ID: 1148090947

View in Genome Browser
Species Human (GRCh38)
Location 17:45022165-45022187
Sequence GCCGGCTCGGGCGCGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148090927_1148090947 27 Left 1148090927 17:45022115-45022137 CCCGGCCCAGCCCGGGAGGGTGC No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090938_1148090947 -5 Left 1148090938 17:45022147-45022169 CCGGCCGAACGGCAGGCCGCCGG No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090931_1148090947 17 Left 1148090931 17:45022125-45022147 CCCGGGAGGGTGCTGCCACCTGC No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090930_1148090947 21 Left 1148090930 17:45022121-45022143 CCAGCCCGGGAGGGTGCTGCCAC No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090928_1148090947 26 Left 1148090928 17:45022116-45022138 CCGGCCCAGCCCGGGAGGGTGCT No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090929_1148090947 22 Left 1148090929 17:45022120-45022142 CCCAGCCCGGGAGGGTGCTGCCA No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090932_1148090947 16 Left 1148090932 17:45022126-45022148 CCGGGAGGGTGCTGCCACCTGCC No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090940_1148090947 -9 Left 1148090940 17:45022151-45022173 CCGAACGGCAGGCCGCCGGCTCG No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090937_1148090947 -1 Left 1148090937 17:45022143-45022165 CCTGCCGGCCGAACGGCAGGCCG No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data
1148090935_1148090947 2 Left 1148090935 17:45022140-45022162 CCACCTGCCGGCCGAACGGCAGG No data
Right 1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148090947 Original CRISPR GCCGGCTCGGGCGCGGGCCT GGG Intergenic