ID: 1148105952

View in Genome Browser
Species Human (GRCh38)
Location 17:45118965-45118987
Sequence GCGGCGGCTGCTGAAGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 668}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105952_1148105958 10 Left 1148105952 17:45118965-45118987 CCGGCCGCTTCAGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 79
4: 668
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105952_1148105964 25 Left 1148105952 17:45118965-45118987 CCGGCCGCTTCAGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 79
4: 668
Right 1148105964 17:45119013-45119035 CTAGACGGTCGTTGTTGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
1148105952_1148105961 20 Left 1148105952 17:45118965-45118987 CCGGCCGCTTCAGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 79
4: 668
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105952 Original CRISPR GCGGCGGCTGCTGAAGCGGC CGG (reversed) Exonic