ID: 1148085593

View in Genome Browser
Species Human (GRCh38)
Location 17:44991961-44991983
Sequence AGATGGGAGGGCCCTCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148085582_1148085593 26 Left 1148085582 17:44991912-44991934 CCATCAGCTGCTCTTGTTTGCTC No data
Right 1148085593 17:44991961-44991983 AGATGGGAGGGCCCTCTCAGTGG No data
1148085581_1148085593 27 Left 1148085581 17:44991911-44991933 CCCATCAGCTGCTCTTGTTTGCT No data
Right 1148085593 17:44991961-44991983 AGATGGGAGGGCCCTCTCAGTGG No data
1148085580_1148085593 28 Left 1148085580 17:44991910-44991932 CCCCATCAGCTGCTCTTGTTTGC No data
Right 1148085593 17:44991961-44991983 AGATGGGAGGGCCCTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148085593 Original CRISPR AGATGGGAGGGCCCTCTCAG TGG Intergenic
No off target data available for this crispr