ID: 1148106733

View in Genome Browser
Species Human (GRCh38)
Location 17:45122864-45122886
Sequence CTGGGTAAACGGAGAGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148106725_1148106733 18 Left 1148106725 17:45122823-45122845 CCAAAGATTTTTGAGTCAGAGGA 0: 1
1: 0
2: 2
3: 11
4: 244
Right 1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148106733 Original CRISPR CTGGGTAAACGGAGAGTCCA TGG Intronic
900958582 1:5904823-5904845 CTGGGTTAACTGAGTATCCATGG + Intronic
901842660 1:11963888-11963910 CTGGGTAATAGGTGAGGCCAAGG - Intronic
902092148 1:13912170-13912192 CTGGGTAAAGGGGGTGCCCAGGG - Intergenic
905902396 1:41590218-41590240 CTGGGCAAAGAGAGAGGCCAAGG + Intronic
915106936 1:153540658-153540680 CAGGGCAAAGAGAGAGTCCAGGG + Intronic
917510269 1:175663813-175663835 CTGGGGAACTGGAGAGTCCAAGG + Intronic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
923247024 1:232142616-232142638 CTGGGTACATGGAAATTCCAGGG - Intergenic
1071170541 10:82858859-82858881 CTAGGTATGTGGAGAGTCCATGG - Intronic
1075078927 10:119369902-119369924 CTGGGTAAACGGAGGGTCAGGGG - Intronic
1075115915 10:119627164-119627186 CTCGCTAAACAGAGAGGCCAGGG - Intergenic
1075745322 10:124723586-124723608 ATGGGAAAACTGAGAGCCCAGGG + Intronic
1076565580 10:131396724-131396746 ATGGGAAAAAGGAGAATCCATGG - Intergenic
1085540951 11:77269150-77269172 CTGAGTAAACCCACAGTCCATGG + Intronic
1086392848 11:86383175-86383197 CTGGGTAAAAGTTGAGTCCATGG + Intronic
1089615276 11:119691569-119691591 CTGGGGAAAGGGAAAGCCCAGGG - Intronic
1090113064 11:123937270-123937292 CTGAGTAAACCGAAAGTCAATGG - Intergenic
1090819289 11:130326548-130326570 CTGGGAGAAGGCAGAGTCCATGG - Intergenic
1096752634 12:53771758-53771780 CTGGGTAAACAGAAACTCCGTGG - Intergenic
1097486181 12:60204671-60204693 CTGGGGAAACTTAAAGTCCATGG + Intergenic
1098385196 12:69910885-69910907 CTGCGGAAACGGAGAGACCTTGG + Intronic
1098987706 12:77030244-77030266 CTGGGTCAACAGAGAGGACAGGG + Exonic
1099422477 12:82479694-82479716 CTGAGTAAACCAAGAGTCAATGG + Intergenic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1101312341 12:103593504-103593526 GTGGGCAGAAGGAGAGTCCAAGG - Intronic
1105229991 13:18484840-18484862 GTTGGTAAACGGAGAATCCCAGG - Intergenic
1107013792 13:35693404-35693426 CTGAGTAAATGGAGAGACCTGGG + Intergenic
1107424050 13:40275386-40275408 ATGGGTAAACATAGAGTCCTGGG - Intergenic
1107640651 13:42439916-42439938 GTGGGTACACAGACAGTCCAGGG + Intergenic
1114782565 14:25554694-25554716 CAGGGTAAAGGGAGAGTCTTTGG + Intergenic
1116825102 14:49665517-49665539 CTGGATAAACGGAGAGTACTGGG - Intronic
1124825490 15:33090528-33090550 CTGAGAAAAATGAGAGTCCAGGG + Intronic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1128502332 15:68235309-68235331 CTGCCTGAACGGAGAGGCCATGG + Intronic
1129268032 15:74404468-74404490 CTGGGTATCAGGAGAGTCCCAGG + Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1133173969 16:3999672-3999694 CTGGGTAACCTGAGATTCCCTGG + Intronic
1134017043 16:10895904-10895926 CTGGAGGAACGGAGACTCCAGGG + Intronic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1136068538 16:27774772-27774794 CTGGGGAAACGGGGAGTGCCGGG - Intronic
1138998160 16:62477845-62477867 CTGGGAGCAGGGAGAGTCCAGGG - Intergenic
1146739298 17:35267946-35267968 CTGTGTCCACGGAGAGTCCCTGG - Exonic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1152230730 17:79112838-79112860 CTGGGTCCAGGGAGCGTCCAGGG + Intronic
1152684082 17:81685209-81685231 CTGGGCGAACGGGGACTCCAAGG + Intronic
1154059005 18:11041076-11041098 CTCTGAAAACGGACAGTCCAAGG + Intronic
1154224589 18:12491519-12491541 CTGGGTGAACCAAGATTCCATGG - Intronic
1157566400 18:48681596-48681618 CTGGGCTAAAGGAAAGTCCAGGG - Intronic
1158981183 18:62763432-62763454 CTGGCAAAAGGTAGAGTCCAGGG - Intronic
1160361454 18:78285483-78285505 GTGGGTAAACGGTGAGTCTTGGG - Intergenic
1160723512 19:607714-607736 CTGGGGAAACTGAGACCCCAAGG - Intronic
1161464267 19:4419313-4419335 CTCAGTAAACGCAGAGCCCATGG - Intronic
1167932443 19:52877146-52877168 CTGGGGACAGGGAGAGTCTAAGG + Exonic
927519293 2:23689441-23689463 CTGGGCAGACGGACAGTCCATGG - Intronic
927845018 2:26466970-26466992 CTGAGTCATGGGAGAGTCCAGGG + Intronic
928092753 2:28385853-28385875 CTGTGTAACAGGAAAGTCCAGGG + Intergenic
931609401 2:64082249-64082271 GTGGGTAAATGGAGAGTAAAAGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
941388704 2:164885081-164885103 CTGGGTAACCGAAGAATTCATGG - Intergenic
944041326 2:195358177-195358199 CAGTGTAAAAGGAGAGTCCAAGG + Intergenic
946129394 2:217594080-217594102 CTGGTTAAACTCAGAGGCCAAGG + Intronic
947587090 2:231363024-231363046 CTGGGTATACGGGGAATGCAGGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
1168754009 20:303320-303342 CTGGGTCAGAGGAGAGCCCAAGG + Intergenic
1173599030 20:44279787-44279809 CTGGATAACCGGAGACCCCATGG + Exonic
1176140883 20:63544566-63544588 CAGGGCTAACGGAGAGCCCACGG - Intronic
1177168362 21:17628388-17628410 CTGGGAACCAGGAGAGTCCATGG + Intergenic
1179959687 21:44761060-44761082 CTGGAGAAGGGGAGAGTCCAGGG + Intergenic
1180904732 22:19401456-19401478 CTGGGTATGAGCAGAGTCCAAGG - Intronic
1181032945 22:20157040-20157062 CTGGGTGGAGGGAGAGACCAGGG + Intergenic
954466631 3:50659000-50659022 CGGGGTAACCCCAGAGTCCAGGG - Intergenic
954784432 3:53082555-53082577 CTGTGTAATCAGACAGTCCAGGG + Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
963151592 3:142051184-142051206 CTGGGTAGAGGTAGAGGCCAGGG - Intronic
975318024 4:72977800-72977822 TTAGGTAAAGGGAGATTCCAAGG + Intergenic
985627597 5:997909-997931 CTGGGAAAAGGCACAGTCCACGG + Intergenic
992506853 5:77395562-77395584 ATGGCAAAACGGAGAGTCAAAGG - Intronic
994620116 5:102153213-102153235 CTGTGTAAAAGCAGAATCCACGG + Intergenic
995061406 5:107814962-107814984 ATGAGTAAACGGAGACTCAAAGG + Intergenic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
999077270 5:148808005-148808027 CTGGGTAAACAGAGCAGCCACGG - Intergenic
1000478135 5:161737805-161737827 TTGGGTAAACAGGGATTCCAAGG + Intergenic
1004850294 6:19691916-19691938 CTGGGAAAAGGGAGAGCCCTCGG - Intergenic
1005943432 6:30578398-30578420 TGTGGTAAACGGAGACTCCAAGG + Intronic
1011552489 6:88542544-88542566 ATGGCTAAACTGGGAGTCCAAGG + Intergenic
1015356874 6:132287669-132287691 CAGTGTAAAATGAGAGTCCATGG - Intergenic
1023658658 7:42451423-42451445 CTTGGCAAGAGGAGAGTCCATGG + Intergenic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1024835551 7:53514000-53514022 CAGGTTAAACACAGAGTCCATGG + Intergenic
1031076927 7:117221927-117221949 TTGGGTAAACTGAGACTTCATGG - Exonic
1036766048 8:11549932-11549954 CTAGGAAAACAGTGAGTCCAGGG + Intronic
1041963804 8:63650793-63650815 ATGGATAAACGGAGAGACTAAGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1048349450 8:133604177-133604199 CTGGGTGAACAGACAGTCCCAGG - Intergenic
1049175645 8:141190853-141190875 CTGGGTCCACGGAGAGTCCCAGG - Intronic
1049658149 8:143807935-143807957 CTGGGCAAACTCAGATTCCAGGG - Intronic
1051525309 9:18036326-18036348 CAGAGTATACGGAGAATCCACGG - Intergenic
1057919941 9:99088983-99089005 CTCGTTAAACATAGAGTCCATGG + Intergenic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1187366235 X:18667701-18667723 CTGAGCAAACCTAGAGTCCAAGG + Intronic
1187677655 X:21733884-21733906 CTGGACAAATGGAGTGTCCAGGG - Intronic