ID: 1148109243

View in Genome Browser
Species Human (GRCh38)
Location 17:45135575-45135597
Sequence CTGTGCTGAATGGTTGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148109237_1148109243 30 Left 1148109237 17:45135522-45135544 CCCCGCCTGATTGGGAAAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 155
1148109240_1148109243 25 Left 1148109240 17:45135527-45135549 CCTGATTGGGAAAGGCTCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 155
1148109239_1148109243 28 Left 1148109239 17:45135524-45135546 CCGCCTGATTGGGAAAGGCTCTG 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 155
1148109238_1148109243 29 Left 1148109238 17:45135523-45135545 CCCGCCTGATTGGGAAAGGCTCT 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148109243 Original CRISPR CTGTGCTGAATGGTTGAGGT AGG Exonic
902313425 1:15599490-15599512 CTCTGCTGAATGCTAGAGGCGGG - Intergenic
908797434 1:67845075-67845097 CTGTGCTGGAGGGTTGAGTCCGG + Intergenic
916801610 1:168221416-168221438 CTGTCCTGATTGGTTCAGCTAGG + Intergenic
917168553 1:172143409-172143431 CTGTGCTGAACTTTAGAGGTCGG - Intronic
917697271 1:177538552-177538574 CTGTGTTGAATAGGGGAGGTGGG - Intergenic
920048580 1:203149616-203149638 CGGGGCTGAGTGGTTGAGGCGGG + Intronic
920060756 1:203225498-203225520 CTGTGCTTAATGAAAGAGGTAGG - Intronic
921883465 1:220279635-220279657 ATGTGTAGGATGGTTGAGGTGGG - Intergenic
1062799073 10:366351-366373 CTGTGCAGAACGGATGAGATCGG - Exonic
1063714738 10:8515486-8515508 CTGTGCTGAATGAATTAGGCAGG - Intergenic
1067477310 10:46575614-46575636 CTGTGCTGAATGGCAGATGAAGG - Intergenic
1067617429 10:47766167-47766189 CTGTGCTGAATGGCAGATGAAGG + Intergenic
1070775553 10:79107819-79107841 CTCTGCTGTAGGGTGGAGGTGGG + Intronic
1072629151 10:97133786-97133808 CTGTGCTGAAGGGTTTGGGGAGG + Intronic
1073428089 10:103468517-103468539 CTGTGCTGACTGGCTGTGATGGG - Intergenic
1076757232 10:132578920-132578942 CTGTGGTGCAGGGTAGAGGTCGG + Intronic
1077107182 11:847317-847339 CTGGGCTGGATGGTTGTGGTGGG + Intronic
1077160531 11:1110508-1110530 CTGTACTGTGTGGTTTAGGTTGG + Intergenic
1080952618 11:37052941-37052963 GTGTACTGAATGATTAAGGTAGG + Intergenic
1080966992 11:37224721-37224743 GTATGCTGATTGGTTGTGGTTGG + Intergenic
1083013435 11:59426128-59426150 TGCTGCTGAATGGATGAGGTAGG + Intergenic
1083553326 11:63607087-63607109 CTGTGCTGATGGAATGAGGTGGG + Intronic
1086413861 11:86569442-86569464 CTGTGTGGAATGGTGGAGGCAGG - Intronic
1086657292 11:89374893-89374915 CTGTGCTGACTAGTTAATGTAGG + Intronic
1087662087 11:100999971-100999993 CTGTTCTGAATGGTTAATTTAGG + Intergenic
1089438564 11:118494201-118494223 CTGTGCTGGATGATTAAGGAGGG + Intronic
1095493211 12:42757835-42757857 CTGTGCTGGATGCTAGAGCTAGG - Intergenic
1095972235 12:47910223-47910245 CTGGTCTCAATGGTTGGGGTTGG - Intronic
1101717314 12:107321761-107321783 CTGTGCTTTTTGGTGGAGGTAGG - Intronic
1102068445 12:109998324-109998346 CTGTGGAGAATGGATTAGGTTGG + Intergenic
1105786932 13:23759375-23759397 CTGTGCTGTCTGGTGGGGGTGGG - Intronic
1109286087 13:60409637-60409659 CTGTTCCAAATGGGTGAGGTTGG - Intronic
1109794140 13:67287741-67287763 CTTTGCTGAATGATGGTGGTGGG + Intergenic
1110779453 13:79447913-79447935 CGGTAATGAATGGTTGAAGTGGG + Intergenic
1113456768 13:110455001-110455023 CAGTACAGAATGGGTGAGGTAGG - Intronic
1118528223 14:66670117-66670139 CTTTGCTCCAAGGTTGAGGTGGG + Intronic
1124393887 15:29283603-29283625 CTGTGCTGCATTGTTTTGGTGGG - Intronic
1124630614 15:31334834-31334856 CTGTGCTGTGTGGCTGAGGTTGG + Intronic
1125267504 15:37900342-37900364 TTGTCTTGAATGGTTGTGGTGGG - Intergenic
1125845001 15:42843948-42843970 CACTGCTGATTGGTTGAGTTGGG - Intronic
1128110675 15:65074232-65074254 CTGAGCTGAAGGGGTGAGGTGGG + Intronic
1128308821 15:66617822-66617844 CTGTGGTGAGAGGCTGAGGTGGG - Intronic
1129051876 15:72787649-72787671 CTTTGCAGAATGGTTGTGGGAGG + Intergenic
1132783740 16:1642829-1642851 CTTTGCTGTATGCTTGAGGACGG + Intronic
1132928992 16:2449020-2449042 CTGTGCTGGAGGGTGGGGGTGGG + Intronic
1136994591 16:35181198-35181220 CTCAGCTGAATGGATGAGGCAGG + Intergenic
1137697415 16:50470358-50470380 CTGTGCTGACTGGTAGAGTTTGG + Intergenic
1138090975 16:54174455-54174477 CAGTGCTGATTGGTGGCGGTGGG - Intergenic
1139558700 16:67728512-67728534 CTGTGGGGAGGGGTTGAGGTGGG + Intronic
1140716160 16:77727511-77727533 CTGTGCTTATTGGCAGAGGTGGG - Intronic
1142411140 16:89917858-89917880 CTGTGCTGAAGGGTGGAAGCGGG - Exonic
1145011452 17:19370659-19370681 CTGTGCTGAATGGTGGAAGCAGG + Intronic
1145190410 17:20837311-20837333 CTTTGCTGCATGGTAGTGGTAGG - Intronic
1145825001 17:27870254-27870276 CTGTGCTGGAAGGTTCAGGAAGG - Intronic
1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG + Exonic
1148725838 17:49789228-49789250 CTCTCCTGATTGGTCGAGGTTGG + Intronic
1148991095 17:51668033-51668055 CTTTGCTGAATGGTTGGGCCTGG - Intronic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151495757 17:74457249-74457271 CTGTGGTGCAGGGTTGGGGTAGG + Intergenic
1152576255 17:81142581-81142603 CTCTGCTGAGAGGTTGGGGTGGG + Intronic
1156869971 18:41934060-41934082 CTTTGCTGGAGGGTTGGGGTTGG + Intergenic
1159940197 18:74400943-74400965 CTGTTTTGAATGCTTGATGTAGG - Intergenic
1160340828 18:78087429-78087451 AGGTGCTGGATGCTTGAGGTGGG + Intergenic
1163598215 19:18232828-18232850 CTCTGCTGCTTGGTTGAGGCTGG - Intronic
1166219699 19:41356474-41356496 CGGTGCTGTGTGGGTGAGGTGGG - Intronic
1167594021 19:50418133-50418155 CTGTGCTGCCTGGTTCATGTGGG + Intronic
1167807186 19:51796109-51796131 CTTTGCAGAGTGGGTGAGGTGGG + Intronic
926141757 2:10372246-10372268 CTGTGCTGTGTGGCTAAGGTGGG + Intronic
927850044 2:26493248-26493270 CTGGGCTGAAGGGCAGAGGTGGG + Intronic
928482687 2:31698423-31698445 CTGGGCAGAATTGTTGGGGTGGG - Intergenic
928495750 2:31829766-31829788 CTGTGCTGAGGAGTTGAGATGGG + Intergenic
929593880 2:43163583-43163605 CTGTGCAGAGTTGTTGAAGTTGG - Intergenic
933280667 2:80329612-80329634 CTGTCCTGACTTGTTAAGGTAGG - Intronic
941466704 2:165836988-165837010 CTGTGTTATATGGTGGAGGTGGG + Intergenic
942409043 2:175687442-175687464 CTGAGGTGAATGGTTGGGCTTGG - Intergenic
943198261 2:184784133-184784155 CTGTGCTTCATGTTTTAGGTGGG + Intronic
947145480 2:227060188-227060210 CTGGGCTGAGTGGTTCAGATGGG - Exonic
949018800 2:241728850-241728872 CTGTGCAGACTGGTGGCGGTGGG + Exonic
1168799822 20:637234-637256 CTGTGTAGAATGGATGAGATAGG - Intergenic
1170330862 20:15209024-15209046 CTGTGCTGTATGGTTGGAATAGG + Intronic
1172194105 20:33080300-33080322 CTGTGCTGACTCTCTGAGGTTGG + Intronic
1175112233 20:56656737-56656759 CTGGGCTGGCTGGTGGAGGTGGG + Intergenic
1178145023 21:29729240-29729262 GTTTGGTGAATGGTTGAGGCTGG + Intronic
1178508116 21:33179587-33179609 CTGTGCAGAATGGGTGGGGTTGG - Intergenic
1180613234 22:17110928-17110950 CTGAGCTGAAGGATTGTGGTTGG + Exonic
1180746834 22:18095161-18095183 CAGGGCTGAAGGGTGGAGGTGGG + Exonic
1181995444 22:26877253-26877275 CTTGCCTGAATGCTTGAGGTGGG + Intergenic
1182421049 22:30248759-30248781 CTGGGCAGAATGGTAGATGTAGG - Intergenic
1184986678 22:48140675-48140697 CTGGGCTGGATGTTTCAGGTTGG - Intergenic
1185099447 22:48829889-48829911 TTGTGTGGCATGGTTGAGGTAGG + Intronic
950476481 3:13218266-13218288 CTGTGCTGAATCCTTGAAGTTGG + Intergenic
951756006 3:26092022-26092044 CTGTAATGAAAGGCTGAGGTGGG + Intergenic
957142479 3:76379044-76379066 CTGTGCTTAATGATGGAGGGTGG + Intronic
958530824 3:95328750-95328772 CTGTGTTGAATAGTTCAGGGAGG + Intergenic
959369094 3:105500880-105500902 GGGCTCTGAATGGTTGAGGTTGG - Intronic
960995734 3:123339040-123339062 CTGTGCTGAGTGGTGGATGGTGG + Intronic
961701980 3:128751519-128751541 CTGTTCTGAATGGTAGAAATTGG - Intronic
962258274 3:133886946-133886968 CTCTGCTGAATGGATGGTGTTGG - Intronic
963414819 3:144982237-144982259 CTGTACTGAAGGGCTGAGGCAGG - Intergenic
964554499 3:157921320-157921342 CTGTACTGAAAGGTTGAACTCGG - Intergenic
964879600 3:161408877-161408899 CTGTGGTAAATGGTGCAGGTGGG + Intergenic
967962941 3:194940011-194940033 CTGTGGTGCCTGGTTCAGGTCGG - Intergenic
968041823 3:195595276-195595298 CTATGCTGCATGGCTGAGCTGGG - Intergenic
970620616 4:17813994-17814016 CTGTACTTAATAATTGAGGTAGG + Intronic
974488258 4:62531450-62531472 GTGTGCTGAATAGCTGAGTTTGG + Intergenic
979891065 4:126095756-126095778 TAATGCTGAATGCTTGAGGTGGG - Intergenic
984042304 4:174750035-174750057 CAGTGATGGAAGGTTGAGGTGGG - Intronic
985757464 5:1727519-1727541 TTGGCCTGAATGGTTGATGTTGG + Intergenic
986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG + Intronic
986357575 5:6943609-6943631 TTGTGCTGAATGCTGGCGGTAGG + Intergenic
989239678 5:39189535-39189557 CTGTGTTGAAGGGTTCAGCTTGG + Intronic
993137067 5:83982867-83982889 CTGTGCTGAATTGTTCAGGTTGG + Intronic
993281610 5:85932458-85932480 ATGTGCTGAATGGTCTGGGTGGG - Intergenic
994068749 5:95574004-95574026 CTGGGCAGAATAGTTGGGGTGGG - Intronic
995309143 5:110691388-110691410 ATGTGATGAATGGTTTAGGAAGG + Intronic
997491117 5:134276956-134276978 CTTTGCTGAGTTGATGAGGTAGG - Intergenic
999531060 5:152464065-152464087 CTGTCCTGAATGGTGGGGGTTGG - Intergenic
999622877 5:153490410-153490432 GTGTGCAGAAAGGTGGAGGTGGG - Intronic
999734803 5:154505274-154505296 CTGTGCTGAATGCTTGGGAATGG + Intergenic
1003319930 6:5042442-5042464 CTGTGCTGAAAGGTTGTTGAAGG - Intergenic
1004793209 6:19051500-19051522 GTGTGCTCTGTGGTTGAGGTGGG - Intergenic
1005096154 6:22118797-22118819 ACGTGCTTAATGGTGGAGGTGGG - Intergenic
1005249022 6:23923096-23923118 CTGTGCTTAATAATTGAAGTTGG - Intergenic
1006006621 6:31007633-31007655 CTGTGCTGAAAGTTTGATTTAGG - Intergenic
1006541203 6:34741319-34741341 CTGTTGTGAAGGGTAGAGGTGGG - Intergenic
1007065239 6:38984385-38984407 CTCTGCTGTATGCTTGAGTTTGG - Intronic
1007780998 6:44254700-44254722 CTGTGCAGAAGGTTTGAGGGTGG - Exonic
1007875380 6:45094174-45094196 CTGTGCTGAACGTTTTAGTTCGG - Intronic
1007921324 6:45612149-45612171 CAGTGCTTAATGGGGGAGGTGGG + Intronic
1008430980 6:51416399-51416421 ATGTGCTGAGTGGTTTGGGTTGG + Intergenic
1009866613 6:69406045-69406067 CTGCTGTGAATGGTTGATGTAGG - Intergenic
1010817703 6:80378153-80378175 ATGTGCATAATGGTTGAGATTGG + Intergenic
1012601003 6:101096779-101096801 CTGTGGGGCTTGGTTGAGGTGGG - Intergenic
1014750829 6:125254061-125254083 CTGTGCTAAATGCTTTATGTAGG - Intronic
1015703092 6:136057469-136057491 ATGTTCTGAATGGTTTAGGGTGG + Intronic
1019362820 7:614202-614224 CAGTCCTGAGTGGCTGAGGTTGG - Intronic
1020680809 7:11234377-11234399 CTGTGCTGAATTCTGGAGGGAGG + Intergenic
1023313464 7:38910990-38911012 CTATGCTGAATGGATGAGATTGG + Intronic
1026225539 7:68436914-68436936 ATGTGTTGAAAGGGTGAGGTGGG - Intergenic
1026874358 7:73871015-73871037 CTGTGCTAGATGGGTGAGGATGG + Intergenic
1027821245 7:83047907-83047929 CTGTGGTGTATCCTTGAGGTGGG - Intronic
1030625799 7:111844792-111844814 CTGAGCTGGATGGCTGAGGTCGG + Exonic
1030980408 7:116179450-116179472 CTGTGCTGACTTGTTTATGTTGG - Intergenic
1033053755 7:138030723-138030745 CTGGGCTCAATGTTGGAGGTGGG - Intronic
1035026452 7:155829901-155829923 CTGTGCTGAAGGCTTCATGTGGG - Intergenic
1036759622 8:11498301-11498323 CTGTGCTTAATAGATGAAGTGGG + Intronic
1037040883 8:14231293-14231315 CTGTCTTGAATGTTGGAGGTGGG + Intronic
1039925915 8:41932376-41932398 CTGTGCTGTCTGGTTCATGTAGG + Exonic
1041213758 8:55579367-55579389 CTCTGCTGAATGGTTATTGTGGG + Intergenic
1049383091 8:142327155-142327177 CTGCGGTGAATGTTTGCGGTAGG - Intronic
1050807622 9:9701582-9701604 GTCTTCTGAATGGTAGAGGTGGG + Intronic
1051903303 9:22065722-22065744 CTGCACTGAATAATTGAGGTAGG - Intergenic
1055514738 9:77023251-77023273 CTGTGCTAAAGGGTGGAGGGCGG - Intergenic
1056759402 9:89404642-89404664 CTGAGGTGAGTGGCTGAGGTCGG - Intronic
1059346939 9:113635448-113635470 CTGTGCTACATGGTGGTGGTCGG + Intergenic
1059599151 9:115757423-115757445 ATATGCTGAATGAGTGAGGTTGG - Intergenic
1059803681 9:117775679-117775701 CTGGGCTGAATGGAAGAGGAAGG - Intergenic
1060680254 9:125556378-125556400 CTCTGCTGAAAGATTGAGGCTGG - Intronic
1060780538 9:126409059-126409081 CTCAGCAGAATGGTGGAGGTGGG - Intronic
1061103209 9:128508292-128508314 CTGGGGAGACTGGTTGAGGTGGG + Intronic
1061603966 9:131694400-131694422 CTGTGTTGTATGGTTCAGATGGG + Intronic
1189166233 X:38863801-38863823 CCTTGCTGAGTGGCTGAGGTAGG + Intergenic
1189645452 X:43124395-43124417 CTCTGCTGAATAATTGAAGTTGG + Intergenic
1194885658 X:99313315-99313337 CTCTGCTGAATACTTGAGGGAGG - Intergenic
1196350863 X:114727342-114727364 TTGTGAAGAATAGTTGAGGTAGG + Intronic
1196501090 X:116383377-116383399 CTCTGCTGAATACTTAAGGTAGG + Intergenic
1199192549 X:144987804-144987826 CTGGGCTTAATAGTTGAGATTGG + Intergenic
1199748314 X:150790460-150790482 CTGTACTGAATGGATGAGGAAGG + Intronic