ID: 1148082314

View in Genome Browser
Species Human (GRCh38)
Location 17:44974180-44974202
Sequence GTGAAGAATATGGCCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148082310_1148082314 -3 Left 1148082310 17:44974160-44974182 CCCTGAAAGGAGTCATCAAGGTG No data
Right 1148082314 17:44974180-44974202 GTGAAGAATATGGCCACTGGAGG No data
1148082311_1148082314 -4 Left 1148082311 17:44974161-44974183 CCTGAAAGGAGTCATCAAGGTGA No data
Right 1148082314 17:44974180-44974202 GTGAAGAATATGGCCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148082314 Original CRISPR GTGAAGAATATGGCCACTGG AGG Intergenic
No off target data available for this crispr