ID: 1148096374

View in Genome Browser
Species Human (GRCh38)
Location 17:45055094-45055116
Sequence TTTCCATGTGATGCCATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148096371_1148096374 2 Left 1148096371 17:45055069-45055091 CCATAATGAAACTTGGGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1148096368_1148096374 8 Left 1148096368 17:45055063-45055085 CCTCCTCCATAATGAAACTTGGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1148096366_1148096374 15 Left 1148096366 17:45055056-45055078 CCAGGCACCTCCTCCATAATGAA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1148096365_1148096374 16 Left 1148096365 17:45055055-45055077 CCCAGGCACCTCCTCCATAATGA 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1148096364_1148096374 23 Left 1148096364 17:45055048-45055070 CCTTCAACCCAGGCACCTCCTCC 0: 1
1: 0
2: 3
3: 47
4: 571
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1148096370_1148096374 5 Left 1148096370 17:45055066-45055088 CCTCCATAATGAAACTTGGGCTT 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148096374 Original CRISPR TTTCCATGTGATGCCATCAA GGG Intronic