCCAAGG + Intergenic
1073537580 10:104291628-104291650 CGTCCCTCTGGGGGCGCCCGAGG + Intronic
1074469493 10:113714498-113714520 CTGCCCACCTCGGCCTCCCGAGG - Intronic
1074913330 10:117932120-117932142 CGGCCCACCTCGGCCTCCCAAGG - Intergenic
1075132083 10:119748730-119748752 AGGCCGTCCGTGGCCTCCCATGG - Intronic
1075144457 10:119872145-119872167 CGGCTCTGCGGGCCCTCCCCAGG + Intronic
1075597574 10:123743260-123743282 CGGCCCTCCTGGGACCCACGTGG + Intronic
1075893037 10:125970567-125970589 CTGCCCACCTCGGCCTCCCGAGG - Intronic
1076116933 10:127907360-127907382 CGGCCTGCTTGGGCCTCCCGGGG - Intronic
1076157032 10:128212105-128212127 AGGCCCCGCTGGGCCTCCCGCGG - Intergenic
1076161570 10:128247778-128247800 CGGCCCTCAGGCACCTCCCGGGG + Intergenic
1076792327 10:132784166-132784188 CGGAGCGGCGGGGCCTCCCGTGG - Intergenic
1076807781 10:132867794-132867816 CGGCCCCGCTGTGCCTCCCGCGG + Intronic
1077040094 11:517091-517113 CTGCCCGCCTCGGCCTCCCGGGG + Intergenic
1077495393 11:2884582-2884604 CAGCCCTCGGGGGCCTCGCTGGG - Intronic
1077637655 11:3854936-3854958 TGGCCCTCGTGGGCCTCCCCCGG + Intronic
1079296069 11:19235403-19235425 CCGCCCTCCTCGGCCTCCCAAGG - Intronic
1080538271 11:33243329-33243351 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1082166574 11:48956279-48956301 CTGCCCGCCTGGGCCTCTCGAGG - Intergenic
1084595842 11:70116590-70116612 CCGGCCTCCAGGGCCTCCCCAGG + Intronic
1084785179 11:71437975-71437997 CGGCCCTCCTGGGGCCCCCATGG + Intronic
1085159556 11:74328048-74328070 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1085666205 11:78417588-78417610 GGGCGCTCCGGGGCCTGCGGAGG - Intronic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1086818149 11:91399777-91399799 CAGCCCACCTGGGCCTCCCAAGG + Intergenic
1087227858 11:95624024-95624046 CCGCCCTCCTCAGCCTCCCGTGG - Intergenic
1088250598 11:107858355-107858377 CGGTCCTCTGGGGCGTTCCGCGG - Intronic
1088829572 11:113523901-113523923 CTGCCCGCCTTGGCCTCCCGAGG + Intergenic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1089189462 11:116643679-116643701 CGGCCCACCGGAGGCTCCTGCGG - Intergenic
1090207809 11:124895605-124895627 CGGAGCTCCCTGGCCTCCCGGGG + Exonic
1091547121 12:1508692-1508714 CCGCCCGCCTGGGCCTCCCAAGG - Intergenic
1092361528 12:7840627-7840649 CCGCCCACCTGGGCCTCCCAAGG + Intronic
1092850122 12:12618783-12618805 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
1093006806 12:14060015-14060037 CAGCCCTCCTGTGCTTCCCGAGG + Intergenic
1095774766 12:45999902-45999924 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1096054685 12:48641607-48641629 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1096983639 12:55743172-55743194 CGGCCCCCCGGGTCCCCCCTCGG + Intergenic
1097089717 12:56495116-56495138 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1097228734 12:57495753-57495775 CTGCCCGCCTGGGCCTCCTGAGG - Intronic
1097460935 12:59860825-59860847 CTGCCCTCCTTGGCCTCCCAAGG + Intergenic
1098023015 12:66174660-66174682 CTGCCCGCCTCGGCCTCCCGGGG + Intergenic
1098379659 12:69854099-69854121 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1102394576 12:112575275-112575297 CGTCCCTCCGCCGCCTCCAGCGG - Intronic
1102656392 12:114485368-114485390 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1103045274 12:117730751-117730773 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1103415460 12:120739529-120739551 CGGCCCGGCGGGGGCTCCCTGGG + Exonic
1105416871 13:20220922-20220944 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1105577873 13:21670132-21670154 CTGCCCTGCGGGGCCGCACGTGG - Intergenic
1105926570 13:25014139-25014161 CCGCCCACCTCGGCCTCCCGAGG + Intergenic
1106208649 13:27621472-27621494 CGGCCCTCCCGGGCCTTTTGTGG - Exonic
1107562999 13:41573863-41573885 CTGCCCGCCTCGGCCTCCCGGGG + Intronic
1107737838 13:43416963-43416985 CTGCCCGCCCCGGCCTCCCGAGG - Intronic
1108688873 13:52845613-52845635 CAGCCCTACGGTGCCTCCCCGGG - Exonic
1111230731 13:85341259-85341281 CTGCCCACCTCGGCCTCCCGAGG - Intergenic
1113329006 13:109311141-109311163 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1113539501 13:111095229-111095251 CAGCCCTCCGCAGCCTCCGGAGG - Intergenic
1114178459 14:20344567-20344589 CTGCCCTCCTCGGCCTCCCAAGG - Intronic
1114578639 14:23736572-23736594 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1114594430 14:23898957-23898979 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1115027183 14:28759196-28759218 TGGGCCTCCTGGGCCCCCCGCGG - Intergenic
1116502015 14:45634760-45634782 CTGCCCGCCTCGGCCTCCCGGGG + Intergenic
1117524099 14:56579975-56579997 CGGCGCTCCGGGGGCATCCGCGG + Exonic
1118381982 14:65224958-65224980 GTTCCCTCTGGGGCCTCCCGTGG + Intergenic
1118517859 14:66546523-66546545 CGGCCAGCCTCGGCCTCCCGAGG - Intronic
1119051951 14:71377729-71377751 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1119261015 14:73238003-73238025 CGGCCACCCCGGGCCTCCCGTGG + Intronic
1121368034 14:93332675-93332697 CGGCGCCCCAGCGCCTCCCGCGG + Intronic
1121648005 14:95534483-95534505 CGGCGCTCCGGAGGCGCCCGGGG + Intronic
1122177230 14:99929972-99929994 TGGCCCTCCTGGGCCTTCCCAGG + Intronic
1122228300 14:100292303-100292325 CGCCCCTGCGGGGCCTGCCCTGG - Exonic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122234067 14:100322348-100322370 GAGCCCTCTGGGGCCTCCCCAGG + Intergenic
1122582352 14:102778224-102778246 CGGCCCTCGGCGGCCGCGCGAGG - Intronic
1122857653 14:104567525-104567547 GGGCCCTCCGGGGCCTGAGGTGG + Intronic
1122971242 14:105153078-105153100 AGGCCCTGCCGGGACTCCCGGGG + Intronic
1202881837 14_KI270722v1_random:67726-67748 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1123470934 15:20551500-20551522 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123647124 15:22449200-22449222 CCGCCCGCCACGGCCTCCCGGGG - Intergenic
1123722014 15:23068417-23068439 CCGCCCTCCTCGGCCTCCGGGGG + Intergenic
1123731237 15:23146488-23146510 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123749375 15:23343903-23343925 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123752994 15:23373019-23373041 CCGCCCGCCTCGGCCTCCCGGGG - Intergenic
1123753103 15:23373616-23373638 CCGCCCGCCTCGGCCTCCCGGGG - Intergenic
1123834329 15:24172486-24172508 CCGCCCTCCTCGGCCTCCCATGG + Intergenic
1124169351 15:27358963-27358985 CGCCCCGCCGGGTCCTCCCCAGG - Intronic
1124281746 15:28367780-28367802 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1124300957 15:28543824-28543846 CCGCCCGCCACGGCCTCCCGGGG - Intergenic
1124584458 15:30991931-30991953 CGGCCCGCGGGGGCCTACGGCGG + Intergenic
1124629161 15:31327291-31327313 CGGGACTCCGGCCCCTCCCGCGG - Exonic
1125575932 15:40755356-40755378 CGCCCCTCCGGCGGCGCCCGTGG - Exonic
1125834447 15:42737146-42737168 CGCCCCTCCCTGGCCGCCCGCGG - Intergenic
1126703380 15:51386537-51386559 CGGCCCTCTGGGGCTTCTCATGG - Intronic
1126752040 15:51886419-51886441 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1127023937 15:54781849-54781871 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1127088885 15:55447528-55447550 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1127606540 15:60592609-60592631 CGCCCCTCCGCTTCCTCCCGGGG + Intronic
1128343948 15:66842283-66842305 CTGCCCTCCCCAGCCTCCCGCGG - Intergenic
1128496314 15:68200511-68200533 TGGCCTTCCTGGGCCTCCCAGGG - Intronic
1128500021 15:68221473-68221495 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1128725625 15:69986582-69986604 TGGACCCCAGGGGCCTCCCGTGG + Intergenic
1128982421 15:72197411-72197433 GGGCCATGCGGGGCGTCCCGAGG + Intronic
1129223864 15:74153992-74154014 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1129267469 15:74401669-74401691 CCTCCCTCTGGGGCCTCCTGTGG + Intergenic
1129382831 15:75178621-75178643 CGGCCCCCAGGCGCCGCCCGTGG - Intergenic
1129589094 15:76899405-76899427 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1130071026 15:80647197-80647219 CGGCCAGCCTCGGCCTCCCGAGG + Intergenic
1130942567 15:88523682-88523704 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1131257338 15:90871442-90871464 CGGCCCTGCGGGGCCTTCTGGGG - Intronic
1131484655 15:92809592-92809614 AGGCCCTGCGGGGAATCCCGCGG + Intronic
1131511404 15:93051344-93051366 CGGCCCACCGGTGCCCCCTGGGG - Intronic
1132484124 16:181382-181404 CCGCCGCCCGGGGCGTCCCGCGG - Intergenic
1132622940 16:876227-876249 CTGCCCTCCGCGGCCGCGCGTGG - Intronic
1132642343 16:983577-983599 GTGCGCTCCGGAGCCTCCCGTGG - Intronic
1133011100 16:2912218-2912240 CGGCTCTCCCGGGGGTCCCGAGG + Intronic
1133802033 16:9092026-9092048 CCATCCTCCGCGGCCTCCCGCGG - Exonic
1134750263 16:16619594-16619616 CTGCCCGCCTGGGCCTCCCAAGG - Intergenic
1134995195 16:18734004-18734026 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1135240412 16:20802096-20802118 CTGCCCACCTTGGCCTCCCGAGG - Intronic
1135683315 16:24477560-24477582 CCTCCCTCCTGGGCCTCCCAAGG + Intergenic
1135694648 16:24575515-24575537 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1136995790 16:35187397-35187419 CTGCCCTCCTTGGCCTCCCAGGG - Intergenic
1137439169 16:48483599-48483621 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1138014193 16:53414026-53414048 CCGCCCGCCTCGGCCTCCCGGGG + Intergenic
1138307143 16:55988688-55988710 CTGCCCGCCATGGCCTCCCGAGG + Intergenic
1140205176 16:72927670-72927692 CGCCCCTCCGGAGCCGCCCGGGG + Intronic
1140481534 16:75265322-75265344 CGGCGCTCCCGGGACTCCCCCGG - Intronic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1141215386 16:82018997-82019019 CTGCCCTCCTTGGCCTCCCCAGG + Intergenic
1141443554 16:84044327-84044349 CCGCCCTCCATGGCCTCCAGAGG - Intergenic
1141638620 16:85328813-85328835 CCCCGCCCCGGGGCCTCCCGCGG + Intergenic
1142310153 16:89307580-89307602 GGTCCCTCCCGGGCCTCCGGAGG + Intronic
1142548974 17:726109-726131 CCGCCCACCTTGGCCTCCCGAGG + Intergenic
1142583410 17:955651-955673 CCGCCCGCCTCGGCCTCCCGAGG - Intronic
1142806196 17:2372423-2372445 CGGCCCCCGGGGGCCTCCGCGGG + Exonic
1143026596 17:3944965-3944987 CCGCCCCCAGGGGCCTCCCACGG + Intronic
1143183395 17:4997562-4997584 CCGCCCGCCGGCTCCTCCCGCGG - Intronic
1145026334 17:19470672-19470694 CCAGGCTCCGGGGCCTCCCGGGG + Intergenic
1145158295 17:20557197-20557219 CTGCCCGCCTGGGCCTCCTGAGG + Intergenic
1145241031 17:21241204-21241226 TGGCCCTCAGGGGCTTCCTGTGG + Exonic
1145249409 17:21289217-21289239 CTGGCCTCCTGGGCCTCCCTTGG + Intronic
1145314665 17:21722576-21722598 CCATGCTCCGGGGCCTCCCGGGG + Intergenic
1146361103 17:32178433-32178455 CTGCCTGCCGTGGCCTCCCGAGG + Intronic
1146581220 17:34040173-34040195 GGGCCCTCCTGCGCCTCCCTTGG - Intronic
1147840609 17:43368984-43369006 CGGTCCTCCGGGCCCACCCCAGG - Intergenic
1147907528 17:43832861-43832883 CCGCCCTCCGAGGTCCCCCGGGG - Intronic
1148080995 17:44967757-44967779 CGGCCCTGTGGGGCCGCCGGGGG - Exonic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1148672355 17:49420196-49420218 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1150108540 17:62478964-62478986 GGGCCCTCCTGCGCCTCCCTTGG + Intronic
1150654495 17:67031113-67031135 CAGCCCTCCCTGGCCTCCAGAGG + Exonic
1150983366 17:70169006-70169028 CGGCCCTTCGAAGCCCCCCGCGG - Intronic
1151570948 17:74925054-74925076 CGGTCCTCCTGGTCCTCCCTAGG - Intronic
1151614174 17:75197563-75197585 CTGCCCACCTCGGCCTCCCGAGG - Intergenic
1151975747 17:77482795-77482817 CAGCTCTCCGGGGCCACCAGGGG - Intronic
1152354251 17:79799010-79799032 CGGCCGTCGGCGGCCTCCCACGG - Intronic
1152404671 17:80089964-80089986 CGGCTCTCCCGGGGCTCCTGTGG + Intronic
1152824264 17:82454177-82454199 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1153201745 18:2655112-2655134 CGGCGCTCCAGGGCCCCCAGAGG + Intergenic
1153805727 18:8706740-8706762 AGGCCCTCCGGGGGCGCCCCGGG - Intronic
1153900755 18:9614887-9614909 CGGCCGGGCGGGGCCTCCCGCGG + Intronic
1154042444 18:10870117-10870139 CTGCCCACCTGGGCCTCCCAAGG + Intronic
1154146093 18:11867433-11867455 CCGCCCTCCTTGGCCTCCCAAGG - Intronic
1154389607 18:13924956-13924978 CCGCCCTCCAGGGGCTTCCGAGG + Intergenic
1154943604 18:21138228-21138250 CTGCCCGCCTCGGCCTCCCGGGG - Intergenic
1155401715 18:25446799-25446821 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1155959501 18:31982234-31982256 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1156747469 18:40409858-40409880 CCGCCCTCCCTGGCCTCCCAAGG + Intergenic
1157455780 18:47827723-47827745 CTGCCCGCCTGGGCCTCCCGAGG + Exonic
1158678367 18:59543536-59543558 CGGCCTCTCGGGGCCTCTCGCGG - Intronic
1159040651 18:63320311-63320333 CGCCACTCCCGGGCCTGCCGCGG - Intergenic
1160465593 18:79073381-79073403 CTGCCCGCCTCGGCCTCCCGGGG - Intronic
1160728353 19:628759-628781 CTGCCCCCCTGAGCCTCCCGAGG - Intronic
1160760352 19:781082-781104 CGCCCCTCCGGGGCCCCACAGGG - Intergenic
1160874699 19:1291562-1291584 CGGCCAGCCTGGGCCTCCCCGGG + Intronic
1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG + Intergenic
1162602249 19:11677629-11677651 CTGCCCGCCTTGGCCTCCCGAGG - Intergenic
1162948530 19:14057527-14057549 CGGAGCTCCCGGGGCTCCCGAGG + Intronic
1163051842 19:14690164-14690186 CCGCCCTCCCCGCCCTCCCGAGG - Intronic
1163151204 19:15415641-15415663 CCGCCCTCCCTGGCCTCCCAAGG - Intronic
1163301963 19:16453346-16453368 CTTCCCACCGGGGCCTCCCACGG + Intronic
1163519046 19:17781168-17781190 GGGGCCTCTGGGGCCTCCCCAGG - Intronic
1163607069 19:18281367-18281389 CGGCCGTCGGGGGCGCCCCGGGG + Exonic
1163708607 19:18832349-18832371 CGGGCCGCCGGGGCCGCCGGGGG - Exonic
1163777737 19:19227863-19227885 CGGGCCTCAGGGGTATCCCGGGG + Exonic
1164016905 19:21261530-21261552 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1164231312 19:23290562-23290584 CTGCCCGCCTGGGCCTCCCCGGG - Intergenic
1164565567 19:29323686-29323708 TCGCCCTCCTGGGCCTCCGGTGG + Intergenic
1165061615 19:33207669-33207691 AGGCCCTCCGGGGACCCCAGCGG + Exonic
1165144874 19:33724618-33724640 TGCCCCTCCAGGGCCTTCCGAGG - Intronic
1165243270 19:34483265-34483287 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1165721517 19:38082517-38082539 CGGCCCTCGTCGGCCTCCCCCGG - Exonic
1166218754 19:41352631-41352653 CGGCACTCCGGCGCCCCCTGGGG + Intronic
1166762684 19:45234707-45234729 CGGCGCGCCTGGGCCTCCCAAGG - Intronic
1167002658 19:46755406-46755428 TGGGCCTCCGGGGCATCCTGGGG - Exonic
1167043809 19:47038581-47038603 CTGCCCTCCTTGGCCTCCCAAGG - Intronic
1167288790 19:48613483-48613505 TGGCCATCCGAGGCCTCCGGCGG + Exonic
1167415038 19:49365552-49365574 TGGACTTCCGGGGCCTCCCTGGG + Exonic
1167501573 19:49851391-49851413 CCGCCCTCCGCGGCCCCTCGTGG + Exonic
1167588828 19:50391450-50391472 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
1168068770 19:53937131-53937153 CTGCCCACCTCGGCCTCCCGAGG + Intronic
1168316578 19:55487186-55487208 TGGCCCTCGGGGGCCTCTCGAGG + Exonic
1168336286 19:55599416-55599438 CGGCCTCCCGGGGCCGCCCCGGG - Intronic
1168336291 19:55599426-55599448 CGGACTTCCCCGGCCTCCCGGGG - Intronic
1168385940 19:55963255-55963277 CTGCCCTCCTCGGCCTCCCAAGG + Intronic
1202657445 1_KI270708v1_random:36825-36847 CGGCCCCCCGGGATCGCCCGAGG - Intergenic
925390670 2:3491862-3491884 AGGCTCTCCGGGGCCTCCCTGGG - Intergenic
927176767 2:20415433-20415455 CCGCCCGCCTCGGCCTCCCGAGG + Intergenic
927594162 2:24382343-24382365 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
927713937 2:25341185-25341207 CGGCCCTCCTCGGCCCCGCGGGG - Intronic
927737645 2:25536456-25536478 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
927787239 2:25982353-25982375 CGGGGGTCCCGGGCCTCCCGAGG + Exonic
927961438 2:27242743-27242765 CGGGCCTTCGTGGCCTCCCGCGG + Exonic
929188696 2:39120706-39120728 CGGCCCGCCGGCGCCGCCCCGGG + Intronic
929468729 2:42169775-42169797 CGCCCCTCCGCGGACTCCGGTGG + Intronic
931794745 2:65698642-65698664 CTGCCCACCTGGGCCTCCCAAGG + Intergenic
932059821 2:68484751-68484773 CTGCCCACCTGGGCCTCCCAAGG - Intronic
932827994 2:74958944-74958966 CGGGGCCTCGGGGCCTCCCGCGG + Intronic
933869278 2:86550130-86550152 CTGCCCGTCGTGGCCTCCCGGGG - Intronic
934775046 2:96932092-96932114 CAACCCACCTGGGCCTCCCGGGG - Intronic
937620960 2:123984540-123984562 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
938241412 2:129744956-129744978 CAGCCTTCCTGGGCCTGCCGCGG - Intergenic
938253315 2:129833263-129833285 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
940817408 2:158311224-158311246 CTGCCCACCTCGGCCTCCCGAGG - Intronic
941543617 2:166817539-166817561 CTGCCTTCCGTGGCCTCCCAAGG - Intergenic
942194360 2:173502945-173502967 CTGCCCTCCAGGGGCTCCCAAGG - Intergenic
942565873 2:177264500-177264522 CGGCCCTCTGGGCCCTGCGGTGG - Intronic
943100222 2:183478792-183478814 CTGCCCGCCTTGGCCTCCCGAGG + Intergenic
943418638 2:187637895-187637917 CTGCCCGCCTTGGCCTCCCGGGG - Intergenic
944194744 2:197040618-197040640 CTGCCCTCCTTGGCCTCCCAAGG + Intronic
944263275 2:197697163-197697185 CCGCCAGCCTGGGCCTCCCGAGG - Intronic
945032886 2:205682105-205682127 CGTCCCCCCGGGGTCTCCCTTGG + Intronic
946412693 2:219522929-219522951 CCGCCCTCCGCTCCCTCCCGCGG - Intronic
947990311 2:234482267-234482289 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
948207146 2:236168304-236168326 CCGCCGTCCGTCGCCTCCCGCGG + Exonic
948368888 2:237475196-237475218 CGGCCCTCCAGCCCTTCCCGGGG - Intergenic
1168806586 20:675475-675497 TGGCGCCCGGGGGCCTCCCGGGG - Exonic
1169125454 20:3124366-3124388 CTGCCCGCCTTGGCCTCCCGAGG + Intronic
1169420046 20:5452542-5452564 CTGCCCGCCTCGGCCTCCCGGGG + Intergenic
1171464411 20:25317653-25317675 CGGCACTTCAGGGCCTCCCTGGG - Intronic
1171518833 20:25760323-25760345 CTACCCTCCGGGTCCTCCCCTGG + Intergenic
1171558022 20:26095887-26095909 CTACCCTCCGGGTCCTCCCCTGG - Intergenic
1171935851 20:31274366-31274388 TGGACTTCCGGGGCCTCCCTAGG + Intergenic
1172738896 20:37150530-37150552 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1173473120 20:43338782-43338804 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1175285861 20:57836368-57836390 CTGCCCTCGGGGGCCTCTCCTGG + Intergenic
1175367787 20:58467485-58467507 CGGGCCTCCTGGGTCACCCGGGG - Exonic
1175428906 20:58889362-58889384 GGGAGCGCCGGGGCCTCCCGCGG + Intronic
1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG + Intronic
1176135006 20:63518698-63518720 CGGCCCCCGAGGGCATCCCGCGG + Intergenic
1176281502 20:64316402-64316424 CGGCCCTCCTCGGCCTCCACGGG - Intergenic
1176555529 21:8252710-8252732 CGGCCCTCCGGCGATCCCCGCGG - Intergenic
1176597203 21:8758473-8758495 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1176643020 21:9324414-9324436 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1178191869 21:30292263-30292285 CGGCCCTCCTCAGCCTCCCAAGG - Intergenic
1179814712 21:43897893-43897915 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1180179738 21:46112609-46112631 CGGCCCACCGTGGCCACCCCTGG - Intronic
1180376449 22:12098021-12098043 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1180421244 22:12816362-12816384 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1181818902 22:25460406-25460428 TGGGCCTCCCGGGCCTCCCGTGG + Intergenic
1182331011 22:29552028-29552050 CGGCCAGCCTCGGCCTCCCGAGG + Intronic
1184663511 22:45976244-45976266 CCGCCCTCCCGGGCCTCCGCAGG + Intronic
1184755393 22:46512902-46512924 CTGCCATGCGGGGCCACCCGGGG - Intronic
1185275405 22:49948411-49948433 CTGCCCTCTGGGGGTTCCCGTGG + Intergenic
949274110 3:2257818-2257840 CGGCCCACCTCGGCCTCCCAAGG - Intronic
950449658 3:13058574-13058596 CTGCCCTCCAGGTCCTCCCCTGG - Intronic
950462965 3:13136052-13136074 CGGCCCTGTGGGGCCTCCCATGG - Intergenic
953084766 3:39655535-39655557 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
953306965 3:41840617-41840639 CTGCCCACCTCGGCCTCCCGGGG + Intronic
953614464 3:44477696-44477718 GGGCCCTCCGCGGCCTCTCTAGG + Intergenic
953888875 3:46736035-46736057 CCGCCCTCCTTGGCCTCCCACGG + Intronic
953982278 3:47418775-47418797 CGGCCCTCCAGAGCCTCCCTCGG + Exonic
954717593 3:52534093-52534115 CGGCCGTCCGGAGCCTCTCAGGG - Intronic
955256541 3:57338253-57338275 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
955626729 3:60927242-60927264 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
956299772 3:67759356-67759378 CTGCCCTCCTTGGCCTCCCAAGG + Intergenic
958431268 3:94043899-94043921 CCGCCCACCTCGGCCTCCCGAGG + Intronic
959053998 3:101551130-101551152 CTGCCCACCTTGGCCTCCCGAGG + Intergenic
959561895 3:107791757-107791779 CTGCCCGCCTTGGCCTCCCGAGG - Intronic
959958655 3:112270570-112270592 CTGCCCACCTCGGCCTCCCGAGG - Intronic
960963005 3:123085086-123085108 CGACCCTTCTGGGCCTCCCAAGG + Intronic
961633086 3:128315569-128315591 CCTCCCTCCTGGGCCTCCCCAGG - Intronic
961869440 3:129977062-129977084 GGGCCCACAGGGGCCTCCCAGGG - Exonic
962787834 3:138784672-138784694 CTGCCCGCATGGGCCTCCCGAGG + Intronic
966617324 3:181926422-181926444 CTGCCCGCCTGGGCCTCCCGAGG - Intergenic
966860813 3:184230143-184230165 CGGCCCCCCGGGGCCCCCCGCGG - Intronic
967166309 3:186783180-186783202 CGGGCGGCCGGGGCTTCCCGCGG - Intergenic
1202743865 3_GL000221v1_random:80600-80622 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
968457283 4:706107-706129 CGGCCCTCCCGGGCCTGCCAAGG - Intronic
968576658 4:1369349-1369371 CGGCACTCCTGGGGCCCCCGGGG - Intronic
968637844 4:1691310-1691332 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
968657680 4:1785673-1785695 AGGGCCTCAGGGGCCTCCCAGGG - Intergenic
968698238 4:2042844-2042866 CGGTCCTCCCGGGCTTCCCAGGG + Intronic
968775395 4:2536856-2536878 CCGCCCTCCGCCGCCGCCCGCGG + Intronic
968912648 4:3483924-3483946 CGGCCCTCATGAGCCTCTCGGGG + Intronic
968978763 4:3835540-3835562 TGGGCCTCCTGGGCCTCCTGGGG + Intergenic
969113513 4:4857914-4857936 CGGTGCACCGGGGCCTCCGGAGG - Intergenic
969656327 4:8500903-8500925 CTGCCCTCCTTGGCCTCCCAAGG + Intergenic
972437075 4:39044857-39044879 GCCCCCTCCGGGGCCACCCGGGG + Intergenic
972938354 4:44167585-44167607 CTGCCTGCCTGGGCCTCCCGAGG + Intergenic
973293438 4:48491081-48491103 TCGCCCTCCTGGGCCTCTCGCGG - Exonic
973360497 4:49160692-49160714 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
973399587 4:49627221-49627243 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
974597754 4:64036888-64036910 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
975063704 4:70037196-70037218 CTGCCCGCCTCGGCCTCCCGTGG + Intergenic
975908665 4:79244869-79244891 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
976080088 4:81345949-81345971 CAGCCCACCAGGGCCTCCCTTGG - Intergenic
976223964 4:82780805-82780827 TGGCCCCCTGGGGCCTCCTGGGG - Intronic
977542266 4:98331050-98331072 CTGCCCGCCTTGGCCTCCCGAGG - Intronic
978527367 4:109679400-109679422 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
979360538 4:119758944-119758966 CGGCCCACCTCGGCCTCCCAGGG - Intergenic
979482766 4:121238223-121238245 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
979702404 4:123684560-123684582 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
981516920 4:145619490-145619512 CGGTCCTCCGGGGCGCCCCCTGG + Intronic
981993572 4:150953605-150953627 CTGCCAGCCCGGGCCTCCCGAGG + Intronic
982182987 4:152765873-152765895 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
982281236 4:153684798-153684820 CCGCCCCCCTCGGCCTCCCGAGG - Intergenic
982711085 4:158759429-158759451 CTGCCCTCCTCGGCCTCCCGAGG + Intergenic
984772012 4:183444490-183444512 GTGCCCTCCGTGGCCTCACGGGG + Intergenic
1202758049 4_GL000008v2_random:83454-83476 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
985661469 5:1159160-1159182 CTGCCCACCTTGGCCTCCCGTGG + Intergenic
985895574 5:2748639-2748661 CGGGCCACCGGGGCTGCCCGCGG - Exonic
986199612 5:5569436-5569458 CTGCCCTCCAGGGCCTGCTGTGG + Intergenic
986330550 5:6713743-6713765 CCGCCCGCCGCGGCCTGCCGGGG + Intergenic
986451472 5:7869444-7869466 CGCCGCCCAGGGGCCTCCCGCGG - Intronic
990617062 5:57518951-57518973 CTGCCCCCCTCGGCCTCCCGAGG - Intergenic
991222673 5:64234840-64234862 CCACCCTCCTTGGCCTCCCGAGG + Intronic
993934568 5:93985666-93985688 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
999978941 5:156940199-156940221 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1001545437 5:172568036-172568058 CCTCCCTCCAGAGCCTCCCGTGG - Intergenic
1001602791 5:172939891-172939913 CCGCCCTCCGAGGGCTCCCAGGG - Intronic
1002118418 5:176983476-176983498 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1002683259 5:180986285-180986307 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1003212469 6:4079486-4079508 CGGCCTTCCTGGGCCTCCTCGGG + Exonic
1003812787 6:9803579-9803601 CTGCCCACCTCGGCCTCCCGAGG + Intronic
1004631496 6:17425849-17425871 CGGCCCACCTTGGCCTCCCAAGG - Intronic
1005414600 6:25586707-25586729 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1005901771 6:30222455-30222477 CTGCCCGCCTTGGCCTCCCGAGG - Intergenic
1005933286 6:30499235-30499257 CTGCCCACCTCGGCCTCCCGAGG - Intergenic
1006628543 6:35414746-35414768 GGTCCCTCAGGGGACTCCCGAGG - Intronic
1007521341 6:42453188-42453210 CGGCCACCGGGGGCCGCCCGGGG + Intergenic
1008106424 6:47444389-47444411 CTGCCCGCCTGGGCCTCCCGAGG - Intergenic
1009869278 6:69433814-69433836 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1010246110 6:73661450-73661472 CCGCCAGCCTGGGCCTCCCGAGG - Intergenic
1010710753 6:79171675-79171697 CTGCCCTCCTTGGCCTCCCAAGG - Intergenic
1012417332 6:99024890-99024912 CTGCCCTCAGGGGCCCCCCATGG - Intergenic
1013322517 6:109009172-109009194 CGGCCCTCCTGCGCCCCTCGGGG - Intronic
1015781514 6:136871802-136871824 CTGCCCTCCTGAGCCTCCCAAGG + Intronic
1016949448 6:149566257-149566279 CGCCTCTCCGCGGCCGCCCGGGG + Intergenic
1017898368 6:158700857-158700879 CTGCCCTCCTTGGCCTCCCAAGG + Intronic
1017981800 6:159406984-159407006 CTGCCCACCTGGGCCTCCCGAGG + Intergenic
1018170570 6:161140170-161140192 CGGCCCTCAGAGCCCTCCAGTGG - Intronic
1019128530 6:169857447-169857469 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019479372 7:1259614-1259636 CGGCTCCCCGTGGGCTCCCGTGG - Intergenic
1019711336 7:2519538-2519560 CGGCCCGCAGGGGCTACCCGGGG + Intronic
1020106125 7:5423186-5423208 CGGCCCTCCTGGCCCGGCCGAGG - Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1021995803 7:26177351-26177373 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1022187751 7:27986898-27986920 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
1022317964 7:29263271-29263293 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1022700207 7:32753415-32753437 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1023401107 7:39793375-39793397 TGCCCCACCGCGGCCTCCCGGGG - Intergenic
1023954364 7:44872355-44872377 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1024075089 7:45814034-45814056 CGCCCCACCGCGGCCGCCCGGGG - Intergenic
1024648506 7:51387306-51387328 CGCCCCACTGCGGCCTCCCGGGG + Intergenic
1024896128 7:54264199-54264221 CCGCCCTCCTTGGCCTCCCAAGG - Intergenic
1025052358 7:55741775-55741797 CGCCCCACCGCGGCTTCCCGGGG + Intergenic
1025130029 7:56370309-56370331 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130335 7:56371559-56371581 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130655 7:56372857-56372879 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130971 7:56374151-56374173 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025775042 7:64553828-64553850 CTGCCCGCCACGGCCTCCCGAGG + Intronic
1025800704 7:64784354-64784376 CCGCCAGCCTGGGCCTCCCGAGG + Intergenic
1025850012 7:65237617-65237639 CTGCCCTCCCAGGCCTCCCAGGG + Intergenic
1025994222 7:66518174-66518196 CGGCCTCAGGGGGCCTCCCGTGG - Intergenic
1026841294 7:73671215-73671237 CTGCCCACTGGGGCCGCCCGGGG + Exonic
1027369879 7:77496870-77496892 CTGCCCACCTCGGCCTCCCGAGG + Intergenic
1027370941 7:77508655-77508677 CCGCCCGCCTTGGCCTCCCGAGG + Intergenic
1027826694 7:83124997-83125019 CTGCCCGCCTTGGCCTCCCGAGG + Intronic
1028548038 7:92026576-92026598 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1029155410 7:98514046-98514068 CAGTTCTCCTGGGCCTCCCGCGG + Intergenic
1029547289 7:101217136-101217158 CGGCCGTGCCGGGCCTCCCCGGG + Intronic
1030084198 7:105803217-105803239 CTGCCCTCCCTGGCCTCCCATGG - Intronic
1030329250 7:108255409-108255431 CTGCCCACCTGGGCCTCCCGAGG + Intronic
1031289955 7:119921917-119921939 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
1032028538 7:128463106-128463128 CTGCCCGCCCTGGCCTCCCGAGG + Intergenic
1032037291 7:128530636-128530658 CCGCCCTCCGGGGCGACGCGCGG + Intergenic
1032129362 7:129215978-129216000 CTGCCCACCTCGGCCTCCCGAGG + Intergenic
1032179635 7:129663879-129663901 CTGCCCACCTCGGCCTCCCGAGG - Intronic
1032240333 7:130154554-130154576 GGCTCCTGCGGGGCCTCCCGAGG - Intergenic
1032437140 7:131909544-131909566 CGGGCCTCAGCTGCCTCCCGCGG + Intergenic
1033741868 7:144282363-144282385 CGGCTCTCCATGGCCTCCAGCGG - Intergenic
1033752033 7:144367251-144367273 CGGCTCTCCATGGCCTCCAGCGG + Exonic
1033795588 7:144841360-144841382 CCGCCCTCCTCGGCCTCCCACGG - Intergenic
1034880649 7:154759878-154759900 CCGCCCTCCTTGGCCTCCCAAGG - Intronic
1034922737 7:155097149-155097171 CTGCCCGCCTTGGCCTCCCGAGG - Intergenic
1035365883 7:158349179-158349201 CTGCCCTCAGGGGCCACCCAGGG - Intronic
1035366032 7:158349680-158349702 CTGCCCTCAGGGGCCACCCAGGG - Intronic
1035366076 7:158349831-158349853 CTGCCCTCAGGGGCCACCCAGGG - Intronic
1035462275 7:159049428-159049450 GGGCCCTCCAGGGCCTCCGTGGG + Intronic
1036618190 8:10404693-10404715 CGGCCCTCCGTGCCTTCTCGTGG + Intronic
1036702862 8:11024713-11024735 TGGCCCTCTTGGGCCTCCCTGGG - Intronic
1037134700 8:15446480-15446502 CTGCCCGCCTGGGCCTCCTGAGG - Intronic
1037803676 8:22048349-22048371 CGGCCCTCAGGGTCCTCCCTCGG - Exonic
1038505496 8:28081073-28081095 CGGCCCACCTTGGCCTCCCAAGG - Intronic
1039467826 8:37796821-37796843 CCGCCCGCCCGGGCCTTCCGCGG - Intronic
1039566230 8:38554243-38554265 TTCCCCTCCGGAGCCTCCCGGGG + Intergenic
1040079081 8:43269741-43269763 CCGCCCGCCTTGGCCTCCCGAGG - Intergenic
1040802261 8:51356243-51356265 CTGCCCTCCTCGGCCTCCCAAGG - Intronic
1040915723 8:52565160-52565182 TGCGCCCCCGGGGCCTCCCGTGG + Exonic
1042784912 8:72536764-72536786 CGTCGCGGCGGGGCCTCCCGGGG + Intergenic
1043053210 8:75407301-75407323 CGGACCCCCGGGGGCTCCCCAGG + Intergenic
1043053247 8:75407435-75407457 CGGCTCTCCCGGGCCTCCGCGGG - Intergenic
1044306427 8:90645801-90645823 CGGCCCGCTGGGCCCTGCCGCGG - Exonic
1044582347 8:93834977-93834999 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1044734824 8:95268797-95268819 CAGCCCTCTGGGGCATGCCGGGG + Intronic
1044969319 8:97604597-97604619 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1045022025 8:98052270-98052292 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1045047661 8:98294361-98294383 CGGCGGTCTGCGGCCTCCCGGGG + Exonic
1048865850 8:138760950-138760972 CTGCCCTCCAGGCCCTCCCTGGG - Intronic
1050417490 9:5432739-5432761 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1050862221 9:10449282-10449304 CTGCCCACCTGGGCCTCCCGAGG + Intronic
1052236326 9:26215650-26215672 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1052258974 9:26492199-26492221 CTGCCCGCCTCGGCCTCCCGGGG + Intergenic
1053082034 9:35184462-35184484 CTGCCCGCCTCGGCCTCCCGGGG - Intronic
1053261430 9:36668754-36668776 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1055297884 9:74852734-74852756 CTGCCCGCCTCGGCCTCCCGAGG + Intronic
1056166683 9:83947756-83947778 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
1058049507 9:100392441-100392463 CTGCCCACCTCGGCCTCCCGAGG + Intergenic
1058609216 9:106756835-106756857 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1059176810 9:112175376-112175398 CCGCGCTCTGCGGCCTCCCGGGG - Intronic
1059880065 9:118678800-118678822 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1060527856 9:124330608-124330630 CGGCCCTGCTGGGTCTCCCAGGG + Intronic
1060625445 9:125108075-125108097 CTGCCAGCCTGGGCCTCCCGAGG + Intronic
1061056570 9:128225827-128225849 CGGCCCTCCCTTGCCACCCGGGG - Intronic
1061600964 9:131669745-131669767 GGGCCCTCAGGAGCCTCCCGTGG - Intronic
1061987004 9:134135759-134135781 CGGCCCTCCGGGACCTGCGCAGG - Intronic
1062027239 9:134346253-134346275 CTGCCCTCCCTGCCCTCCCGCGG + Intronic
1062274989 9:135726298-135726320 GGGCCCTCTGGGGCCTCCCTGGG + Intronic
1062317699 9:135976587-135976609 AGGGCCTCCGGGTCCTCCCTGGG - Intergenic
1062341302 9:136094974-136094996 CCCCCCTCCGCGGGCTCCCGAGG + Intronic
1062363259 9:136197454-136197476 GGGCCCGCCGGGGGCTCCCGAGG + Exonic
1062653339 9:137589852-137589874 CGGCGATCCGGGGCCTAGCGCGG - Intronic
1203712497 Un_KI270742v1:110565-110587 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1203538838 Un_KI270743v1:68326-68348 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1203556097 Un_KI270743v1:208883-208905 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1185736448 X:2500352-2500374 CTCCCCTCCGGGGCCTGGCGGGG + Intronic
1186109558 X:6241567-6241589 CTGCCCGCCTGGGCCTCCCAAGG - Intergenic
1190334481 X:49253970-49253992 AGGCTGTCAGGGGCCTCCCGGGG + Exonic
1190505392 X:51120246-51120268 CTGCCAGCCTGGGCCTCCCGAGG - Intergenic
1191894309 X:65975797-65975819 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1192350267 X:70350239-70350261 CTGCCCGCCTCGGCCTCCCGAGG - Intronic
1192503660 X:71668390-71668412 CAGCCCGGCGGGGCCTTCCGCGG - Intergenic
1192504811 X:71675428-71675450 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic
1192886036 X:75336060-75336082 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1195520327 X:105822331-105822353 AGGCCCTTCGCGGCCTCCCCCGG - Intergenic
1199772704 X:150984310-150984332 CGCCCCGCCCGGGCCGCCCGGGG - Intronic
1200093574 X:153647124-153647146 CGGCCCGCCGGGCCCGCCCCCGG + Intronic
1200107791 X:153724458-153724480 GGAGCCTCCGGGGCCTCGCGAGG - Intronic
1200182959 X:154162363-154162385 CCACCCTCCTGGGCCTCCTGGGG - Intergenic
1200188613 X:154199477-154199499 CCACCCTCCTGGGCCTCCTGGGG - Intergenic
1200194262 X:154236618-154236640 CCACCCTCCTGGGCCTCCTGGGG - Intergenic
1200200018 X:154274421-154274443 CCACCCTCCTGGGCCTCCTGGGG - Intronic
1200634512 Y:5633969-5633991 CTGCCCTCCTCGGCCTCCCAAGG - Intronic
1201440353 Y:14001315-14001337 CTGCCCGCCTCGGCCTCCCGAGG - Intergenic
1201444218 Y:14041393-14041415 CTGCCCGCCTCGGCCTCCCGAGG + Intergenic