ID: 1148105956

View in Genome Browser
Species Human (GRCh38)
Location 17:45118984-45119006
Sequence CTGAGATCGAGGAGTTCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105956_1148105967 20 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105967 17:45119027-45119049 TTGGAGTGGTCACACTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 106
1148105956_1148105964 6 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105964 17:45119013-45119035 CTAGACGGTCGTTGTTGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
1148105956_1148105961 1 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105956_1148105958 -9 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105958 17:45118998-45119020 CGATCTCAGCCCCCTCTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1148105956_1148105968 29 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105968 17:45119036-45119058 TCACACTCCTGGGGAGCAGCAGG 0: 1
1: 0
2: 3
3: 31
4: 273
1148105956_1148105965 18 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105965 17:45119025-45119047 TGTTGGAGTGGTCACACTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 119
1148105956_1148105966 19 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105966 17:45119026-45119048 GTTGGAGTGGTCACACTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105956 Original CRISPR CTGAGATCGAGGAGTTCCTG CGG (reversed) Exonic