ID: 1148105951

View in Genome Browser
Species Human (GRCh38)
Location 17:45118959-45118981
Sequence GCTGCTGAAGCGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105951_1148105958 16 Left 1148105951 17:45118959-45118981 CCAGCTCCGGCCGCTTCAGCAGC 0: 1
1: 0
2: 0
3: 26
4: 337
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105951_1148105961 26 Left 1148105951 17:45118959-45118981 CCAGCTCCGGCCGCTTCAGCAGC 0: 1
1: 0
2: 0
3: 26
4: 337
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105951 Original CRISPR GCTGCTGAAGCGGCCGGAGC TGG (reversed) Exonic