ID: 1148105176

View in Genome Browser
Species Human (GRCh38)
Location 17:45115025-45115047
Sequence CTCCTGAAGGGAGTCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105176 Original CRISPR CTCCTGAAGGGAGTCTGGAA AGG (reversed) Intronic
900351996 1:2239545-2239567 GACCTGAATGGAGTCAGGAAGGG + Intronic
900520436 1:3102774-3102796 CTGCGGAAGGGACTCTGGAAGGG + Intronic
902375310 1:16027569-16027591 CTCCTTCAGGGAGGATGGAAGGG + Intronic
902852016 1:19166313-19166335 CTGCTGAAATGAGTGTGGAATGG - Intronic
903474228 1:23608314-23608336 CTGCTGGAGGGAGTCAGAAAAGG - Intronic
904591779 1:31619031-31619053 TTCCTGAAGGGAGGAAGGAAAGG - Exonic
906245375 1:44269720-44269742 CACCTGAAGGCAGTCTGGCCTGG - Intronic
907678084 1:56537299-56537321 CTCCTCATGGGGGTGTGGAAAGG - Intronic
908926127 1:69257209-69257231 TCTCTGAAGGGAGCCTGGAAAGG - Intergenic
911869106 1:103069947-103069969 CTGCTGAAGGGAGTATAAAATGG + Intronic
913230115 1:116734713-116734735 CTCTTGATGGGAGTGTGTAAAGG - Intergenic
915216465 1:154343873-154343895 CTCCTGGAGGCAGAGTGGAAAGG - Exonic
915536543 1:156539612-156539634 CCCCTGATGGAAATCTGGAATGG + Intronic
915979165 1:160409434-160409456 CTCCTGAAGGGAAAAGGGAAAGG + Intronic
918101131 1:181375792-181375814 CTCATCAAGGGAATCAGGAAAGG - Intergenic
920079575 1:203362474-203362496 CTCCTGAAGAGAGGCAGGAGTGG + Intergenic
920441933 1:205986515-205986537 CTCCCGAAGGGAGACAGAAAAGG - Intronic
920780033 1:208980859-208980881 CTGCTGAAGGGAGTATAGATTGG - Intergenic
922910627 1:229213175-229213197 CTCCTTTGGTGAGTCTGGAATGG + Intergenic
1068666814 10:59685000-59685022 TTCCTGAAGGAGGCCTGGAATGG + Intronic
1069009750 10:63358775-63358797 CTGTTAAAGGCAGTCTGGAAAGG + Intronic
1069772964 10:70911070-70911092 CTCCTGAAGGGAGGCCTGAGAGG - Intergenic
1072126436 10:92449432-92449454 CTCGTGAAGTGAGTTGGGAAGGG + Intergenic
1075738437 10:124678611-124678633 TTCCTCAAGAGAGACTGGAATGG + Intronic
1075881674 10:125857553-125857575 CCCCTGAAGGCAGGCTGGAAAGG - Intronic
1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG + Intronic
1077217252 11:1400169-1400191 CTCCTGCAGGGAGACTGGGCTGG - Intronic
1082885650 11:58079315-58079337 CTCCTGAAGGAGTTATGGAATGG + Intronic
1083749340 11:64752800-64752822 CATCTGAAGTGAGCCTGGAAGGG - Intronic
1085550247 11:77363430-77363452 CTCATGGAGGGAGTGGGGAAAGG - Intronic
1091272676 11:134328846-134328868 CTCCTGAGGGGAGGGTGGATGGG + Intergenic
1091900824 12:4142622-4142644 CACCTCAAGGGATTCTGGGAGGG + Intergenic
1093820920 12:23616480-23616502 CTCCTGAAGGGAGTAAGGAAGGG + Intronic
1094061785 12:26322057-26322079 ATGATGAAGGGAGTCAGGAATGG + Intergenic
1094417559 12:30233393-30233415 CTCTTGAGAGGAGTCTGGTAAGG - Intergenic
1094872783 12:34607328-34607350 CTCCTCAAGGAAGGCTTGAAAGG + Intergenic
1099083008 12:78210123-78210145 CTCCAGCAGGGAGACTGGAAAGG - Intronic
1103465443 12:121138782-121138804 CTCCTGGTGGGACTCAGGAAGGG - Intronic
1104334551 12:127881101-127881123 TTGATGAAGGGAGACTGGAATGG + Intergenic
1104763272 12:131311058-131311080 CGCCTGAATGGATTCTGGAGAGG + Intergenic
1104816226 12:131647012-131647034 CGCCTGAATGGATTCTGGAGAGG - Intergenic
1104834507 12:131779328-131779350 CTCCTGGAGGGAGGGTGGAGAGG - Intronic
1106218225 13:27721936-27721958 CTCCTGAAGAGCTCCTGGAATGG - Intergenic
1109257661 13:60102821-60102843 ATGATGAAGTGAGTCTGGAAGGG - Intronic
1109381813 13:61571683-61571705 CTCCTGAAGACAGTATAGAATGG - Intergenic
1109946763 13:69444744-69444766 CTCATAAAATGAGTCTGGAAGGG + Intergenic
1110575393 13:77049148-77049170 CAAGTGAAGGGAGTGTGGAAAGG - Intronic
1111689207 13:91540216-91540238 ACCCTGAAGAGAGTCTGGAAGGG - Intronic
1112194719 13:97213933-97213955 CTCCAACAGGGAGTATGGAATGG - Intergenic
1113271642 13:108681285-108681307 CTCCTTAGTGGAGTCTGGAAGGG - Intronic
1114558069 14:23573110-23573132 CTCAGGAAGGCAGTCTGGTATGG + Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1119668024 14:76498733-76498755 CTCCTGAAGGGAGTCAGCCCTGG - Intronic
1121391366 14:93577905-93577927 CTCCGAAACGGACTCTGGAAAGG - Exonic
1122480035 14:102041275-102041297 CACCTGAAGGTACTCAGGAAGGG - Intronic
1124160276 15:27262062-27262084 CTAATGAAGGAAGTCTAGAAGGG - Intronic
1128183902 15:65627862-65627884 CTACTGAAGGGACTCTTCAAGGG + Intronic
1128495461 15:68195936-68195958 GTCCTGGGGGGAGTCTGGGAGGG + Intronic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1129670587 15:77605748-77605770 CTCCTGCAGGGCAGCTGGAAGGG - Intergenic
1130883171 15:88072312-88072334 CCCCTGAGGGGAGTATGAAAAGG - Intronic
1132070946 15:98776110-98776132 CTCCCGAAGGGAGGGTGGAAGGG + Intronic
1132375069 15:101323432-101323454 CCGCTAAAGGGAGTCTGGGACGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1135177361 16:20242468-20242490 TTGCTCAAGGGAGTCTGGGAAGG + Intergenic
1136590609 16:31215680-31215702 CACCAGAAGGGAGACTGTAAGGG + Intronic
1138730990 16:59195098-59195120 CTCTTGAAAGGAATGTGGAAAGG - Intergenic
1140767307 16:78172288-78172310 CTCGAAAAGGAAGTCTGGAACGG - Intronic
1140785947 16:78342349-78342371 CTCGTGAAGGCAGACTTGAAGGG + Intronic
1140801090 16:78489032-78489054 CTCCTGAAGTGTTTCTGAAAGGG - Intronic
1141566586 16:84906518-84906540 CTCCTGCAGGGACTCTGGGTGGG - Intronic
1142186583 16:88697721-88697743 CTGCTGGAGGGAGGCAGGAAGGG - Intronic
1142278430 16:89135272-89135294 CTCCTTGAGGGATGCTGGAAGGG + Intronic
1142591342 17:1007397-1007419 CTCCTGAAGGACTCCTGGAAGGG + Intronic
1142781829 17:2187099-2187121 GTGCTGAAGGAAGGCTGGAAGGG - Intronic
1146585099 17:34075575-34075597 GTACTGCAGGGAGTCAGGAAAGG - Intronic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1148750427 17:49942465-49942487 CTCCTGAAGGGAGTTAAGAATGG + Intergenic
1148842133 17:50505839-50505861 TTCTTGAAGGGAGACAGGAATGG - Intergenic
1149147947 17:53520354-53520376 GTCCTTAAGGGCATCTGGAATGG + Intergenic
1149830835 17:59870466-59870488 CTACTGCAGGGAGTGGGGAAGGG - Intronic
1151102020 17:71566880-71566902 CTCCTTAAGGGGCACTGGAAAGG + Intergenic
1155167822 18:23245638-23245660 CTGCTGGAGACAGTCTGGAAGGG - Intronic
1158416037 18:57250507-57250529 CTCCTGAGCTGAGTCTAGAAGGG + Intergenic
1159114158 18:64093999-64094021 CCGCTGAAGGGATTCTGGATCGG + Intergenic
1165791311 19:38494343-38494365 CTCCTGCAGGGACCCTGGGAAGG - Exonic
1168357495 19:55711419-55711441 CTTCAGAAGGGCTTCTGGAATGG - Intronic
1168454717 19:56497356-56497378 CTCCTGAAGGGACTCTGGGCTGG - Intergenic
925434746 2:3827182-3827204 ACCCTGAGGGGAGGCTGGAAGGG + Intronic
926991868 2:18688976-18688998 CTCCTGCAGCGAGGATGGAAGGG - Intergenic
927939669 2:27095614-27095636 CTGCAGGAGGGAGTCTGCAAGGG - Intronic
928384120 2:30849872-30849894 CTCCTGAAGGAAGCATGGAAAGG + Intergenic
928946164 2:36774056-36774078 CCCCTGAAGCGAGTCTGTAGAGG + Intronic
930046315 2:47176068-47176090 CTTCTGTCGGGCGTCTGGAAAGG - Intronic
932790677 2:74652304-74652326 ATCCTGATGGCAGTCTGGAAGGG + Intergenic
933219379 2:79670283-79670305 CTCTTGTAGGGAGTGAGGAATGG - Intronic
933989217 2:87621666-87621688 CTGCTGAAATGAGTCTGAAATGG - Intergenic
934124288 2:88871381-88871403 CTCCAGAACCAAGTCTGGAATGG - Intergenic
935651274 2:105384332-105384354 CTTCTGAAAGGTGTGTGGAAGGG + Intronic
936304626 2:111329160-111329182 CTGCTGAAATGAGTCTGAAATGG + Intergenic
937859853 2:126699087-126699109 CTCCTGAAGGGAGGCCAGACAGG - Intergenic
938189485 2:129262933-129262955 CTTGTGAAGGGAGTCTGGATTGG - Intergenic
938220662 2:129564478-129564500 CTCCTGACGGAAGTCTGGTAGGG - Intergenic
938221364 2:129570831-129570853 CTCCTGAAGGAAATATGGAAAGG + Intergenic
938597514 2:132802887-132802909 CTCTTGATGGGATTCTGGAGGGG - Intronic
940923581 2:159338319-159338341 CTCCTGAAAGAGGTCAGGAAAGG - Intronic
943758548 2:191584461-191584483 CTGCTGCAGGGTGTCTGGATTGG + Intergenic
946891594 2:224282640-224282662 CTCCTGGATGGAGTAAGGAAGGG - Intergenic
947435252 2:230067807-230067829 CTCCTCAAGAGAGGCTGAAATGG - Intronic
947491888 2:230602634-230602656 CTCCTGGAGGGTGCCTGAAAGGG - Intergenic
948732820 2:239977955-239977977 CTGCTGAGGGGAGGCTGGAGGGG - Intronic
1169363475 20:4971532-4971554 CACCTGTAGGGAGGCTGGGATGG + Intronic
1169757276 20:9056142-9056164 CTTCTCTAGAGAGTCTGGAAAGG + Intergenic
1170722965 20:18900479-18900501 CTCCTAAAGGGAGATGGGAAGGG - Intergenic
1173446809 20:43126741-43126763 CTCCTGAGGAGAGACTGAAAGGG - Intronic
1173798267 20:45877947-45877969 CTTCTGCAGGGAGGCTGGTAAGG - Exonic
1176693324 21:9944254-9944276 CTCCTGAAGGGAGGAATGAAAGG - Intergenic
1177057157 21:16320156-16320178 CTCAGGAAAGGAGTCTGGATTGG + Intergenic
1179827896 21:43978156-43978178 CTCCTGAAGAGGCTGTGGAAGGG + Intronic
1180115941 21:45705081-45705103 CTCCTGAAAAGAGGCTGCAAGGG - Intronic
1182145945 22:27996744-27996766 TTTCGGAAGGGAGTGTGGAAAGG - Intronic
1182373939 22:29832340-29832362 CTCCTGAAAGGAATATGGATGGG + Exonic
1184045794 22:41971597-41971619 CTCCTCCAGGGAGTCTCGAGGGG - Intergenic
1184245357 22:43232995-43233017 CTGCTGGAGAGAGTCTGGAGGGG - Intronic
1184935795 22:47719461-47719483 CTCCGAAACCGAGTCTGGAAGGG - Intergenic
1185066358 22:48633627-48633649 CTCCTGAACGGAGCCAAGAAGGG + Intronic
1185131852 22:49043785-49043807 CTCCTAAAGGAAGACAGGAAGGG - Intergenic
951237250 3:20250559-20250581 CTCCAGTGGGGAGTCTGCAATGG + Intergenic
953207871 3:40847986-40848008 CTGCAGCAGGGAGTCTGGAGGGG + Intergenic
954793470 3:53149329-53149351 CTCCTGAGGGGAGGAGGGAAGGG - Intergenic
955348187 3:58176212-58176234 CTCCCCAAGGCAGACTGGAAGGG + Intergenic
958952212 3:100428943-100428965 CTTTTGAAGGGAGTATGGATTGG + Intronic
961386789 3:126527288-126527310 CAGCTGAAGGGAGTCTGAATTGG - Intronic
962632599 3:137294478-137294500 TTCTGGAAGGGAGTCTGGCAGGG + Intergenic
962657845 3:137566732-137566754 CTCCTGACAGGAGTCAGTAATGG - Intergenic
963605412 3:147408801-147408823 CTCTTGAAGGGAGGGGGGAAGGG + Intronic
977916938 4:102604631-102604653 CTCCTGAAGAGAATCTAGTATGG + Intronic
980365933 4:131804482-131804504 CTCCTGAAGGGAGGAATGAAAGG - Intergenic
981563004 4:146067405-146067427 CTCTTGAAGGGAGTTCTGAATGG - Intergenic
983394609 4:167177568-167177590 CTCCAGAAGGCAGACTGGACTGG + Intronic
983412312 4:167416981-167417003 CTATTGTAGGGAGACTGGAAGGG - Intergenic
983655059 4:170074352-170074374 CTGCTGGGGGGAGTCAGGAAGGG - Intronic
987261761 5:16211424-16211446 CTCCTGATGGGTGACTGGCAAGG - Intergenic
989687812 5:44110073-44110095 CACCTGAAGGGGAGCTGGAAAGG - Intergenic
993994662 5:94708520-94708542 CATCTGAAGGGACTCTGGAAAGG + Exonic
997195563 5:131977016-131977038 CTCCTGAAGGAAGACGGGAGAGG - Intronic
997322798 5:132992701-132992723 GTCCTGAGGGGACTCTGAAAAGG - Intergenic
998442730 5:142175717-142175739 CACCTGGAGGGAGTCAGGAACGG + Intergenic
1000848879 5:166315662-166315684 ATCCAGAAGGCAGTCTGAAAGGG + Intergenic
1001499045 5:172214287-172214309 CACCTGAAATGAGTCTGGAATGG + Intronic
1003984040 6:11417466-11417488 CTCCTCAAGGGCGGCTGGAGTGG + Intergenic
1004919995 6:20367331-20367353 CTTCTGAAGGGTTTATGGAACGG - Intergenic
1006846110 6:37062696-37062718 CTGCTGAAGGGAGATTGTAAGGG - Intergenic
1008210618 6:48719925-48719947 CTCCTGACGGTTGTCTGTAATGG + Intergenic
1010352147 6:74887429-74887451 CTCCTGAAGGAAACATGGAAAGG - Intergenic
1011205064 6:84883590-84883612 CTGCTAAATGGAGTCTGCAATGG - Intergenic
1011897666 6:92251775-92251797 CCCTTGAAGGAAGTCTGAAAAGG - Intergenic
1014826223 6:126051213-126051235 TCCCTGAAGTGAGTTTGGAAGGG + Intergenic
1016378595 6:143450074-143450096 GTCCTGAAGGGAGTGAGGGAAGG + Intronic
1018818726 6:167356240-167356262 CTCCTGAAGGGAGTCTCGGGTGG - Intronic
1019383417 7:740144-740166 CTCCTTAAGGGAAGCGGGAACGG - Intronic
1020083577 7:5298968-5298990 CTCCTGGAGGGAGGATGGAGTGG - Exonic
1024450278 7:49531951-49531973 CTGCTGAAGCCAGTCTGTAAAGG + Intergenic
1025210706 7:57018225-57018247 CTCCTGGAGGGAGGATGGAGTGG + Intergenic
1025293729 7:57757763-57757785 GTCCTGAACGGACTCTGAAATGG + Intergenic
1025661250 7:63558622-63558644 CTCCTGGAGGGAGGATGGAGTGG - Intergenic
1026481545 7:70783950-70783972 TTCCTGAAGGAAGCCAGGAAAGG - Intronic
1026832076 7:73616356-73616378 CCGCTGGTGGGAGTCTGGAAGGG - Intronic
1027433331 7:78136609-78136631 GTCTTGAAGGGAGAATGGAAAGG - Intronic
1030278589 7:107745449-107745471 GTCCTGAAGTGAGATTGGAAAGG + Intronic
1030322133 7:108180212-108180234 CTCCAGAAGGAGGTATGGAATGG - Exonic
1032665071 7:134027982-134028004 CTCCTGACATGAGTCTGTAAGGG - Intronic
1033255830 7:139800469-139800491 CTACTGAAGGAAGTCCAGAAGGG - Intronic
1034172228 7:149071475-149071497 CTCCTGCAGGAAGTGTGGCAAGG - Exonic
1035170561 7:157015145-157015167 GGCCTTAAAGGAGTCTGGAAAGG + Intergenic
1037417429 8:18667088-18667110 CTCATAAAGGCAGTGTGGAAGGG + Intronic
1037608811 8:20459297-20459319 CTCAGGAAGGGAGGCTGGACAGG - Intergenic
1041787468 8:61650415-61650437 CTCATGAAGGGATTGTGGAGTGG - Intronic
1043500567 8:80850691-80850713 CTACTTAGGGGAGTCTGTAAAGG - Intronic
1043773191 8:84231031-84231053 CTTCTGGAGAAAGTCTGGAAAGG - Intronic
1044389534 8:91633352-91633374 CTGCTGAAGAGAGACTTGAAGGG + Intergenic
1045354758 8:101375506-101375528 CTCCTGCATTGACTCTGGAATGG + Intergenic
1045392040 8:101725399-101725421 CACCAGAAGGGAAGCTGGAAAGG - Intronic
1046799350 8:118408152-118408174 CTTATCAAGGGAGTCTGGTATGG - Intronic
1049177044 8:141200168-141200190 CTCCTAAAATGAGTTTGGAAGGG - Intergenic
1053410645 9:37914311-37914333 TTCCTGAAGGGAGGGAGGAAAGG - Intronic
1053630279 9:39930342-39930364 CTCCTGAAGGGAGGAATGAAAGG - Intergenic
1053775491 9:41533186-41533208 CTCCTGAAGGGAGGAATGAAAGG + Intergenic
1054213608 9:62320360-62320382 CTCCTGAAGGGAGGAATGAAAGG + Intergenic
1056358144 9:85823632-85823654 CACCTGAAGTGAGTCTAGAGGGG - Intergenic
1056567537 9:87787835-87787857 ATGCTGACGGGAGTCTGGAGAGG - Intergenic
1057762544 9:97888496-97888518 ATCATGAAGGGAAGCTGGAATGG + Intergenic
1060869274 9:127026741-127026763 CTCCTGAGGGGAGTCTGCCTGGG + Intronic
1061258236 9:129465187-129465209 CTGGTGAAGGGAGCTTGGAAGGG - Intergenic
1062365531 9:136206774-136206796 CTCCACAAGGGTTTCTGGAAAGG + Exonic
1187220029 X:17316324-17316346 CTCGTGAAATGAGTTTGGAAGGG - Intergenic
1189906282 X:45763357-45763379 TTCCTAAAGGGATTTTGGAAGGG + Intergenic
1192181145 X:68916516-68916538 CTCATGAAGGGAGTCCTGGAAGG - Intergenic
1194081963 X:89479709-89479731 CTCCTCAAGGTACTCTGAAAAGG + Intergenic
1194758312 X:97763840-97763862 CTCCTGAGAGGAGTCTTTAAAGG - Intergenic
1195694816 X:107659184-107659206 CCCCTGAAGGGAGGAAGGAAGGG - Intergenic
1195853050 X:109303961-109303983 CTCCTAGAGGCAGTCTGGATTGG + Intergenic
1196556311 X:117088593-117088615 CCCGAGAAGGGAGTCTGGACAGG + Intergenic
1200060665 X:153482385-153482407 CTCCTGCAGGGAGGCAGGTAGGG - Intronic
1200434635 Y:3135898-3135920 CTCCTCAAGGTACTCTGAAAAGG + Intergenic