ID: 1148105955

View in Genome Browser
Species Human (GRCh38)
Location 17:45118981-45119003
Sequence AGATCGAGGAGTTCCTGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105955_1148105966 22 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105966 17:45119026-45119048 GTTGGAGTGGTCACACTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 85
1148105955_1148105965 21 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105965 17:45119025-45119047 TGTTGGAGTGGTCACACTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 119
1148105955_1148105958 -6 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105955_1148105961 4 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105955_1148105964 9 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105964 17:45119013-45119035 CTAGACGGTCGTTGTTGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
1148105955_1148105967 23 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105967 17:45119027-45119049 TTGGAGTGGTCACACTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105955 Original CRISPR AGATCGAGGAGTTCCTGCGG CGG (reversed) Exonic