ID: 1148105961

View in Genome Browser
Species Human (GRCh38)
Location 17:45119008-45119030
Sequence CCCCTCTAGACGGTCGTTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148105957_1148105961 -10 Left 1148105957 17:45118995-45119017 CCTCGATCTCAGCCCCCTCTAGA 0: 1
1: 1
2: 0
3: 7
4: 113
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105954_1148105961 16 Left 1148105954 17:45118969-45118991 CCGCTTCAGCAGCCGCCGCAGGA 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105950_1148105961 29 Left 1148105950 17:45118956-45118978 CCTCCAGCTCCGGCCGCTTCAGC 0: 1
1: 0
2: 2
3: 24
4: 479
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105951_1148105961 26 Left 1148105951 17:45118959-45118981 CCAGCTCCGGCCGCTTCAGCAGC 0: 1
1: 0
2: 0
3: 26
4: 337
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105955_1148105961 4 Left 1148105955 17:45118981-45119003 CCGCCGCAGGAACTCCTCGATCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105956_1148105961 1 Left 1148105956 17:45118984-45119006 CCGCAGGAACTCCTCGATCTCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
1148105952_1148105961 20 Left 1148105952 17:45118965-45118987 CCGGCCGCTTCAGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 79
4: 668
Right 1148105961 17:45119008-45119030 CCCCTCTAGACGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148105961 Original CRISPR CCCCTCTAGACGGTCGTTGT TGG Exonic