ID: 1148105957

View in Genome Browser
Species Human (GRCh38)
Location 17:45118995-45119017
Sequence TCTAGAGGGGGCTGAGATCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105957_1148105968 18 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105968 17:45119036-45119058 TCACACTCCTGGGGAGCAGCAGG 0: 1
1: 0
2: 3
3: 31
4: 273
1148105957_1148105967 9 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105967 17:45119027-45119049 TTGGAGTGGTCACACTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 106
1148105957_1148105966 8 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105966 17:45119026-45119048 GTTGGAGTGGTCACACTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 85
1148105957_1148105965 7 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105965 17:45119025-45119047 TGTTGGAGTGGTCACACTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 119
1148105957_1148105964 -5 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105964 17:45119013-45119035 CTAGACGGTCGTTGTTGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
1148105957_1148105961 -10 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105957 Original CRISPR TCTAGAGGGGGCTGAGATCG AGG (reversed) Exonic