ID: 1148105950

View in Genome Browser
Species Human (GRCh38)
Location 17:45118956-45118978
Sequence GCTGAAGCGGCCGGAGCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105950_1148105958 19 Left 1148105950 17:45118956-45118978 CCTCCAGCTCCGGCCGCTTCAGC 0: 1
1: 0
2: 2
3: 24
4: 479
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105950_1148105961 29 Left 1148105950 17:45118956-45118978 CCTCCAGCTCCGGCCGCTTCAGC 0: 1
1: 0
2: 2
3: 24
4: 479
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105950 Original CRISPR GCTGAAGCGGCCGGAGCTGG AGG (reversed) Exonic