ID: 1148088025

View in Genome Browser
Species Human (GRCh38)
Location 17:45006455-45006477
Sequence TCAAAGGCCCTCCTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148088018_1148088025 5 Left 1148088018 17:45006427-45006449 CCCAGGAGCAGATAAATCCAAAT No data
Right 1148088025 17:45006455-45006477 TCAAAGGCCCTCCTGGATCCTGG No data
1148088019_1148088025 4 Left 1148088019 17:45006428-45006450 CCAGGAGCAGATAAATCCAAATC No data
Right 1148088025 17:45006455-45006477 TCAAAGGCCCTCCTGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148088025 Original CRISPR TCAAAGGCCCTCCTGGATCC TGG Intergenic
No off target data available for this crispr