ID: 1148105954

View in Genome Browser
Species Human (GRCh38)
Location 17:45118969-45118991
Sequence TCCTGCGGCGGCTGCTGAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105954_1148105961 16 Left 1148105954 17:45118969-45118991 CCGCTTCAGCAGCCGCCGCAGGA 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105954_1148105958 6 Left 1148105954 17:45118969-45118991 CCGCTTCAGCAGCCGCCGCAGGA 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105954_1148105964 21 Left 1148105954 17:45118969-45118991 CCGCTTCAGCAGCCGCCGCAGGA 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1148105964 17:45119013-45119035 CTAGACGGTCGTTGTTGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105954 Original CRISPR TCCTGCGGCGGCTGCTGAAG CGG (reversed) Exonic