ID: 1148084829

View in Genome Browser
Species Human (GRCh38)
Location 17:44987815-44987837
Sequence GCGGCGGCGGAGACCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148084829_1148084842 27 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084842 17:44987865-44987887 GGAAAGGACTGCTGGCTGCCTGG No data
1148084829_1148084833 -9 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG No data
1148084829_1148084839 6 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084839 17:44987844-44987866 AGATGGGGGAGCTGAACTGACGG No data
1148084829_1148084841 19 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084841 17:44987857-44987879 GAACTGACGGAAAGGACTGCTGG No data
1148084829_1148084834 -8 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084834 17:44987830-44987852 GCCGCCGCCGCCGTAGATGGGGG No data
1148084829_1148084832 -10 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084832 17:44987828-44987850 CCGCCGCCGCCGCCGTAGATGGG No data
1148084829_1148084840 11 Left 1148084829 17:44987815-44987837 CCTGTCTGGGTCTCCGCCGCCGC No data
Right 1148084840 17:44987849-44987871 GGGGAGCTGAACTGACGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148084829 Original CRISPR GCGGCGGCGGAGACCCAGAC AGG (reversed) Intergenic
No off target data available for this crispr