ID: 1148105725

View in Genome Browser
Species Human (GRCh38)
Location 17:45117931-45117953
Sequence TGAGTGCGGACGGAGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105720_1148105725 7 Left 1148105720 17:45117901-45117923 CCTCTGGAAGGACGGAGGGCAGC 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1148105725 17:45117931-45117953 TGAGTGCGGACGGAGGTCATTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105725 Original CRISPR TGAGTGCGGACGGAGGTCAT TGG Intronic
906156177 1:43615307-43615329 TGAGTGTGGGTGGAGGCCATGGG - Intronic
917688719 1:177445468-177445490 TGAGTGCTAACTCAGGTCATTGG - Intergenic
1071514973 10:86291282-86291304 TCAGTGGGGATGGAGGTCAATGG - Intronic
1071604229 10:86973511-86973533 AGAGTGCGGAGTGAAGTCATGGG + Intronic
1083404659 11:62448258-62448280 TGAGTGTGGCTGGAAGTCATCGG + Intronic
1091783103 12:3226135-3226157 TGAGTGCAGAGGGAGGAGATGGG + Intronic
1094005347 12:25743147-25743169 TGACTGCAGACTAAGGTCATAGG - Intergenic
1094741238 12:33291399-33291421 GGAGTGCTGACTGAGGTCAAAGG + Intergenic
1103336579 12:120194619-120194641 TGGGTGCGGACGGTGGCCGTCGG - Intronic
1104049279 12:125185518-125185540 AGAGTGCGGAGGGAGGTCACAGG - Intergenic
1107190412 13:37577560-37577582 TGAGTGGGGAAGAAGTTCATTGG + Intronic
1108167875 13:47711677-47711699 TGAGGGAGGAAGGAGGGCATGGG - Intergenic
1108726576 13:53189858-53189880 TGAGTGTGGACGGATGACTTGGG - Intergenic
1122968292 14:105142080-105142102 TTAGTGGGGCCTGAGGTCATCGG - Exonic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1143350518 17:6284777-6284799 TGAGAGAGGACAGAGGTCCTTGG - Intergenic
1147462547 17:40582641-40582663 TGAGTGAGGACGGGGGTCTGAGG + Intergenic
1148105725 17:45117931-45117953 TGAGTGCGGACGGAGGTCATTGG + Intronic
1156248902 18:35331921-35331943 GGAGTTGGGATGGAGGTCATTGG + Intergenic
1157899441 18:51500363-51500385 AGAGTGTGGAGGGAGGTCTTAGG + Intergenic
1158578140 18:58657668-58657690 TGAGGGCGGAAGGAGCACATAGG - Intergenic
1159184797 18:64955649-64955671 TGAGTGCACAGGGAGGTCATAGG - Intergenic
1160343542 18:78110472-78110494 TGAGTGTGCACGGAGGTCAGAGG - Intergenic
948382443 2:237560049-237560071 GGAGTGAGCTCGGAGGTCATGGG - Intergenic
1175124105 20:56738896-56738918 TGAGGGCGCAAGGAGATCATGGG + Intergenic
1183071011 22:35396294-35396316 TTAGTGGAGACGGAGGTCACAGG + Intergenic
1184240995 22:43211218-43211240 TGAGGGTGGTGGGAGGTCATGGG - Intronic
982456242 4:155612248-155612270 TGAGTGCATAGGGAGTTCATGGG - Intergenic
1001616644 5:173048207-173048229 AGAGTGCAGACTGAAGTCATGGG + Intergenic
1006511994 6:34526445-34526467 GGAGTGGGGCCTGAGGTCATGGG - Intronic
1008336492 6:50311200-50311222 TGAGAGAGGAAGGAGGACATAGG - Intergenic
1008710081 6:54214444-54214466 TCAGTGCTGACAGTGGTCATGGG + Intronic
1019983995 7:4641976-4641998 GGAGTGGGGTCGGAGGTCAGAGG + Intergenic
1021760983 7:23903148-23903170 TGCGTGGGGAGGGAGGTGATGGG + Intergenic
1028461502 7:91098256-91098278 TCAGTTAGGTCGGAGGTCATGGG - Intronic
1031693434 7:124818656-124818678 TGAGTTCGGCTGGAGGTGATGGG + Intergenic
1035396366 7:158537616-158537638 TGAGTCAGGACAGAGGTCAAAGG + Intronic
1037317194 8:17610151-17610173 TGAGTGAGGACAGAGGACAAAGG - Intronic
1050411015 9:5364888-5364910 TGAGTTCATACGGATGTCATTGG - Intronic
1055165295 9:73184792-73184814 TGAATGCGGAGGGATGTCAATGG - Intergenic
1060482210 9:124023123-124023145 TGAGTTCGGACTGAGGACTTGGG + Intronic
1187788145 X:22916937-22916959 TGAGTGGGGAAGCAGGTCAAGGG - Intergenic
1193348671 X:80432312-80432334 TGAGGCCGGAAGGAGGTCCTGGG - Intronic